Phenotypic Mutation 'freckle'

• Allele: freckle
• Mutation Type: nonsense
• Chromosome: 12
• Coordinate: 91,505,000 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Tshr
• Gene Name: thyroid stimulating hormone receptor
• Synonym(s): hypothroid, pet, hyt
• Chromosomal Location: 91,367,767-91,507,283 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008] ; PHENOTYPE: Mutations in this gene exhibit profound hypothyroidism, developmental and growth retardation, impaired hearing with cochlear defects, and infertility. One mutation results in high postweaning mortality. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Serine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000021346] [ENSMUSP00000139632] [ENSMUSP00000152158]
• AlphaFold: P47750
• SMART Domains: Protein: ENSMUSP00000021346; Gene: ENSMUSG00000020963; AA Change: S646*

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:LRR_5	53	153	9.5e-7	PFAM
Pfam:LRR_5	148	244	5.1e-5	PFAM
Pfam:7tm_1	431	678	2.6e-30	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000139632; Gene: ENSMUSG00000020963; AA Change: S54*

Domain	Start	End	E-Value	Type
Pfam:7tm_1	1	86	6.4e-10	PFAM

• Predicted Effect: probably null
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9717
• Is this an essential gene?: Probably nonessential (E-score: 0.238)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• MMRRC Submission: 038201-MU
• Last Updated: 2019-09-04 9:48 PM by Bruce Beutler
• Record Created: 2014-06-27 1:07 PM by Carlos Reyna
• Record Posted: 2015-06-05
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Carlos Reyna Tiana Purrington Jeff SoRelle

Accession Number

NM_011648, NM_001113404; MGI:98849

Alleles Listed at MGI

All mutations/alleles(5) : Spontaneous(3) Targeted(1) Transgenic(1)

Phenotypic Description

Figure 1. Homozygous freckle mice exhibit reduced body weights compared to wild-type and heterozygous littermates. Body weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The freckle phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0658, some of which exhibited reduced body weights compared to wild-type mice (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 60 mutations (X-axis) identified in the G1 male of pedigree R0658. Weight phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 60 mutations. Mutations in Pgf (placental growth factor), Syne2 (spectrin repeat containing, nuclear envelope 2), and Tshr on chromosome 12 showed similar linkage (i.e., P values) to the body weight phenotype; however, only Tshr has known effects on adult body weight (see MGI for a list of Tshr alleles). The mutation in Tshr is a C to A transversion at base pair 91,538,226 (v38) on chromosome 12, or base pair 137,234 in the GenBank genomic region NC_000078 encoding Tshr. Linkage was found with a recessive model of inheritance (P = 2.715 x 10^-5), wherein 2 variant homozygotes departed phenotypically from 5 homozygous reference mice and 8 heterozygous mice (Figure 2).

The mutation corresponds to residue 2,029 in the mRNA sequence NM_011648 (variant 1) within exon 10 of 10 total exons; the mutation is not predicted to affect variant 2 (NM_001113404).

2013 TCCTTCTATGCGCTGTCGGCACTTATGAACAAG 641  -S--F--Y--A--L--S--A--L--M--N--K-

The mutated nucleotide is indicated in red, and coverts serine 646 to a stop codon (S646*) in the canonical isoform of thyroid stimulating hormone receptor (TSHR) protein. 

Protein Prediction

Figure 3. Topology and domain structure of TSHR. (A) Topology of the TSHR. (B) Domain structure of the TSHR. The TSHR is comprised of a large extracellular N-terminus that contains several leucine-rich repeats (LRR) and a hinge region. TSHR is a G-protein-coupled receptor with seven transmembrane domains (TM). Abbreviations: SP, signal peptide; ECD, extracellular domain; ICD, intracellular domain. The freckle mutation is indicated by a red asterisk and results in conversion of serine 646 to a stop codon (S646*).

TSHR is a member of the glycoprotein hormone receptor (GPHR) subfamily of G protein-coupled receptors (GPCRs) (1). GPCRs are the largest superfamily of proteins known, and consist of seven transmembrane-spanning α-helices connected by alternating intracellular (C-) and extracellular (E-) loops (Figure 3A). The N-terminus is located on the extracellular side and the C-terminus on the intracellular side (2). In vertebrates, three major GPCR subfamilies exist known as the class A, class B, and class C receptors. TSHR, along with rhodopsin (see the record for Bemr3), adrenergic, and adenosine receptors, belongs to the class A subfamily, which are characterized by a highly conserved (E/D)RY motif at the cytoplasmic end of the third transmembrane helix (TM3) (2). A conserved NPXXY motif located in TM7 is essential for receptor silencing, for TSHR coupling to the G protein, and for internalization (3-5). Residues within the C-terminus of TSHR are proposed to mediate endosomal trafficking of TSHR once it is internalized.

TSHR has five putative N-glycosylation sites, a short intracytoplasmic region, and seven leucine-rich repeats (LRRs) within the N-terminal extracellular region [Figure 3B; (6;7)]. N-linked glycosylation of TSHR is conserved and essential for the expression, trafficking, and function of TSHR (8). The LRRs of TSHR mediate protein-protein interactions and provide a TSH (alternatively, thyrotropin)-binding surface (9-11). In addition to TSH, TSHR can also be activated by other hormones including luteinizing hormone (LH), chorionic gonadotropin (CG), and thyrostimulin as well as tryptic clipping, antibodies, mutations, or small drug-like molecules (12;13).

The region between the LRR domain (LRD) and TMD1 (aa 289-414), termed the hinge region, is important for hormone binding and for signal transduction (14;15). Within this region are cysteine-rich fragments, termed cysteine boxes, connected by disulfide bridges. The cysteine boxes regulate the function of TSHR. Upon TSH binding, the LRD, hinge region, and the TM region undergo structural rearrangements. The greatest movement observed within the TM region is between TM5, 6, and 7 (16). Asp633 (in TM6) and Asn674 (in TM7) are essential in maintaining TSHR in an inactive state through a conformational constraint on the Asn (17). In addition, highly conserved Asn674 is necessary for ligand-induced cAMP accumulation (17).

The TSHR is a heterodimeric structure composed of an extracellular α-subunit and a membrane-spanning β-subunit linked by disulfide bridges (18). In the thyroid, TSHR undergoes posttranslational processing at multiple cleavage sites (19). Cleavage of TSHR releases a 50-amino acid (amino acids 317-366) C-peptide from the receptor and mediates the separation of the TSHR into the α- and β-subunits (7;18-21). The role of TSHR cleavage under physiological conditions is unknown.

Human TSHR can generate at least five alternatively spliced isoforms in the thyroid (22). The alternative transcripts are generated by the use of alternative transcription initiation sites (23), by the use of alternative poly(A) signals (22), or by alternative splicing. One isoform of human TSHR lacks the entire transmembrane and cytoplasmic domains (24-26). The functions of the alternative TSHR isoforms are unknown. In the mouse, a Tshr cDNA that lacks exon 5 has been identified ; exon 5 encodes 35 amino acids within the LRR domain (27). The protein product, designated as TSHR_739,  localizes to the plasma membrane, but did not bind TSH or produce cAMP upon stimulation; however, TSAbs from a patient with Graves’ disease bound TSHR₇₃₉ , subsequently stimulating cAMP (27).

Figure 4 . GPCR activation cycle. In its inactive state, the GDP-bound α subunit and the βγ complex are associated. Upon agonist binding, the GPCR undergoes conformational change and exchanges GDP for GTP in the Gα subunit. GTP-Gα and βγ dissociate and modulate effectors. Hydrolysis of GTP to GDP by RGS leads to inactivation of the G-protein.

As a GPCR, TSHR couples with a heterotrimeric G protein to mediate its downstream effects. G proteins, which consist of an α subunit that binds and hydrolyzes GTP (Gα), and β and γ subunits that are constitutively associated in a complex [Figure 4; reviewed in (28)].  In the absence of a stimulus, the GDP-bound α subunit and the βγ complex are associated.  Upon activation by ligand binding, the GPCR recruits its cognate heterotrimeric G protein, and undergoes a conformational change enabling it to act as guanine nucleotide exchange factor (GEF) for the G protein α subunit.  GEFs promote the exchange of GDP for GTP, resulting in dissociation of the GTP-bound α subunit from the activated receptor and the βγ complex. Both the GTP-bound α subunit and the βγ complex mediate signaling by modulating the activities of other proteins, such as adenylyl cyclases, phospholipases, and ion channels. Gα signaling is terminated upon GTP hydrolysis, an activity intrinsic to Gα and one that may be stimulated by GTPase activating proteins (GAPs) such as regulators of G protein signaling (RGS) proteins. The GDP-bound Gα subunit reassociates with the βγ complex and is ready for another activation cycle. Ligand-induced phosphorylation of the GPCR by G protein coupled receptor kinases (GRKs) leads to sequestration of the receptor from the cell surface thereby downregulating signaling.

The freckle mutation results in substitution of Ser646 for a premature stop codon; Ser646 is within TM6. The mutation is not predicted to affect the alternative isoform of Tshr. The structure and function of TSHR^freckle have not been examined.

Expression/Localization

TSHR mRNA and protein are strongly expressed in the thyroid (18), with less expression in other tissues including adipose (29-31), bone (32-34), and thymus (35-37). Human TSHR is highly expressed in the thymus during early stages of T cell development, albeit at significantly lower levels than that observed in the thyroid (37). Highest expression of TSHR was detected in immature single positive thymocytes (CD4+ CD8− CD3−) and double positive thymocytes (CD4+ CD8+) (37). Tshr expression increases from very low levels at embryonic day 14 (E14) to higher levels as development progresses (38).

Background

Figure 5. Diagram of the major signaling pathways downstream of the TSHR. Activation of TSHR on the cell surface by TSH or TSHR antibodies results in the activation of two major classes of G proteins, Gα S and Gα q . Activation of Gα S results in activation of the cAMP/PKA/ERK signaling pathway. While activation of Gα q results in activation of the PI3/Akt/mTOR, PKC/NF-κB, and PKC/c-raf/ERK/P90RSK pathways. Activation of these pathways promotes thyroid development and other functions. See the text for more details.

After migration from the pharyngeal cavity during development, the thyroid expands in size significantly, coinciding with the synthesis of thyroid hormone from follicular cells. By E15-16 in mice, the gland has a definite shape with two lobes connected by an isthmus. During childhood in humans, thyroid growth parallels body growth [reviewed in (39)]. TSHR regulates the growth and function of the thyroid gland by activating G proteins from all four G protein classes [i.e., G_s (G stimulatory), G_q/11, G_12/13, and G_i (G inhibitory)] and several subsequent signaling pathways (e.g., phospholipase C, cAMP, PIP2, and MAP kinase) (40;41).

The TSHR mainly functions through adenylate cyclase to regulate thyroid follicular cell proliferation and thyroid hormone synthesis and release [Figure 5; (42)]. Upon TSH binding to the TSHR, G_sα activation induces cyclic AMP (cAMP) production by adenylyl cyclase. cAMP stimulates cAMP-dependent protein kinase A (PKA), which subsequently phosphorylates cytoplasmic and nuclear target proteins such as the nuclear transcription factor CREB. Although TSH/TSHR activation mainly uses cAMP as a second messenger, other signaling cascades (e.g., the insulin growth factor-1 (IGF-1) and epidermal growth factor (EGF; see the record for Velvet for information about EGF receptor) signaling pathways are activated. IGF-1 (and insulin at supraphysiological concentrations) regulates the cell proliferative action of TSH (43). During embryonic development, EGF/EGFR is proposed to control cell proliferation and thyroid development.

Upon TSH binding to the TSHR, G_qα activation results in the hydrolysis of PIP₂ by PLC (see the record queen for information about PLC-γ2) enzymes to produce DAG and IP₃ (44). DAG is responsible for activating protein kinase C (PKC; see the record for Untied) and possibly the TRP calcium influx channels (see the record for gingame for information about TRPV5), while IP₃ modulates calcium responses within the cell by binding to receptors on the intracellular membrane to allow the mobilization of intracellular calcium. 

TSH/TSHR pathway activation in the developing thyroid coincides with the onset of thyroid hormone biosynthesis. After the induction of TSHR in the developing thyroid, sodium/iodide symporter (NIS) expression is stimulated and the levels of thyroglobulin (Tg) and thyroid peroxidase (TPO) increase (38). TSH/TSHR-associated signaling is also required for the targeting of NIS to the plasma membrane (45). The TSH/TSHR signaling pathways regulate the expression of the transcription factors Titf1, Pax8, and Foxe1 in vitro, all of which regulate the expression of genes that encode proteins that function in the thyroid hormone biosynthesis. In vivo, loss of Tshr expression does not alter the expression of Titf1, Pax8, or Foxe1.

In addition to a role in thyroid development and function, the TSHR has a role in T and B cell development. Tshr^hyt/Tshr^hyt mice have a spontaneous mutation in Tshr resulting in a proline to leucine substitution at amino acid 556 (46-48). The Tshr^hyt/Tshr^hyt mice exhibited a T cell development block at the immature single positive (SP) or double positive stages and subsequent reduced frequencies of double positive and single positive thymocytes compared to wild-type mice; the frequency of T cells in the blood and spleen were not changed (37).  Tshr^hyt/Tshr^hyt mice also exhibited reduced frequencies of pro-B, pre-B, and B cells in the bone marrow compared to wild-type mice (49;50). The frequency of IgM⁺ cells in the spleens of the Tshr^hyt/Tshr^hyt mice was comparable to that in wild-type mice (50). TSHR signaling is proposed to regulate T cell development through functioning in both T cell differentiation and survival. The expression patterns of several genes involved in T cell development of immature SP thymocytes were upregulated upon treatment with recombinant TSH. In addition, the expression levels of genes involved in apoptosis induction and proliferation were reduced, while the expression levels of genes involved in differentiation were increased (37). TSHR-associated signaling is also proposed to be involved in pre-TCR-signaling and β-selection and/or subsequent induction of TCR rearrangements (37).

Skeletal remodeling is a process by which old bone is resorbed by the osteoclast and is replaced by new bone by the osteoblast. TSH/TSHR is essential for skeletal remodeling, osteoblastic bone formation, and osteoclastic bone resorption (32). Hypothyroidism causes growth arrest and delayed bone maturation; thyroid hormone replacement therapy leads to rapid catch-up growth in both humans and mice (46;51;52). The Tshr^hyt/Tshr^hyt mice have delayed endochondral ossification as well as impaired chondrocyte differentiation, reduced cortical bone thickness, impaired trabecular remodeling, and reduced bone mineralization (34). Loss of Tshr expression in Tshr-deficient (Tshr^-/-) mice resulted in both osteoporosis (i.e., bone loss) and osteosclerosis (i.e., localized bone formation) (32). TSH/TSHR inhibits osteoclast formation and survival by attenuating JNK and NF-κB signaling in response to receptor activator of NF-κB ligand (RANKL) and TNFα (see the record for Panr1) (32;53). RANKL binding to RANK stimulates the non-canonical NF-κB signaling pathway (see the record for xander). TNFα binding to TNFR-1 results in activation of the TAB2/TAK1 complex, and subsequent activation of the IKK complex to phosphorylate IκB, resulting in release of NF-κB for translocation to the nucleus and activation of gene expression. TNFR1 also activates JNK through sequential recruitment of TRAF2, MEKK1 and MKK7. MAPK activation involves signaling through TRADD, RIP and MKK3. TRADD recruitment to TNFR1 also leads to the induction of apoptosis through FAS (see the record for cherry)-associated death domain (FADD) protein, caspase-8 and caspase-3. TSH/TSHR inhibits osteoblast differentiation in a Runx2- and osterix-independent manner by downregulating Wnt and VEGF signaling (32).

TSH/TSHR promotes cholesterol synthesis and fasting glucose homeostasis through the cAMP/PKA/CREB pathway (54). Tshr^-/- mice exhibited reduced fasting blood glucose levels and increased insulin sensitivity, but normal fasting plasma insulin levels (55). Loss of Tshr expression resulted in reduced hepatic glucose production due to a downregulation in the expression of mRNAs associated with hepatic gluoconeogenesis [i.e., glucose-6-phosphatase and phosphoenolpyruvate pyruvate carboxylase (PEPCK)] as well as an upregulation in enzymes associated with glycogen synthesis (e.g., hepatic glucokinase) (55).

Mutations in TSHR are linked to familial gestational hyperthyroidism [OMIM: #603373; (56;57)], nonautoimmune hyperthyroidism [OMIM: #609152; (58;59)], congenital nongoitrous hypothyroidism 1 [OMIM: #275200; (60-62)], somatic hyperfunctioning thyroid adenoma (63), and thyroid carcinoma with thyrotoxicosis (64). Non-autoimmune hyperthyroidism and toxic nodules are caused by mutations (e.g., Gly431Ser) that cause constitutive activation of the TSHR-G_s-adenylyl cyclase signaling pathway or the activation of the TSHR-G_q/11-phospholipase Cβ (PLCβ) pathway. Impaired function of the TSHR results in either TSH elevation with normal thyroid hormone levels (hyperthyrotropinemia) or as more severe congenital hypothyroidism with thyroid gland hypoplasia (e.g., Cys41Ser and Cys600Arg) (65;66). In Graves’ disease, thyroid stimulating antibody (TSAb) targets the TSHR, subsequently resulting in continuous stimulation of hormone synthesis, hormone secretion, and cell growth.

Similar to human patients with inactivating TSHR mutations, Tshr^hyt/Tshr^hyt and Tshr^-/- mice exhibit hypothyroidism (46;48;67;68). The TSHR^hyt protein does not stimulate an increase in cAMP in response to TSH as opposed to wild-type TSHR that exhibits a 7.4-fold increase in cAMP upon TSH stimulation because the TSHR^hyt protein failed to bind TSH (67). The Tshr^hyt/Tshr^hyt mice exhibited hearing loss as well as inner ear defects including tectorial membrane distortion, tunnel of Corti dysplasia, outer hair cell abnormalities, and a contiguous membrane along the apices of the outer hair cell stereocilia (69;70); Tshr^-/- mice exhibit middle ear abnormalities including enlarged ossicles, delayed ossficiation of the ossicles, and chronic persistence of mesenchyme in the middle ear into adulthood (71). Some studies have noted a variable spontaneous, asymmetrical circling behavior in the Tshr^hyt/Tshr^hyt mice (72). The mice that exhibited the circling behavior had a reduced number of midbrain dopamine neurons compared to mice that did not circle (72). Both male and female Tshr^hyt/Tshr^hyt mice are infertile (73); male infertility can be reversed by supplementing them with thyroid. Egg development was not affected in the Tshr^hyt/Tshr^hyt female mice; however, the female Tshr^hyt/Tshr^hyt mice exhibited continuous dioestrus (73). In addition, follicles were degenerative and corpora lutea was not observed in the ovaries. The number of ovaluted eggs was lower than that in wild-type mice.

Putative Mechanism

Tshr^hyt/Tshr^hyt and Tshr^-/- mice exhibit a retarded growth rate at weaning that becomes more pronounced with age (34;46;68), similar to the freckle mice.  The reduced size/growth rate of the freckle mice indicates that there is loss of TSHR^freckle function and/or expression.   

Primers

PCR Primer
freckle_pcr_F: AAGGTCAGCATCTGCCTGCCAATG
freckle_pcr_R: TCACTGTGACTAGCGTAGCCTTTCC

Sequencing Primer
freckle_seq_F: TCTGCCTGCCAATGGACAC
freckle_seq_R: GGAGTTTCCAAGCAGTTCATAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 629 nucleotides is amplified (chromosome 12, + strand):

1   aaggtcagca tctgcctgcc aatggacacc gacacccctc ttgcactcgc atacattgtc
61  ctcgttctgc tgctcaatgt tgttgccttt gttgtcgtct gttcctgcta tgtgaagatc
121 tacatcacgg tccgaaatcc ccagtacaac cctcgagata aagacaccaa gattgccaag
181 aggatggctg tgttgatctt cactgacttc atgtgcatgg cgcccatctc cttctatgcg
241 ctgtcggcac ttatgaacaa gcctctaatc actgttacta actccaaaat cttgttggtt
301 ctcttctacc ccctcaactc ctgtgccaat ccgtttctct atgctatttt caccaaggcc
361 ttccagaggg acgtgttcat cctgctcagc aagtttggca tctgcaaacg ccaggcccag
421 gcctatcagg gtcagagagt ctgtcccaac aatagcactg gtattcagat ccaaaagatt
481 ccccaggaca cgaggcagag tctccccaac atgcaagata cctatgaact gcttggaaac
541 tcccagctag ctccaaaact gcagggacaa atctcagaag agtataagca aacagccttg
601 taaaggaaag gctacgctag tcacagtga

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Vassart, G., Pardo, L., and Costagliola, S. (2004) A Molecular Dissection of the Glycoprotein Hormone Receptors. Trends Biochem Sci. 29, 119-126.

  2. Mustafi, D., and Palczewski, K. (2009) Topology of Class A G Protein-Coupled Receptors: Insights Gained from Crystal Structures of Rhodopsins, Adrenergic and Adenosine Receptors. Mol Pharmacol. 75, 1-12.

  3. Shi, Y., Zou, M., Ahring, P., Al-Sedairy, S. T., and Farid, N. R. (1995) Thyrotropin Internalization is Directed by a Highly Conserved Motif in the Seventh Transmembrane Region of its Receptor. Endocrine. 3, 409-414.

  4. Claeysen, S., Govaerts, C., Lefort, A., Van Sande, J., Costagliola, S., Pardo, L., and Vassart, G. (2002) A Conserved Asn in TM7 of the Thyrotropin Receptor is a Common Requirement for Activation by both Mutations and its Natural Agonist. FEBS Lett. 517, 195-200.

  5. Fotiadis, D., Jastrzebska, B., Philippsen, A., Muller, D. J., Palczewski, K., and Engel, A. (2006) Structure of the Rhodopsin Dimer: A Working Model for G-Protein-Coupled Receptors. Curr Opin Struct Biol. 16, 252-259.

  6. Nagayama, Y., Kaufman, K. D., Seto, P., and Rapoport, B. (1989) Molecular Cloning, Sequence and Functional Expression of the cDNA for the Human Thyrotropin Receptor. Biochem Biophys Res Commun. 165, 1184-1190.

  7. Parmentier, M., Libert, F., Maenhaut, C., Lefort, A., Gerard, C., Perret, J., Van Sande, J., Dumont, J. E., and Vassart, G. (1989) Molecular Cloning of the Thyrotropin Receptor. Science. 246, 1620-1622.

  8. Nagayama, Y., Nishihara, E., Namba, H., Yamashita, S., and Niwa, M. (2000) Identification of the Sites of Asparagine-Linked Glycosylation on the Human Thyrotropin Receptor and Studies on their Role in Receptor Function and Expression. J Pharmacol Exp Ther. 295, 404-409.

  9. Kobe, B., and Deisenhofer, J. (1993) Crystal Structure of Porcine Ribonuclease Inhibitor, a Protein with Leucine-Rich Repeats. Nature. 366, 751-756.

  10. Wadsworth, H. L., Chazenbalk, G. D., Nagayama, Y., Russo, D., and Rapoport, B. (1990) An Insertion in the Human Thyrotropin Receptor Critical for High Affinity Hormone Binding. Science. 249, 1423-1425.

  11. Caltabiano, G., Campillo, M., De Leener, A., Smits, G., Vassart, G., Costagliola, S., and Pardo, L. (2008) The Specificity of Binding of Glycoprotein Hormones to their Receptors. Cell Mol Life Sci. 65, 2484-2492.

  12. Nakabayashi, K., Matsumi, H., Bhalla, A., Bae, J., Mosselman, S., Hsu, S. Y., and Hsueh, A. J. (2002) Thyrostimulin, a Heterodimer of Two New Human Glycoprotein Hormone Subunits, Activates the Thyroid-Stimulating Hormone Receptor. J Clin Invest. 109, 1445-1452.

  13. Hershman, J. M. (2004) Physiological and Pathological Aspects of the Effect of Human Chorionic Gonadotropin on the Thyroid. Best Pract Res Clin Endocrinol Metab. 18, 249-265.

  14. Nagayama, Y., Wadsworth, H. L., Chazenbalk, G. D., Russo, D., Seto, P., and Rapoport, B. (1991) Thyrotropin-Luteinizing hormone/chorionic Gonadotropin Receptor Extracellular Domain Chimeras as Probes for Thyrotropin Receptor Function. Proc Natl Acad Sci U S A. 88, 902-905.

  15. Kosugi, S., Ban, T., Akamizu, T., and Kohn, L. D. (1991) Site-Directed Mutagenesis of a Portion of the Extracellular Domain of the Rat Thyrotropin Receptor Important in Autoimmune Thyroid Disease and Nonhomologous with Gonadotropin Receptors. Relationship of Functional and Immunogenic Domains. J Biol Chem. 266, 19413-19418.

  16. Scheerer, P., Park, J. H., Hildebrand, P. W., Kim, Y. J., Krauss, N., Choe, H. W., Hofmann, K. P., and Ernst, O. P. (2008) Crystal Structure of Opsin in its G-Protein-Interacting Conformation. Nature. 455, 497-502.

  17. Govaerts, C., Lefort, A., Costagliola, S., Wodak, S. J., Ballesteros, J. A., Van Sande, J., Pardo, L., and Vassart, G. (2001) A Conserved Asn in Transmembrane Helix 7 is an on/off Switch in the Activation of the Thyrotropin Receptor. J Biol Chem. 276, 22991-22999.

  18. Loosfelt, H., Pichon, C., Jolivet, A., Misrahi, M., Caillou, B., Jamous, M., Vannier, B., and Milgrom, E. (1992) Two-Subunit Structure of the Human Thyrotropin Receptor. Proc Natl Acad Sci U S A. 89, 3765-3769.

  19. Graves, P., Pritsker, A., and Davies, T. F. (1999) Post-Translational Processing of the Natural Human Thyrotropin Receptor: Demonstration of More than Two Cleavage Sites. J Clin Endocrinol Metab. 84, 2177-2181.

  20. Chazenbalk, G. D., Tanaka, K., Nagayama, Y., Kakinuma, A., Jaume, J. C., McLachlan, S. M., and Rapoport, B. (1997) Evidence that the Thyrotropin Receptor Ectodomain Contains Not One, but Two, Cleavage Sites. Endocrinology. 138, 2893-2899.

  21. de Bernard, S., Misrahi, M., Huet, J. C., Beau, I., Desroches, A., Loosfelt, H., Pichon, C., Pernollet, J. C., and Milgrom, E. (1999) Sequential Cleavage and Excision of a Segment of the Thyrotropin Receptor Ectodomain. J Biol Chem. 274, 101-107.

  22. Kakinuma, A., and Nagayama, Y. (2002) Multiple Messenger Ribonucleic Acid Transcripts and Revised Gene Organization of the Human TSH Receptor. Endocr J. 49, 175-180.

  23. Gross, B., Misrahi, M., Sar, S., and Milgrom, E. (1991) Composite Structure of the Human Thyrotropin Receptor Gene. Biochem Biophys Res Commun. 177, 679-687.

  24. Graves, P. N., Tomer, Y., and Davies, T. F. (1992) Cloning and Sequencing of a 1.3 KB Variant of Human Thyrotropin Receptor mRNA Lacking the Transmembrane Domain. Biochem Biophys Res Commun. 187, 1135-1143.

  25. Hunt, N., Willey, K. P., Abend, N., Balvers, M., Jahner, D., Northemann, W., and Ivell, R. (1995) Novel Splicing Variants of the Human Thyrotropin Receptor Encode Truncated Polypeptides without a Membrane-Spanning Domain. Endocrine. 3, 233-240.

  26. Takeshita, A., Nagayama, Y., Fujiyama, K., Yokoyama, N., Namba, H., Yamashita, S., Izumi, M., and Nagataki, S. (1992) Molecular Cloning and Sequencing of an Alternatively Spliced Form of the Human Thyrotropin Receptor Transcript. Biochem Biophys Res Commun. 188, 1214-1219.

  27. Endo, T., and Kobayashi, T. (2013) Immunization of Mice with a Newly Identified Thyroid-Stimulating Hormone Receptor Splice Variant Induces Graves'-Like Disease. J Autoimmun. 43, 18-25.

  28. Wettschureck, N., and Offermanns, S. (2005) Mammalian G Proteins and their Cell Type Specific Functions. Physiol Rev. 85, 1159-1204.

  29. Endo, T., Ohta, K., Haraguchi, K., and Onaya, T. (1995) Cloning and Functional Expression of a Thyrotropin Receptor cDNA from Rat Fat Cells. J Biol Chem. 270, 10833-10837.

  30. Roselli-Rehfuss, L., Robbins, L. S., and Cone, R. D. (1992) Thyrotropin Receptor Messenger Ribonucleic Acid is Expressed in most Brown and White Adipose Tissues in the Guinea Pig. Endocrinology. 130, 1857-1861.

  31. Haraguchi, K., Shimura, H., Kawaguchi, A., Ikeda, M., Endo, T., and Onaya, T. (1999) Effects of Thyrotropin on the Proliferation and Differentiation of Cultured Rat Preadipocytes. Thyroid. 9, 613-619.

  32. Abe, E., Marians, R. C., Yu, W., Wu, X. B., Ando, T., Li, Y., Iqbal, J., Eldeiry, L., Rajendren, G., Blair, H. C., Davies, T. F., and Zaidi, M. (2003) TSH is a Negative Regulator of Skeletal Remodeling. Cell. 115, 151-162.

  33. Inoue, M., Tawata, M., Yokomori, N., Endo, T., and Onaya, T. (1998) Expression of Thyrotropin Receptor on Clonal Osteoblast-Like Rat Osteosarcoma Cells. Thyroid. 8, 1059-1064.

  34. Bassett, J. H., Williams, A. J., Murphy, E., Boyde, A., Howell, P. G., Swinhoe, R., Archanco, M., Flamant, F., Samarut, J., Costagliola, S., Vassart, G., Weiss, R. E., Refetoff, S., and Williams, G. R. (2008) A Lack of Thyroid Hormones rather than Excess Thyrotropin Causes Abnormal Skeletal Development in Hypothyroidism. Mol Endocrinol. 22, 501-512.

  35. Dutton, C. M., Joba, W., Spitzweg, C., Heufelder, A. E., and Bahn, R. S. (1997) Thyrotropin Receptor Expression in Adrenal, Kidney, and Thymus. Thyroid. 7, 879-884.

  36. Murakami, M., Hosoi, Y., Araki, O., Morimura, T., Imamura, M., Ogiwara, T., Mizuma, H., and Mori, M. (2001) Expression of Thyrotropin Receptors in Rat Thymus. Life Sci. 68, 2781-2787.

  37. van der Weerd, K., van Hagen, P. M., Schrijver, B., Heuvelmans, S. J., Hofland, L. J., Swagemakers, S. M., Bogers, A. J., Dik, W. A., Visser, T. J., van Dongen, J. J., van der Lelij, A. J., and Staal, F. J. (2014) Thyrotropin Acts as a T-Cell Developmental Factor in Mice and Humans. Thyroid. 24, 1051-1061.

  38. Brown, R. S., Shalhoub, V., Coulter, S., Alex, S., Joris, I., De Vito, W., Lian, J., and Stein, G. S. (2000) Developmental Regulation of Thyrotropin Receptor Gene Expression in the Fetal and Neonatal Rat Thyroid: Relation to Thyroid Morphology and to Thyroid-Specific Gene Expression. Endocrinology. 141, 340-345.

  39. De Felice, M., Postiglione, M. P., and Di Lauro, R. (2004) Minireview: Thyrotropin Receptor Signaling in Development and Differentiation of the Thyroid Gland: Insights from Mouse Models and Human Diseases. Endocrinology. 145, 4062-4067.

  40. Allgeier, A., Offermanns, S., Van Sande, J., Spicher, K., Schultz, G., and Dumont, J. E. (1994) The Human Thyrotropin Receptor Activates G-Proteins Gs and Gq/11. J Biol Chem. 269, 13733-13735.

  41. Laugwitz, K. L., Allgeier, A., Offermanns, S., Spicher, K., Van Sande, J., Dumont, J. E., and Schultz, G. (1996) The Human Thyrotropin Receptor: A Heptahelical Receptor Capable of Stimulating Members of all Four G Protein Families. Proc Natl Acad Sci U S A. 93, 116-120.

  42. Vassart, G., and Dumont, J. E. (1992) The Thyrotropin Receptor and the Regulation of Thyrocyte Function and Growth. Endocr Rev. 13, 596-611.

  43. Kimura, T., Van Keymeulen, A., Golstein, J., Fusco, A., Dumont, J. E., and Roger, P. P. (2001) Regulation of Thyroid Cell Proliferation by TSH and Other Factors: A Critical Evaluation of in Vitro Models. Endocr Rev. 22, 631-656.

  44. Latif, R., Morshed, S. A., Zaidi, M., and Davies, T. F. (2009) The Thyroid-Stimulating Hormone Receptor: Impact of Thyroid-Stimulating Hormone and Thyroid-Stimulating Hormone Receptor Antibodies on Multimerization, Cleavage, and Signaling. Endocrinol Metab Clin North Am. 38, 319-41, viii.

  45. Riedel, C., Levy, O., and Carrasco, N. (2001) Post-Transcriptional Regulation of the sodium/iodide Symporter by Thyrotropin. J Biol Chem. 276, 21458-21463.

  46. Beamer, W. J., Eicher, E. M., Maltais, L. J., and Southard, J. L. (1981) Inherited Primary Hypothyroidism in Mice. Science. 212, 61-63.

  47. Stein, S. A., Oates, E. L., Hall, C. R., Grumbles, R. M., Fernandez, L. M., Taylor, N. A., Puett, D., and Jin, S. (1994) Identification of a Point Mutation in the Thyrotropin Receptor of the hyt/hyt Hypothyroid Mouse. Mol Endocrinol. 8, 129-138.

  48. Biesiada, E., Adams, P. M., Shanklin, D. R., Bloom, G. S., and Stein, S. A. (1996) Biology of the Congenitally Hypothyroid hyt/hyt Mouse. Adv Neuroimmunol. 6, 309-346.

  49. Foster, M. P., Montecino-Rodriguez, E., and Dorshkind, K. (1999) Proliferation of Bone Marrow Pro-B Cells is Dependent on Stimulation by the pituitary/thyroid Axis. J Immunol. 163, 5883-5890.

  50. Montecino-Rodriguez, E., Clark, R. G., Powell-Braxton, L., and Dorshkind, K. (1997) Primary B Cell Development is Impaired in Mice with Defects of the pituitary/thyroid Axis. J Immunol. 159, 2712-2719.

  51. Rivkees, S. A., Bode, H. H., and Crawford, J. D. (1988) Long-Term Growth in Juvenile Acquired Hypothyroidism: The Failure to Achieve Normal Adult Stature. N Engl J Med. 318, 599-602.

  52. Boersma, B., Otten, B. J., Stoelinga, G. B., and Wit, J. M. (1996) Catch-Up Growth After Prolonged Hypothyroidism. Eur J Pediatr. 155, 362-367.

  53. Hase, H., Ando, T., Eldeiry, L., Brebene, A., Peng, Y., Liu, L., Amano, H., Davies, T. F., Sun, L., Zaidi, M., and Abe, E. (2006) TNFalpha Mediates the Skeletal Effects of Thyroid-Stimulating Hormone. Proc Natl Acad Sci U S A. 103, 12849-12854.

  54. Tian, L., Song, Y., Xing, M., Zhang, W., Ning, G., Li, X., Yu, C., Qin, C., Liu, J., Tian, X., Sun, X., Fu, R., Zhang, L., Zhang, X., Lu, Y., Zou, J., Wang, L., Guan, Q., Gao, L., and Zhao, J. (2010) A Novel Role for Thyroid-Stimulating Hormone: Up-Regulation of Hepatic 3-Hydroxy-3-Methyl-Glutaryl-Coenzyme A Reductase Expression through the Cyclic Adenosine monophosphate/protein Kinase A/cyclic Adenosine Monophosphate-Responsive Element Binding Protein Pathway. Hepatology. 52, 1401-1409.

  55. Wang, T., Xu, J., Bo, T., Zhou, X., Jiang, X., Gao, L., and Zhao, J. (2013) Decreased Fasting Blood Glucose is Associated with Impaired Hepatic Glucose Production in Thyroid-Stimulating Hormone Receptor Knockout Mice. Endocr J. 60, 941-950.

  56. Rodien, P., Bremont, C., Sanson, M. L., Parma, J., Van Sande, J., Costagliola, S., Luton, J. P., Vassart, G., and Duprez, L. (1998) Familial Gestational Hyperthyroidism Caused by a Mutant Thyrotropin Receptor Hypersensitive to Human Chorionic Gonadotropin. N Engl J Med. 339, 1823-1826.

  57. Kopp, P., van Sande, J., Parma, J., Duprez, L., Gerber, H., Joss, E., Jameson, J. L., Dumont, J. E., and Vassart, G. (1995) Brief Report: Congenital Hyperthyroidism Caused by a Mutation in the Thyrotropin-Receptor Gene. N Engl J Med. 332, 150-154.

  58. Duprez, L., Parma, J., Van Sande, J., Allgeier, A., Leclere, J., Schvartz, C., Delisle, M. J., Decoulx, M., Orgiazzi, J., and Dumont, J. (1994) Germline Mutations in the Thyrotropin Receptor Gene Cause Non-Autoimmune Autosomal Dominant Hyperthyroidism. Nat Genet. 7, 396-401.

  59. de Roux, N., Polak, M., Couet, J., Leger, J., Czernichow, P., Milgrom, E., and Misrahi, M. (1996) A Neomutation of the Thyroid-Stimulating Hormone Receptor in a Severe Neonatal Hyperthyroidism. J Clin Endocrinol Metab. 81, 2023-2026.

  60. Sunthornthepvarakui, T., Gottschalk, M. E., Hayashi, Y., and Refetoff, S. (1995) Brief Report: Resistance to Thyrotropin Caused by Mutations in the Thyrotropin-Receptor Gene. N Engl J Med. 332, 155-160.

  61. Clifton-Bligh, R. J., Gregory, J. W., Ludgate, M., John, R., Persani, L., Asteria, C., Beck-Peccoz, P., and Chatterjee, V. K. (1997) Two Novel Mutations in the Thyrotropin (TSH) Receptor Gene in a Child with Resistance to TSH. J Clin Endocrinol Metab. 82, 1094-1100.

  62. de Roux, N., Misrahi, M., Brauner, R., Houang, M., Carel, J. C., Granier, M., Le Bouc, Y., Ghinea, N., Boumedienne, A., Toublanc, J. E., and Milgrom, E. (1996) Four Families with Loss of Function Mutations of the Thyrotropin Receptor. J Clin Endocrinol Metab. 81, 4229-4235.

  63. Parma, J., Duprez, L., Van Sande, J., Cochaux, P., Gervy, C., Mockel, J., Dumont, J., and Vassart, G. (1993) Somatic Mutations in the Thyrotropin Receptor Gene Cause Hyperfunctioning Thyroid Adenomas. Nature. 365, 649-651.

  64. Russo, D., Tumino, S., Arturi, F., Vigneri, P., Grasso, G., Pontecorvi, A., Filetti, S., and Belfiore, A. (1997) Detection of an Activating Mutation of the Thyrotropin Receptor in a Case of an Autonomously Hyperfunctioning Thyroid Insular Carcinoma. J Clin Endocrinol Metab. 82, 735-738.

  65. Persani, L., Calebiro, D., Cordella, D., Weber, G., Gelmini, G., Libri, D., de Filippis, T., and Bonomi, M. (2010) Genetics and Phenomics of Hypothyroidism due to TSH Resistance. Mol Cell Endocrinol. 322, 72-82.

  66. Corvilain, B., Van Sande, J., Dumont, J. E., and Vassart, G. (2001) Somatic and Germline Mutations of the TSH Receptor and Thyroid Diseases. Clin Endocrinol (Oxf). 55, 143-158.

  67. Gu, W. X., Du, G. G., Kopp, P., Rentoumis, A., Albanese, C., Kohn, L. D., Madison, L. D., and Jameson, J. L. (1995) The Thyrotropin (TSH) Receptor Transmembrane Domain Mutation (Pro556-Leu) in the Hypothyroid hyt/hyt Mouse Results in Plasma Membrane Targeting but Defective TSH Binding. Endocrinology. 136, 3146-3153.

  68. Marians, R. C., Ng, L., Blair, H. C., Unger, P., Graves, P. N., and Davies, T. F. (2002) Defining Thyrotropin-Dependent and -Independent Steps of Thyroid Hormone Synthesis by using Thyrotropin Receptor-Null Mice. Proc Natl Acad Sci U S A. 99, 15776-15781.

  69. Li, D., Henley, C. M., and O'Malley, B. W.,Jr. (1999) Distortion Product Otoacoustic Emissions and Outer Hair Cell Defects in the hyt/hyt Mutant Mouse. Hear Res. 138, 65-72.

  70. O'Malley, B. W.,Jr, Li, D., and Turner, D. S. (1995) Hearing Loss and Cochlear Abnormalities in the Congenital Hypothyroid (hyt/hyt) Mouse. Hear Res. 88, 181-189.

  71. Cordas, E. A., Ng, L., Hernandez, A., Kaneshige, M., Cheng, S. Y., and Forrest, D. (2012) Thyroid Hormone Receptors Control Developmental Maturation of the Middle Ear and the Size of the Ossicular Bones. Endocrinology. 153, 1548-1560.

  72. Kincaid, A. E. (2001) Spontaneous Circling Behavior and Dopamine Neuron Loss in a Genetically Hypothyroid Mouse. Neuroscience. 105, 891-898.

  73. Jiang, J. Y., Imai, Y., Umezu, M., and Sato, E. (2001) Characteristics of Infertility in Female Hypothyroid (Hyt) Mice. Reproduction. 122, 695-700.