Phenotypic Mutation 'gummi_bear'

• Allele: gummi_bear
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 3,211,770 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Insr
• Gene Name: insulin receptor
• Synonym(s): 4932439J01Rik, D630014A15Rik, IR, IR-B, IR-A, CD220
• Chromosomal Location: 3,200,922-3,329,649 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of transmembrane signaling proteins that play important roles in cell differentiation, growth and metabolism. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta chains that form a disulfide-linked heterodimer which, in turn homodimerizes to form a mature, functional receptor. Mice lacking the encoded protein develop severe hyperglycemia and hyperketonemia, and die within a couple of days after birth as a result of diabetic ketoacidosis. [provided by RefSeq, Aug 2016] ; PHENOTYPE: Null mutants grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers. Tissue specific knockouts show milder lipid metabolism anomalies. Point mutation heterozygotes exhibit hyperglycemia, hyperinsulinemia and glucosuria. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Serine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000088837]
• AlphaFold: P15208
• PDB Structure: 1.35A crystal structure of H-2Kb complexed with the GNYSFYAL peptide [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000088837; Gene: ENSMUSG00000005534; AA Change: S1084P

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Recep_L_domain	52	164	5e-28	PFAM
FU	231	274	1.66e-10	SMART
Pfam:Recep_L_domain	359	473	2.5e-30	PFAM
FN3	496	602	4.02e1	SMART
FN3	624	821	1.16e-6	SMART
FN3	841	924	3.17e-4	SMART
transmembrane domain	947	969	N/A	INTRINSIC
TyrKc	1013	1280	3.11e-134	SMART
low complexity region	1303	1315	N/A	INTRINSIC
low complexity region	1327	1336	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000091291)
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9433
• Is this an essential gene?: Probably essential (E-score: 0.880)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:48 PM by Diantha La Vine
• Record Created: 2014-06-15 1:08 PM by Emre Turer
• Record Posted: 2018-10-25
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_010568, NM_001330056; MGI:96575

Alleles Listed at MGI

All Mutations and Alleles(19) : Chemically induced (ENU)(3) Gene trapped(2) Targeted(8) Transgenic(6)

Phenotypic Description

Figure 1. Gummi bear mice exhibited susceptibility to DSS-induced colitis by day 7. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The gummi bear phenotype was identified among G3 mice of the pedigree R0480, some of which showed susceptibility to low-dose DSS-induced colitis at day 7 (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the susceptibility to DSS-induced colitis using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 113 mutations (X-axis) identified in the G1 male of pedigree R0480. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 3. CRISPR- Insr mice exhibited susceptibility to DSS-induced colitis by day 7. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 113 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Insr: a T to C transition at base pair 3,161,770 (v38) on chromosome 8, or base pair 117,880 in the GenBank genomic region NC_000074 encoding Insr. The strongest association was found with a recessive model of inheritance to the raw DSS-induced susceptibility phenotype, wherein one variant homozygote departed phenotypically from 12 homozygous reference mice and 8 heterozygous mice with a P value of 2.779 x 10^-8  (Figure 2).

The mutation corresponds to residue 3,739 in the mRNA sequence NM_010568 within exon 17 of 21 total exons.

3724 CTTCTTGGGGTGGTATCCAAAGGACAGCCAACG 1079 -L--L--G--V--V--S--K--G--Q--P--T-

The mutated nucleotide is indicated in red.  The mutation results in a serine (S) to proline (P) substitution at position 1,084 (S1084P) in the InsR protein, and is strongly predicted by Polyphen-2 to be probably damaging (score = 1.000).

The DSS-induced colitis phenotype was verifed by CRISPR-mediated replacement of the gummi_bear Insr mutation (P = 1.095 x 10^-14; Figure 3).

Protein Prediction

Figure 4. Domain organization of InsR. The gummi_bear mutation results in a serine to proline substitution at position 1084. Domain information is from SMART and UniProt. This image is interactive. Click on each mutation for more information.

Figure 5. Structure of human insulin receptor ectodomain. The gummi_bear mutation occurs in an unsolved section of the protein. UCSF Chimera model is based on PDB 4ZXB, Croll, et al. Structure. 24, 469-476 (2016). Click on the 3D structure to view it rotate.

Insr encodes the insulin receptor (IR), a member of the receptor tyrosine kinase family. The IR forms either a heterodimer comprised of an extracellular α subunit and a membrane-spanning β subunit (αβ), or a heterotetramer of two α and two β  subunits (α₂β₂); the α and β subunits are both coded by Insr. The α and β subunits are joined by disulfide bonds, which are proteolytically processed at a precursor processing enzyme cleavage site to generate the individual subunits (1;2). IR can also form a heterodimer/heterotetramer (Insr_αβ/Igf1r_αβ) with insulin-like growth factor-1 receptor (IGF-1R), which alters the selectivity and affinity for insulin and IGF-1 (3). IR also can form a hybrid complex with Met, a receptor for hepatocyte growth factor (HGF) (4). The IR/Met hybrid can strongly activate IR-associated signaling cascades.

IR has a 27-amino acid signal sequence (Figure 4). The α subunit has two leucine-rich domains, a cysteine-rich domain, a fibronectin type III (FnIII) domain, a partial FnIII domain, and a long carboxy-terminal segment that has the furin cleavage site (5;6). The β subunit begins (after a short amino-terminal segment) with the completion of the partial FnIII domain of the α subunit, a third FnIII domain, a transmembrane domain, a juxtamembrane region, a tyrosine kinase domain, and a carboxy-terminal region. The ectodomain of the IR forms an antiparallel “inverted V” [Figure 5; PDB: 4ZXB; (6;7)]. One leg of the V shape is formed from the first leucine-rich domain, the second cysteine-rich region, and the second leucine-rich domain (6). The second leg of the V is comprised of the three FNIII domains. Insulin binding is mediated by two sites in the ectodomain (8). The first site is formed by the first leucine-rich domain in one α subunit and the C-terminal segment of the other α subunit of α₂β₂ IR. The second site involves loops from the first and second FnIII domains of the other αβ half-receptor.

The IR kinase domain has a canonical kinase architecture with N- and C-lobes. The N-lobe has a five-stranded β sheet and a single α helix (αC), while the C-lobe is mainly helical. The C-lobe has most of the catalytic residues within the catalytic and activation loops. An α helix (αJ) at the carboxy-terminal end of the C-lobe is unique to the IR. The function of the αJ helix is unknown, but in a complex with the phosphastase PTP1B, the αJ helix is part of the phosphatase binding site (9). The kinase activity of the IR is regulated by phosphorylation of the activation loop (amino acids 1150 to 1172) in the C-lobe. Tyr1158, Tyr1162, and Tyr1163 within the activation loop are autophosphorylated after binding of insulin to the ectodomain.

INSR undergoes alternative splicing of exon 11 to generate two isoforms that differ by exclusion (isoform A; IR-A) or inclusion (isoform B; IR-B) of a 12- amino-acid sequence in the carboxy-terminal part of the α subunit (10). IR-A is predominantly expressed in fetal tissues, brain and leukocytes, while IR-B is highly expressed in the liver (11). Similar amounts of IR-A and IR-B are expressed in placenta, skeletal muscle, and adipose tissue (11). IR-A has higher affinity for both insulin and IGF-2 as well as a higher rate of internalization than IR-B, and IR-A is often upregulated in cancers (12).

The gummi_bear mutation results in a serine (S) to proline (P) substitution at position 1,084 (S1084P), which is within the kinase domain of the β subunit.

Expression/Localization

The IR is ubiquitously expressed.

Background

Figure 6. Binding of insulin to the insulin receptor (IR) propagates signaling to activate three main pathways: the MAP kinase, Cbl/CAP, and PI3K pathways. Insulin binding to the IR promotes autophosphorylation of the receptor. IRS1/2 recruitment to the IR results in PI3K and GRB2 activation. Activated PI3K phosphorylates membrane phospholipids, the major product being phosphatidylinositol-3,4,5-trisphosphate (PIP₃). PIP₃ in turn activates PIP₃-dependent kinase 1 (PDK1). PDK1 activates another kinase called protein kinase B (PKB; alternatively, AKT). Insulin-mediated activation of AKT2/PKBβ results in inhibition of lipolysis and gluoconeogenesis as well as activation of protein and glycogen synthesis. PDK1 phosphorylates some isoforms of protein kinase C (PKC). The PKC isoform, PKCλ/ζ, phosphorylates proteins associated with intracellular vesicles containing the glucose transporter, GLUT4, resulting in their migration to and fusion with, the plasma membrane and subsequent increased glucose uptake and metabolism in adipose tissue. GRB2 activation results in signal transduction via the monomeric G-protein, RAS. Activation of RAS ultimately leads to changes in the expression of numerous genes via activation of members of the extracellular signal-regulated kinases, ERK.

The insulin signaling pathway regulates glucose uptake and release as well as the synthesis and storage of carbohydrates and lipids (Figure 6). Binding of insulin to the IR activates IR intrinsic tyrosine kinase activity, which propagates signaling to activate three main pathways: the MAP kinase, Cbl/CAP, and PI3K pathways (13). Insulin growth factor 1 (IGF1) and IGF2 are also traditional IR ligands. Binding of insulin to the ectodomain of IR activates the insulin signaling pathway by triggering a conformational change that facilitates IR autophosphorylation of the kinase domain. Phosphorylation of the kinase activation loop stimulates IR catalytic activity. Phosphorylation of the juxtamembrane region of the IR recruits downstream signaling proteins (e.g., insulin receptor substrate proteins [Irs1 (see the record for runt) and Irs2 (see the record for dum_dum)] and Shc [see the record for shrine (Sch2)]). Shc activates the Shc-Grb2-Sos-Ras-Raf-MAPK pathway, which controls cellular proliferation and gene transcription. Phosphorylated IRS1 docks with SH2 domain-containing proteins and mediates signal transduction to downstream factors. IRS1 and IRS2 activate many similar downstream pathways (e.g., the PI3K and Akt pathways), but are not functionally redundant. The IRS proteins recruit and activate PI3K, which leads to the generation of the second messenger PIP₃. PIP₃ recruits and activates PDK-1, which phosphorylates and activates Akt and atypical PKCs. Akt regulates glucose transport, lipid synthesis, gluconeogenesis, glycogen synthesis, cell cycle, and survival. Activated IR can also phosphorylate several “alternative” substrates, some of which provide docking sites for recruitment of other downstream signaling proteins (Table 1).

Table 1. Select alternative substrates of IR

Substrate	Description of substrate	IR-associated effect	References
ADRB2 (beta-2-adrenergic receptor)	G-protein coupled receptor	Recruits GRB2 and other proteins to promote the internalization of ADRB2	(14;15)
Calmodulin	Calcium-dependent messenger protein	Attenuates biological activity	(16;17)
CEACAM1 (carcinoembryonic antigen-related cell adhesion molecule 1)	Cell-cell adhesion molecule	Initiates IR internalization as well as competes with IR for Shc binding (attenuating IR-associated signaling	(18;19)
Dok1 (docking protein 1)	Scaffolding protein	Enhances its binding to GAP (an inhibitor of Ras)	(20)
FAK1 (focal adhesion kinase 1)	Cytosolic tyrosine kinase in integrin signaling	Unknown; IR promotes FAK1 phosphorylation in suspended cells, but stimulates IR dephosphorylation in attached cells	(21;22)
FRS2 (fibroblast growth factor receptor substrate 2)	Adaptor protein that links fibroblast growth factor receptors to downstream signaling	Putatively recruits SHP2 to the IR	(23)
PTP1C	Protein tyrosine phosphatase	Unknown; no evidence demonstrating that it can directly dephosphorylate IR	(24)
SH2B1 and SH2B2	SH2 domain-containing proteins	Phosphorylated SH2B2 docks c-Cbl to IR and promotes IR ubiquitination and internalization; may function as docking sites for downstream insulin signaling factors	(25;26)
STAT5B (signal transducer and activator of transcription 5B)	Transcription factor	Activates a series of target genes, including glucokinase and SOCS proteins	(27-30)
SYNCRIP (synaptotagmin-binding cytoplasmic RNA-interacting protein) and Sam68 (the 68 kDa Src substrate associated during mitosis)	Cytoplasmic RNA-binding proteins	Sam68 docks p85 PI3K and GAP proteins; affects RNA-binding activity	(31-34)
Vav3	Guanine nucleotide exchange factor	Promotes Rac-1 activation, actin cytoskeletal rearrangement, and the formation of cell membrane ruffles	(35)

Several factors negatively regulate IR-associated signaling [reviewed in (36)]. Adaptor proteins Grb7, Grb10, and Grb14 (37-40) reduce IR activity through direct interaction. The Grb proteins are recruited to the IR whereby they compete with IRS for IR binding, inhibiting IR activity. The protein tyrosine phosphatases PTP1B, PTP1C, TCPTP, and PTPRF dephosphorylate the IR, subsequently negatively regulating its activity (41-43). The phosphatases are recruited to the IR through their SH2 domains after insulin stimulation and IR autophosphorylation. Suppressors of cytokine signaling (SOCS) proteins (SOCS1 [see the record for minipad], SOCS3, and SOCS6) directly interact with the IR to block downstream signal transduction by competing for binding to the IR (44;45). Protein kinase C isoforms (PKCδ [see the record for Rigged] and PKCε [see the record for pinnacles]) also negatively regulate IR-associated signaling (46). The PKCs phosphorylate the IR, which lowers its tyrosine kinase activity (46).

Mutations in INSR are associated with insulin-resistant diabetes mellitus with acanthosis nigricans [OMIM: #610549; (47-49)]. Acanthosis nigricans is a skin condition characterized by areas of discoloration in body folds and creases often in the armpits, groin, and neck. INSR mutations are also linked to familial hyperinsulinemic hypoglycemia 5 [HHF5; OMIM: #609968; (50)], leprechaunism [alternatively, Donohue syndrome; OMIM: #246200; (51-55)], and Rabson-Mendenhall syndrome [OMIM: #262190; (56;57)]. Patients with leprechaunism have growth delays, skin abnormalities, reduced muscle mass, phallic enlargement, and insulin resistance. Patients with Rabson-Mendenhall syndrome exhibit dental and skin abnormalities, abdominal distention, and phallic enlargement.

Insr-deficient (Insr^-/-) mice exhibited postnatal lethality within 72 hours after birth due to hyperglycemia, diabetic ketoacidosis, and hepatic steatosis (58;59). Insr^-/- mice exhibit reduced body weights compared to wild-type controls. Rescue of IR expression in brain, liver, and pancreatic beta cells rescued the Insr^-/- mice from neonatal death, prevented diabetes in most mice, and normalized adipose tissue content, lifespan, and reproductive function (60). Heterozygous Insr mice (Insr^+/-) mice exhibited increased circulating insulin levels and insulin resistance (61;62). Heterozygous mice for an ENU-induced Insr alleles exhibited hyperglycemia and increased circulating insulin levels (MGI). Mice with muscle-specific IR knockout showed increased fat mass, serum triglycerides, and fatty acids; however blood glucose, serum insulin, and glucose tolerance were normal (63). Mice with fat-specific IR knockout showed reduced fat mass, were protected from age-related obesity and obesity-related glucose intolerance, and had increased mean life spans (64;65). Mice with brown adipose tissue-specific IR knockout showed an age-dependent loss of interscapular brown fat and developed an insulin-secretion defect resulting in a progressive glucose intolerance, without insulin resistance (66). Mice with pancreatic beta cell-specific IR knockout showed loss of insulin secretion in response to glucose and a progressive impairment of glucose tolerance (67). Mice with hepatocyte-specific IR knockout showed insulin resistance, glucose intolerance, hyperinsulinemia, and a failure of insulin to suppress hepatic glucose production (68). Mice with cardiomyocyte-specific IR knockout showed subendocardial fibrosis and left ventricular dysfunction four weeks after a transverse aortic constriction (69).

Putative Mechanism

The role of IR-associated signaling in colonic inflammation is unclear. Increased IGF bioactivity leads to increased epithelial proliferation and mucosal barrier repair, thereby lessening inflammation (70). Aberrant IGF bioactivity in the gummi_bear mice may be leading to reduced epithelial proliferation and mucosal barrier repair after exposure of the mice to DSS.

Primers

PCR Primer
gummi_bear_pcr_F: GCGTTCAAGTATGCCATGCCATC
gummi_bear_pcr_R: TGCAGGGAAGACAGTTCCCAAAC

Sequencing Primer
gummi_bear_seq_F: TTCTAAAGTCAAAACAGGGGTTGC
gummi_bear_seq_R: ccgaggaacagtaggcaag

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 786 nucleotides is amplified (chromosome 8, - strand):

1   tgcagggaag acagttccca aactagtagt ggcatgttac gagacaaatg cttgaagaaa
61  ttgaaaaaga gagaggaaga ggattgtact ctacctgagc aaagtcttaa agggatgaac
121 catgtgtcca tgggagtgag ggaccagact aaggagagca ggaagtgcga aggtctggag
181 gtggaaatat ggtttatata ccgaggaaca gtaggcaagt gagatttgct tgggatgttc
241 tatatatgag tgggtctgtt tgctccctca ttctagggct gcctatgctc catccaaaca
301 cagggtggcc cgtgttttac tgttaccaga gagagcattg tgaattgaag taaaacctgg
361 accctcttct aataacctcc ctgcttgttc tcatgcttgt tctgcaggtc cgccttcttg
421 gggtggtatc caaaggacag ccaacgctgg tagtgatgga attgatggct catggagacc
481 tgaaaagtca cctccgttct ctgaggccag atgctgaggt aagctgcctc taggtaagac
541 ccataacagg gtacctgatc ttacgtatac caacctcact aaatgcaaac ccatgtttta
601 acttcagaaa taccctggct acacccctga cccacacacc ctataagaga tgatttagat
661 ggaatcagag tgctaattgc aacccctgtt ttgactttag aataacccag gccgccctcc
721 ccctaccttg caagaaatga ttcagatgac agcagaaatt gctgatggca tggcatactt
781 gaacgc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Ullrich, A., Bell, J. R., Chen, E. Y., Herrera, R., Petruzzelli, L. M., Dull, T. J., Gray, A., Coussens, L., Liao, Y. C., and Tsubokawa, M. (1985) Human Insulin Receptor and its Relationship to the Tyrosine Kinase Family of Oncogenes. Nature. 313, 756-761.

  2. Sparrow, L. G., McKern, N. M., Gorman, J. J., Strike, P. M., Robinson, C. P., Bentley, J. D., and Ward, C. W. (1997) The Disulfide Bonds in the C-Terminal Domains of the Human Insulin Receptor Ectodomain. J Biol Chem. 272, 29460-29467.

  3. White, M. F. (2003) Insulin Signaling in Health and Disease. Science. 302, 1710-1711.

  4. Fafalios, A., Ma, J., Tan, X., Stoops, J., Luo, J., Defrances, M. C., and Zarnegar, R. (2011) A Hepatocyte Growth Factor Receptor (Met)-Insulin Receptor Hybrid Governs Hepatic Glucose Metabolism. Nat Med. 17, 1577-1584.

  5. Menting, J. G., Whittaker, J., Margetts, M. B., Whittaker, L. J., Kong, G. K., Smith, B. J., Watson, C. J., Zakova, L., Kletvikova, E., Jiracek, J., Chan, S. J., Steiner, D. F., Dodson, G. G., Brzozowski, A. M., Weiss, M. A., Ward, C. W., and Lawrence, M. C. (2013) How Insulin Engages its Primary Binding Site on the Insulin Receptor. Nature. 493, 241-245.

  6. Croll, T. I., Smith, B. J., Margetts, M. B., Whittaker, J., Weiss, M. A., Ward, C. W., and Lawrence, M. C. (2016) Higher-Resolution Structure of the Human Insulin Receptor Ectodomain: Multi-Modal Inclusion of the Insert Domain. Structure. 24, 469-476.

  7. McKern, N. M., Lawrence, M. C., Streltsov, V. A., Lou, M. Z., Adams, T. E., Lovrecz, G. O., Elleman, T. C., Richards, K. M., Bentley, J. D., Pilling, P. A., Hoyne, P. A., Cartledge, K. A., Pham, T. M., Lewis, J. L., Sankovich, S. E., Stoichevska, V., Da Silva, E., Robinson, C. P., Frenkel, M. J., Sparrow, L. G., Fernley, R. T., Epa, V. C., and Ward, C. W. (2006) Structure of the Insulin Receptor Ectodomain Reveals a Folded-Over Conformation. Nature. 443, 218-221.

  8. Whittaker, L., Hao, C., Fu, W., and Whittaker, J. (2008) High-Affinity Insulin Binding: Insulin Interacts with Two Receptor Ligand Binding Sites. Biochemistry. 47, 12900-12909.

  9. Li, S., Depetris, R. S., Barford, D., Chernoff, J., and Hubbard, S. R. (2005) Crystal Structure of a Complex between Protein Tyrosine Phosphatase 1B and the Insulin Receptor Tyrosine Kinase. Structure. 13, 1643-1651.

  10. Mosthaf, L., Grako, K., Dull, T. J., Coussens, L., Ullrich, A., and McClain, D. A. (1990) Functionally Distinct Insulin Receptors Generated by Tissue-Specific Alternative Splicing. EMBO J. 9, 2409-2413.

  11. Benecke, H., Flier, J. S., and Moller, D. E. (1992) Alternatively Spliced Variants of the Insulin Receptor Protein. Expression in Normal and Diabetic Human Tissues. J Clin Invest. 89, 2066-2070.

  12. Frasca, F., Pandini, G., Scalia, P., Sciacca, L., Mineo, R., Costantino, A., Goldfine, I. D., Belfiore, A., and Vigneri, R. (1999) Insulin Receptor Isoform A, a Newly Recognized, High-Affinity Insulin-Like Growth Factor II Receptor in Fetal and Cancer Cells. Mol Cell Biol. 19, 3278-3288.

  13. Khan, A. H., and Pessin, J. E. (2002) Insulin Regulation of Glucose Uptake: A Complex Interplay of Intracellular Signalling Pathways. Diabetologia. 45, 1475-1483.

  14. Baltensperger, K., Karoor, V., Paul, H., Ruoho, A., Czech, M. P., and Malbon, C. C. (1996) The Beta-Adrenergic Receptor is a Substrate for the Insulin Receptor Tyrosine Kinase. J Biol Chem. 271, 1061-1064.

  15. Karoor, V., Wang, L., Wang, H. Y., and Malbon, C. C. (1998) Insulin Stimulates Sequestration of Beta-Adrenergic Receptors and Enhanced Association of Beta-Adrenergic Receptors with Grb2 Via Tyrosine 350. J Biol Chem. 273, 33035-33041.

  16. Laurino, J. P., Colca, J. R., Pearson, J. D., DeWald, D. B., and McDonald, J. M. (1988) The in Vitro Phosphorylation of Calmodulin by the Insulin Receptor Tyrosine Kinase. Arch Biochem Biophys. 265, 8-21.

  17. Saville, M. K., and Houslay, M. D. (1994) Phosphorylation of Calmodulin on Tyr99 Selectively Attenuates the Action of Calmodulin Antagonists on Type-I Cyclic Nucleotide Phosphodiesterase Activity. Biochem J. 299 ( Pt 3), 863-868.

  18. Formisano, P., Najjar, S. M., Gross, C. N., Philippe, N., Oriente, F., Kern-Buell, C. L., Accili, D., and Gorden, P. (1995) Receptor-Mediated Internalization of Insulin. Potential Role of pp120/HA4, a Substrate of the Insulin Receptor Kinase. J Biol Chem. 270, 24073-24077.

  19. Poy, M. N., Ruch, R. J., Fernstrom, M. A., Okabayashi, Y., and Najjar, S. M. (2002) Shc and CEACAM1 Interact to Regulate the Mitogenic Action of Insulin. J Biol Chem. 277, 1076-1084.

  20. Wick, M. J., Dong, L. Q., Hu, D., Langlais, P., and Liu, F. (2001) Insulin Receptor-Mediated p62dok Tyrosine Phosphorylation at Residues 362 and 398 Plays Distinct Roles for Binding GTPase-Activating Protein and Nck and is Essential for Inhibiting Insulin-Stimulated Activation of Ras and Akt. J Biol Chem. 276, 42843-42850.

  21. Baron, V., Calleja, V., Ferrari, P., Alengrin, F., and Van Obberghen, E. (1998) P125Fak Focal Adhesion Kinase is a Substrate for the Insulin and Insulin-Like Growth Factor-I Tyrosine Kinase Receptors. J Biol Chem. 273, 7162-7168.

  22. Pillay, T. S., Sasaoka, T., and Olefsky, J. M. (1995) Insulin Stimulates the Tyrosine Dephosphorylation of pp125 Focal Adhesion Kinase. J Biol Chem. 270, 991-994.

  23. Delahaye, L., Rocchi, S., and Van Obberghen, E. (2000) Potential Involvement of FRS2 in Insulin Signaling. Endocrinology. 141, 621-628.

  24. Uchida, T., Matozaki, T., Noguchi, T., Yamao, T., Horita, K., Suzuki, T., Fujioka, Y., Sakamoto, C., and Kasuga, M. (1994) Insulin Stimulates the Phosphorylation of Tyr538 and the Catalytic Activity of PTP1C, a Protein Tyrosine Phosphatase with Src Homology-2 Domains. J Biol Chem. 269, 12220-12228.

  25. Ahmed, Z., Smith, B. J., Kotani, K., Wilden, P., and Pillay, T. S. (1999) APS, an Adapter Protein with a PH and SH2 Domain, is a Substrate for the Insulin Receptor Kinase. Biochem J. 341 ( Pt 3), 665-668.

  26. Ahmed, Z., Smith, B. J., and Pillay, T. S. (2000) The APS Adapter Protein Couples the Insulin Receptor to the Phosphorylation of c-Cbl and Facilitates Ligand-Stimulated Ubiquitination of the Insulin Receptor. FEBS Lett. 475, 31-34.

  27. Chen, J., Sadowski, H. B., Kohanski, R. A., and Wang, L. H. (1997) Stat5 is a Physiological Substrate of the Insulin Receptor. Proc Natl Acad Sci U S A. 94, 2295-2300.

  28. Sawka-Verhelle, D., Filloux, C., Tartare-Deckert, S., Mothe, I., and Van Obberghen, E. (1997) Identification of Stat 5B as a Substrate of the Insulin Receptor. Eur J Biochem. 250, 411-417.

  29. Sadowski, C. L., Choi, T. S., Le, M., Wheeler, T. T., Wang, L. H., and Sadowski, H. B. (2001) Insulin Induction of SOCS-2 and SOCS-3 mRNA Expression in C2C12 Skeletal Muscle Cells is Mediated by Stat5*. J Biol Chem. 276, 20703-20710.

  30. Sawka-Verhelle, D., Tartare-Deckert, S., Decaux, J. F., Girard, J., and Van Obberghen, E. (2000) Stat 5B, Activated by Insulin in a Jak-Independent Fashion, Plays a Role in Glucokinase Gene Transcription. Endocrinology. 141, 1977-1988.

  31. Sanchez-Margalet, V., and Najib, S. (1999) P68 Sam is a Substrate of the Insulin Receptor and Associates with the SH2 Domains of p85 PI3K. FEBS Lett. 455, 307-310.

  32. Hresko, R. C., and Mueckler, M. (2000) A Novel 68-kDa Adipocyte Protein Phosphorylated on Tyrosine in Response to Insulin and Osmotic Shock. J Biol Chem. 275, 18114-18120.

  33. Sanchez-Margalet, V., and Najib, S. (2001) Sam68 is a Docking Protein Linking GAP and PI3K in Insulin Receptor Signaling. Mol Cell Endocrinol. 183, 113-121.

  34. Wang, L. L., Richard, S., and Shaw, A. S. (1995) P62 Association with RNA is Regulated by Tyrosine Phosphorylation. J Biol Chem. 270, 2010-2013.

  35. Zeng, L., Sachdev, P., Yan, L., Chan, J. L., Trenkle, T., McClelland, M., Welsh, J., and Wang, L. H. (2000) Vav3 Mediates Receptor Protein Tyrosine Kinase Signaling, Regulates GTPase Activity, Modulates Cell Morphology, and Induces Cell Transformation. Mol Cell Biol. 20, 9212-9224.

  36. Hubbard, S. R. (2013) The Insulin Receptor: Both a Prototypical and Atypical Receptor Tyrosine Kinase. Cold Spring Harb Perspect Biol. 5, a008946.

  37. Wick, K. R., Werner, E. D., Langlais, P., Ramos, F. J., Dong, L. Q., Shoelson, S. E., and Liu, F. (2003) Grb10 Inhibits Insulin-Stimulated Insulin Receptor Substrate (IRS)-Phosphatidylinositol 3-kinase/Akt Signaling Pathway by Disrupting the Association of IRS-1/IRS-2 with the Insulin Receptor. J Biol Chem. 278, 8460-8467.

  38. Liu, F., and Roth, R. A. (1995) Grb-IR: A SH2-Domain-Containing Protein that Binds to the Insulin Receptor and Inhibits its Function. Proc Natl Acad Sci U S A. 92, 10287-10291.

  39. Nouaille, S., Blanquart, C., Zilberfarb, V., Boute, N., Perdereau, D., Roix, J., Burnol, A. F., and Issad, T. (2006) Interaction with Grb14 Results in Site-Specific Regulation of Tyrosine Phosphorylation of the Insulin Receptor. EMBO Rep. 7, 512-518.

  40. Kasus-Jacobi, A., Bereziat, V., Perdereau, D., Girard, J., and Burnol, A. F. (2000) Evidence for an Interaction between the Insulin Receptor and Grb7. A Role for Two of its Binding Domains, PIR and SH2. Oncogene. 19, 2052-2059.

  41. Seely, B. L., Staubs, P. A., Reichart, D. R., Berhanu, P., Milarski, K. L., Saltiel, A. R., Kusari, J., and Olefsky, J. M. (1996) Protein Tyrosine Phosphatase 1B Interacts with the Activated Insulin Receptor. Diabetes. 45, 1379-1385.

  42. Galic, S., Klingler-Hoffmann, M., Fodero-Tavoletti, M. T., Puryer, M. A., Meng, T. C., Tonks, N. K., and Tiganis, T. (2003) Regulation of Insulin Receptor Signaling by the Protein Tyrosine Phosphatase TCPTP. Mol Cell Biol. 23, 2096-2108.

  43. Ahmad, F., and Goldstein, B. J. (1997) Functional Association between the Insulin Receptor and the Transmembrane Protein-Tyrosine Phosphatase LAR in Intact Cells. J Biol Chem. 272, 448-457.

  44. Emanuelli, B., Peraldi, P., Filloux, C., Sawka-Verhelle, D., Hilton, D., and Van Obberghen, E. (2000) SOCS-3 is an Insulin-Induced Negative Regulator of Insulin Signaling. J Biol Chem. 275, 15985-15991.

  45. Mooney, R. A., Senn, J., Cameron, S., Inamdar, N., Boivin, L. M., Shang, Y., and Furlanetto, R. W. (2001) Suppressors of Cytokine Signaling-1 and -6 Associate with and Inhibit the Insulin Receptor. A Potential Mechanism for Cytokine-Mediated Insulin Resistance. J Biol Chem. 276, 25889-25893.

  46. Bollag, G. E., Roth, R. A., Beaudoin, J., Mochly-Rosen, D., and Koshland, D. E.,Jr. (1986) Protein Kinase C Directly Phosphorylates the Insulin Receptor in Vitro and Reduces its Protein-Tyrosine Kinase Activity. Proc Natl Acad Sci U S A. 83, 5822-5824.

  47. Odawara, M., Kadowaki, T., Yamamoto, R., Shibasaki, Y., Tobe, K., Accili, D., Bevins, C., Mikami, Y., Matsuura, N., and Akanuma, Y. (1989) Human Diabetes Associated with a Mutation in the Tyrosine Kinase Domain of the Insulin Receptor. Science. 245, 66-68.

  48. Moller, D. E., Cohen, O., Yamaguchi, Y., Assiz, R., Grigorescu, F., Eberle, A., Morrow, L. A., Moses, A. C., and Flier, J. S. (1994) Prevalence of Mutations in the Insulin Receptor Gene in Subjects with Features of the Type A Syndrome of Insulin Resistance. Diabetes. 43, 247-255.

  49. Accili, D., Frapier, C., Mosthaf, L., McKeon, C., Elbein, S. C., Permutt, M. A., Ramos, E., Lander, E., Ullrich, A., and Taylor, S. I. (1989) A Mutation in the Insulin Receptor Gene that Impairs Transport of the Receptor to the Plasma Membrane and Causes Insulin-Resistant Diabetes. EMBO J. 8, 2509-2517.

  50. Hojlund, K., Hansen, T., Lajer, M., Henriksen, J. E., Levin, K., Lindholm, J., Pedersen, O., and Beck-Nielsen, H. (2004) A Novel Syndrome of Autosomal-Dominant Hyperinsulinemic Hypoglycemia Linked to a Mutation in the Human Insulin Receptor Gene. Diabetes. 53, 1592-1598.

  51. Psiachou, H., Mitton, S., Alaghband-Zadeh, J., Hone, J., Taylor, S. I., and Sinclair, L. (1993) Leprechaunism and Homozygous Nonsense Mutation in the Insulin Receptor Gene. Lancet. 342, 924.

  52. Hone, J., Accili, D., al-Gazali, L. I., Lestringant, G., Orban, T., and Taylor, S. I. (1994) Homozygosity for a New Mutation (Ile119-->Met) in the Insulin Receptor Gene in Five Sibs with Familial Insulin Resistance. J Med Genet. 31, 715-716.

  53. van der Vorm, E. R., Kuipers, A., Kielkopf-Renner, S., Krans, H. M., Moller, W., and Maassen, J. A. (1994) A Mutation in the Insulin Receptor that Impairs Proreceptor Processing but Not Insulin Binding. J Biol Chem. 269, 14297-14302.

  54. al-Gazali, L. I., Khalil, M., and Devadas, K. (1993) A Syndrome of Insulin Resistance Resembling Leprechaunism in Five Sibs of Consanguineous Parents. J Med Genet. 30, 470-475.

  55. Krook, A., Brueton, L., and O'Rahilly, S. (1993) Homozygous Nonsense Mutation in the Insulin Receptor Gene in Infant with Leprechaunism. Lancet. 342, 277-278.

  56. Moncada, V. Y., Hedo, J. A., Serrano-Rios, M., and Taylor, S. I. (1986) Insulin-Receptor Biosynthesis in Cultured Lymphocytes from an Insulin-Resistant Patient (Rabson-Mendenhall Syndrome). Evidence for Defect before Insertion of Receptor into Plasma Membrane. Diabetes. 35, 802-807.

  57. Takahashi, Y., Kadowaki, H., Ando, A., Quin, J. D., MacCuish, A. C., Yazaki, Y., Akanuma, Y., and Kadowaki, T. (1998) Two Aberrant Splicings Caused by Mutations in the Insulin Receptor Gene in Cultured Lymphocytes from a Patient with Rabson-Mendenhall's Syndrome. J Clin Invest. 101, 588-594.

  58. Accili, D., Drago, J., Lee, E. J., Johnson, M. D., Cool, M. H., Salvatore, P., Asico, L. D., Jose, P. A., Taylor, S. I., and Westphal, H. (1996) Early Neonatal Death in Mice Homozygous for a Null Allele of the Insulin Receptor Gene. Nat Genet. 12, 106-109.

  59. Joshi, R. L., Lamothe, B., Cordonnier, N., Mesbah, K., Monthioux, E., Jami, J., and Bucchini, D. (1996) Targeted Disruption of the Insulin Receptor Gene in the Mouse Results in Neonatal Lethality. EMBO J. 15, 1542-1547.

  60. Okamoto, H., Nakae, J., Kitamura, T., Park, B. C., Dragatsis, I., and Accili, D. (2004) Transgenic Rescue of Insulin Receptor-Deficient Mice. J Clin Invest. 114, 214-223.

  61. Tanabe, K., Liu, Z., Patel, S., Doble, B. W., Li, L., Cras-Meneur, C., Martinez, S. C., Welling, C. M., White, M. F., Bernal-Mizrachi, E., Woodgett, J. R., and Permutt, M. A. (2008) Genetic Deficiency of Glycogen Synthase Kinase-3beta Corrects Diabetes in Mouse Models of Insulin Resistance. PLoS Biol. 6, e37.

  62. Goldsworthy, M., Hugill, A., Freeman, H., Horner, E., Shimomura, K., Bogani, D., Pieles, G., Mijat, V., Arkell, R., Bhattacharya, S., Ashcroft, F. M., and Cox, R. D. (2008) Role of the Transcription Factor sox4 in Insulin Secretion and Impaired Glucose Tolerance. Diabetes. 57, 2234-2244.

  63. Bruning, J. C., Michael, M. D., Winnay, J. N., Hayashi, T., Horsch, D., Accili, D., Goodyear, L. J., and Kahn, C. R. (1998) A Muscle-Specific Insulin Receptor Knockout Exhibits Features of the Metabolic Syndrome of NIDDM without Altering Glucose Tolerance. Mol Cell. 2, 559-569.

  64. Bluher, M., Kahn, B. B., and Kahn, C. R. (2003) Extended Longevity in Mice Lacking the Insulin Receptor in Adipose Tissue. Science. 299, 572-574.

  65. Bluher, M., Michael, M. D., Peroni, O. D., Ueki, K., Carter, N., Kahn, B. B., and Kahn, C. R. (2002) Adipose Tissue Selective Insulin Receptor Knockout Protects Against Obesity and Obesity-Related Glucose Intolerance. Dev Cell. 3, 25-38.

  66. Guerra, C., Navarro, P., Valverde, A. M., Arribas, M., Bruning, J., Kozak, L. P., Kahn, C. R., and Benito, M. (2001) Brown Adipose Tissue-Specific Insulin Receptor Knockout shows Diabetic Phenotype without Insulin Resistance. J Clin Invest. 108, 1205-1213.

  67. Kulkarni, R. N., Bruning, J. C., Winnay, J. N., Postic, C., Magnuson, M. A., and Kahn, C. R. (1999) Tissue-Specific Knockout of the Insulin Receptor in Pancreatic Beta Cells Creates an Insulin Secretory Defect Similar to that in Type 2 Diabetes. Cell. 96, 329-339.

  68. Michael, M. D., Kulkarni, R. N., Postic, C., Previs, S. F., Shulman, G. I., Magnuson, M. A., and Kahn, C. R. (2000) Loss of Insulin Signaling in Hepatocytes Leads to Severe Insulin Resistance and Progressive Hepatic Dysfunction. Mol Cell. 6, 87-97.

  69. Symons, J. D., Hu, P., Yang, Y., Wang, X., Zhang, Q. J., Wende, A. R., Sloan, C. L., Sena, S., Abel, E. D., and Litwin, S. E. (2011) Knockout of Insulin Receptors in Cardiomyocytes Attenuates Coronary Arterial Dysfunction Induced by Pressure Overload. Am J Physiol Heart Circ Physiol. 300, H374-81.

  70. Yancu, D., Blouin, M. J., Birman, E., Florianova, L., Aleynikova, O., Zakikhani, M., VanderMeulen, H., Seidman, E., and Pollak, M. (2017) A Phenotype of IGFBP-3 Knockout Mice Revealed by Dextran Sulfate-Induced Colitis. J Gastroenterol Hepatol. 32, 146-153.