Phenotypic Mutation 'freckle' (pdf version)
List |< first << previous [record 9 of 30] next >> last >|
Allelefreckle
Mutation Type nonsense
Chromosome12
Coordinate91,538,226 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Tshr
Gene Name thyroid stimulating hormone receptor
Synonym(s) pet, hyt, hypothroid
Chromosomal Location 91,384,563-91,549,808 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene exhibit profound hypothyroidism, developmental and growth retardation, impaired hearing with cochlear defects, and infertility. One mutation results in high postweaning mortality. [provided by MGI curators]
Accession Number

NM_011648, NM_001113404; MGI:98849

Mapped Yes 
Amino Acid Change Serine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000021346] [ENSMUSP00000139632] [ENSMUSP00000152158]
SMART Domains Protein: ENSMUSP00000021346
Gene: ENSMUSG00000020963
AA Change: S646*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:LRR_5 53 153 9.5e-7 PFAM
Pfam:LRR_5 148 244 5.1e-5 PFAM
Pfam:7tm_1 431 678 2.6e-30 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000139632
Gene: ENSMUSG00000020963
AA Change: S54*

DomainStartEndE-ValueType
Pfam:7tm_1 1 86 6.4e-10 PFAM
Predicted Effect probably null
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased 11530227 7209519
endocrine/exocrine gland
growth/size 7209519
Penetrance  
Alleles Listed at MGI

All mutations/alleles(5) : Spontaneous(3) Targeted(1) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Tshr APN 12 91537500 missense probably damaging 1.00
IGL01503:Tshr APN 12 91511934 missense probably damaging 1.00
IGL01730:Tshr APN 12 91519303 missense possibly damaging 0.93
IGL02109:Tshr APN 12 91537992 missense probably damaging 1.00
IGL02199:Tshr APN 12 91538283 missense probably damaging 1.00
IGL02439:Tshr APN 12 91537547 missense probably damaging 0.97
IGL02696:Tshr APN 12 91493329 missense possibly damaging 0.72
IGL03170:Tshr APN 12 91537869 missense probably damaging 1.00
IGL03208:Tshr APN 12 91533942 missense probably damaging 1.00
R0017:Tshr UTSW 12 91537886 missense possibly damaging 0.95
R0017:Tshr UTSW 12 91537886 missense possibly damaging 0.95
R0067:Tshr UTSW 12 91505283 missense probably damaging 1.00
R0419:Tshr UTSW 12 91537869 missense probably damaging 1.00
R0658:Tshr UTSW 12 91538226 nonsense probably null
R0724:Tshr UTSW 12 91538286 missense probably damaging 1.00
R1170:Tshr UTSW 12 91538097 missense probably damaging 1.00
R1188:Tshr UTSW 12 91502168 missense probably benign 0.00
R1548:Tshr UTSW 12 91534031 missense probably damaging 1.00
R1677:Tshr UTSW 12 91537341 missense possibly damaging 0.81
R1808:Tshr UTSW 12 91537316 missense probably benign 0.00
R1934:Tshr UTSW 12 91537181 missense probably damaging 0.99
R3980:Tshr UTSW 12 91537743 missense probably damaging 1.00
R4008:Tshr UTSW 12 91537494 missense probably benign 0.21
R4828:Tshr UTSW 12 91537790 missense probably damaging 1.00
R4903:Tshr UTSW 12 91401188 missense probably benign 0.09
R4958:Tshr UTSW 12 91538187 missense probably damaging 1.00
R5528:Tshr UTSW 12 91537193 missense probably damaging 1.00
R5949:Tshr UTSW 12 91537218 missense probably damaging 1.00
R6136:Tshr UTSW 12 91538234 missense probably benign 0.34
R6147:Tshr UTSW 12 91538235 missense possibly damaging 0.84
R6454:Tshr UTSW 12 91538549 missense probably benign 0.33
R6572:Tshr UTSW 12 91538360 missense probably benign 0.29
R6884:Tshr UTSW 12 91538102 missense probably damaging 1.00
R6986:Tshr UTSW 12 91533957 missense probably damaging 0.97
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 038201-MU
Last Updated 2018-08-23 3:35 PM by Bruce Beutler
Record Created 2014-06-27 1:07 PM by Carlos Reyna
Record Posted 2015-06-05
Phenotypic Description

Figure 1. Homozygous freckle mice exhibit reduced body weights compared to wild-type and heterozygous littermates. Body weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The freckle phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0658, some of which exhibited reduced body weights compared to wild-type mice (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 60 mutations (X-axis) identified in the G1 male of pedigree R0658. Weight phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 60 mutations. Mutations in Pgf (placental growth factor), Syne2 (spectrin repeat containing, nuclear envelope 2), and Tshr on chromosome 12 showed similar linkage (i.e., P values) to the body weight phenotype; however, only Tshr has known effects on adult body weight (see MGI for a list of Tshr alleles). The mutation in Tshr is a C to A transversion at base pair 91,538,226 (v38) on chromosome 12, or base pair 137,234 in the GenBank genomic region NC_000078 encoding Tshr. Linkage was found with a recessive model of inheritance (P = 2.715 x 10-5), wherein 2 variant homozygotes departed phenotypically from 5 homozygous reference mice and 8 heterozygous mice (Figure 2).

 

The mutation corresponds to residue 2,029 in the mRNA sequence NM_011648 (variant 1) within exon 10 of 10 total exons; the mutation is not predicted to affect variant 2 (NM_001113404).

 

2013 TCCTTCTATGCGCTGTCGGCACTTATGAACAAG

641  -S--F--Y--A--L--S--A--L--M--N--K-

 

The mutated nucleotide is indicated in red, and coverts serine 646 to a stop codon (S646*) in the canonical isoform of thyroid stimulating hormone receptor (TSHR) protein. 

Protein Prediction
Figure 3. Topology and domain structure of TSHR. (A) Topology of the TSHR. (B) Domain structure of the TSHR. The TSHR is comprised of a large extracellular N-terminus that contains several leucine-rich repeats (LRR) and a hinge region. TSHR is a G-protein-coupled receptor with seven transmembrane domains (TM). Abbreviations: SP, signal peptide; ECD, extracellular domain; ICD, intracellular domain. The freckle mutation is indicated by a red asterisk and results in conversion of serine 646 to a stop codon (S646*).

TSHR is a member of the glycoprotein hormone receptor (GPHR) subfamily of G protein-coupled receptors (GPCRs) (1). GPCRs are the largest superfamily of proteins known, and consist of seven transmembrane-spanning α-helices connected by alternating intracellular (C-) and extracellular (E-) loops (Figure 3A). The N-terminus is located on the extracellular side and the C-terminus on the intracellular side (2). In vertebrates, three major GPCR subfamilies exist known as the class A, class B, and class C receptors. TSHR, along with rhodopsin (see the record for Bemr3), adrenergic, and adenosine receptors, belongs to the class A subfamily, which are characterized by a highly conserved (E/D)RY motif at the cytoplasmic end of the third transmembrane helix (TM3) (2). A conserved NPXXY motif located in TM7 is essential for receptor silencing, for TSHR coupling to the G protein, and for internalization (3-5). Residues within the C-terminus of TSHR are proposed to mediate endosomal trafficking of TSHR once it is internalized.

 

TSHR has five putative N-glycosylation sites, a short intracytoplasmic region, and seven leucine-rich repeats (LRRs) within the N-terminal extracellular region [Figure 3B; (6;7)]. N-linked glycosylation of TSHR is conserved and essential for the expression, trafficking, and function of TSHR (8). The LRRs of TSHR mediate protein-protein interactions and provide a TSH (alternatively, thyrotropin)-binding surface (9-11). In addition to TSH, TSHR can also be activated by other hormones including luteinizing hormone (LH), chorionic gonadotropin (CG), and thyrostimulin as well as tryptic clipping, antibodies, mutations, or small drug-like molecules (12;13).

 

The region between the LRR domain (LRD) and TMD1 (aa 289-414), termed the hinge region, is important for hormone binding and for signal transduction (14;15). Within this region are cysteine-rich fragments, termed cysteine boxes, connected by disulfide bridges. The cysteine boxes regulate the function of TSHR. Upon TSH binding, the LRD, hinge region, and the TM region undergo structural rearrangements. The greatest movement observed within the TM region is between TM5, 6, and 7 (16). Asp633 (in TM6) and Asn674 (in TM7) are essential in maintaining TSHR in an inactive state through a conformational constraint on the Asn (17). In addition, highly conserved Asn674 is necessary for ligand-induced cAMP accumulation (17).

 

The TSHR is a heterodimeric structure composed of an extracellular α-subunit and a membrane-spanning β-subunit linked by disulfide bridges (18). In the thyroid, TSHR undergoes posttranslational processing at multiple cleavage sites (19). Cleavage of TSHR releases a 50-amino acid (amino acids 317-366) C-peptide from the receptor and mediates the separation of the TSHR into the α- and β-subunits (7;18-21). The role of TSHR cleavage under physiological conditions is unknown.

 

Human TSHR can generate at least five alternatively spliced isoforms in the thyroid (22). The alternative transcripts are generated by the use of alternative transcription initiation sites (23), by the use of alternative poly(A) signals (22), or by alternative splicing. One isoform of human TSHR lacks the entire transmembrane and cytoplasmic domains (24-26). The functions of the alternative TSHR isoforms are unknown. In the mouse, a Tshr cDNA that lacks exon 5 has been identified ; exon 5 encodes 35 amino acids within the LRR domain (27). The protein product, designated as TSHR739,  localizes to the plasma membrane, but did not bind TSH or produce cAMP upon stimulation; however, TSAbs from a patient with Graves’ disease bound TSHR739 , subsequently stimulating cAMP (27).

 

Figure 4. GPCR activation cycle. In its inactive state, the GDP-bound α subunit and the βγ complex are associated. Upon agonist binding, the GPCR undergoes conformational change and exchanges GDP for GTP in the Gα subunit. GTP-Gα and βγ dissociate and modulate effectors. Hydrolysis of GTP to GDP by RGS leads to inactivation of the G-protein.

As a GPCR, TSHR couples with a heterotrimeric G protein to mediate its downstream effects. G proteins, which consist of an α subunit that binds and hydrolyzes GTP (Gα), and β and γ subunits that are constitutively associated in a complex [Figure 4; reviewed in (28)].  In the absence of a stimulus, the GDP-bound α subunit and the βγ complex are associated.  Upon activation by ligand binding, the GPCR recruits its cognate heterotrimeric G protein, and undergoes a conformational change enabling it to act as guanine nucleotide exchange factor (GEF) for the G protein α subunit.  GEFs promote the exchange of GDP for GTP, resulting in dissociation of the GTP-bound α subunit from the activated receptor and the βγ complex. Both the GTP-bound α subunit and the βγ complex mediate signaling by modulating the activities of other proteins, such as adenylyl cyclases, phospholipases, and ion channels. Gα signaling is terminated upon GTP hydrolysis, an activity intrinsic to Gα and one that may be stimulated by GTPase activating proteins (GAPs) such as regulators of G protein signaling (RGS) proteins. The GDP-bound Gα subunit reassociates with the βγ complex and is ready for another activation cycle. Ligand-induced phosphorylation of the GPCR by G protein coupled receptor kinases (GRKs) leads to sequestration of the receptor from the cell surface thereby downregulating signaling.

 

The freckle mutation results in substitution of Ser646 for a premature stop codon; Ser646 is within TM6. The mutation is not predicted to affect the alternative isoform of Tshr. The structure and function of TSHRfreckle have not been examined.

Expression/Localization

TSHR mRNA and protein are strongly expressed in the thyroid (18), with less expression in other tissues including adipose (29-31), bone (32-34), and thymus (35-37). Human TSHR is highly expressed in the thymus during early stages of T cell development, albeit at significantly lower levels than that observed in the thyroid (37). Highest expression of TSHR was detected in immature single positive thymocytes (CD4+ CD8− CD3−) and double positive thymocytes (CD4+ CD8+) (37). Tshr expression increases from very low levels at embryonic day 14 (E14) to higher levels as development progresses (38).

Background
Figure 5. Diagram of the major signaling pathways downstream of the TSHR. Activation of TSHR on the cell surface by TSH or TSHR antibodies results in the activation of two major classes of G proteins, GαS and Gαq. Activation of GαS results in activation of the cAMP/PKA/ERK signaling pathway. While activation of Gαq results in activation of the PI3/Akt/mTOR, PKC/NF-κB, and PKC/c-raf/ERK/P90RSK pathways. Activation of these pathways promotes thyroid development and other functions. See the text for more details.

After migration from the pharyngeal cavity during development, the thyroid expands in size significantly, coinciding with the synthesis of thyroid hormone from follicular cells. By E15-16 in mice, the gland has a definite shape with two lobes connected by an isthmus. During childhood in humans, thyroid growth parallels body growth [reviewed in (39)]. TSHR regulates the growth and function of the thyroid gland by activating G proteins from all four G protein classes [i.e., Gs (G stimulatory), Gq/11, G12/13, and Gi (G inhibitory)] and several subsequent signaling pathways (e.g., phospholipase C, cAMP, PIP2, and MAP kinase) (40;41).

 

The TSHR mainly functions through adenylate cyclase to regulate thyroid follicular cell proliferation and thyroid hormone synthesis and release [Figure 5; (42)]. Upon TSH binding to the TSHR, Gsα activation induces cyclic AMP (cAMP) production by adenylyl cyclase. cAMP stimulates cAMP-dependent protein kinase A (PKA), which subsequently phosphorylates cytoplasmic and nuclear target proteins such as the nuclear transcription factor CREB. Although TSH/TSHR activation mainly uses cAMP as a second messenger, other signaling cascades (e.g., the insulin growth factor-1 (IGF-1) and epidermal growth factor (EGF; see the record for Velvet for information about EGF receptor) signaling pathways are activated. IGF-1 (and insulin at supraphysiological concentrations) regulates the cell proliferative action of TSH (43). During embryonic development, EGF/EGFR is proposed to control cell proliferation and thyroid development.

 

Upon TSH binding to the TSHR, Gqα activation results in the hydrolysis of PIP2 by PLC (see the record queen for information about PLC-γ2) enzymes to produce DAG and IP3 (44). DAG is responsible for activating protein kinase C (PKC; see the record for Untied) and possibly the TRP calcium influx channels (see the record for gingame for information about TRPV5), while IP3 modulates calcium responses within the cell by binding to receptors on the intracellular membrane to allow the mobilization of intracellular calcium. 

 

TSH/TSHR pathway activation in the developing thyroid coincides with the onset of thyroid hormone biosynthesis. After the induction of TSHR in the developing thyroid, sodium/iodide symporter (NIS) expression is stimulated and the levels of thyroglobulin (Tg) and thyroid peroxidase (TPO) increase (38). TSH/TSHR-associated signaling is also required for the targeting of NIS to the plasma membrane (45). The TSH/TSHR signaling pathways regulate the expression of the transcription factors Titf1, Pax8, and Foxe1 in vitro, all of which regulate the expression of genes that encode proteins that function in the thyroid hormone biosynthesis. In vivo, loss of Tshr expression does not alter the expression of Titf1, Pax8, or Foxe1.

 

In addition to a role in thyroid development and function, the TSHR has a role in T and B cell development. Tshrhyt/Tshrhyt mice have a spontaneous mutation in Tshr resulting in a proline to leucine substitution at amino acid 556 (46-48). The Tshrhyt/Tshrhyt mice exhibited a T cell development block at the immature single positive (SP) or double positive stages and subsequent reduced frequencies of double positive and single positive thymocytes compared to wild-type mice; the frequency of T cells in the blood and spleen were not changed (37).  Tshrhyt/Tshrhyt mice also exhibited reduced frequencies of pro-B, pre-B, and B cells in the bone marrow compared to wild-type mice (49;50). The frequency of IgM+ cells in the spleens of the Tshrhyt/Tshrhyt mice was comparable to that in wild-type mice (50). TSHR signaling is proposed to regulate T cell development through functioning in both T cell differentiation and survival. The expression patterns of several genes involved in T cell development of immature SP thymocytes were upregulated upon treatment with recombinant TSH. In addition, the expression levels of genes involved in apoptosis induction and proliferation were reduced, while the expression levels of genes involved in differentiation were increased (37). TSHR-associated signaling is also proposed to be involved in pre-TCR-signaling and β-selection and/or subsequent induction of TCR rearrangements (37).

 

Skeletal remodeling is a process by which old bone is resorbed by the osteoclast and is replaced by new bone by the osteoblast. TSH/TSHR is essential for skeletal remodeling, osteoblastic bone formation, and osteoclastic bone resorption (32). Hypothyroidism causes growth arrest and delayed bone maturation; thyroid hormone replacement therapy leads to rapid catch-up growth in both humans and mice (46;51;52). The Tshrhyt/Tshrhyt mice have delayed endochondral ossification as well as impaired chondrocyte differentiation, reduced cortical bone thickness, impaired trabecular remodeling, and reduced bone mineralization (34). Loss of Tshr expression in Tshr-deficient (Tshr-/-) mice resulted in both osteoporosis (i.e., bone loss) and osteosclerosis (i.e., localized bone formation) (32). TSH/TSHR inhibits osteoclast formation and survival by attenuating JNK and NF-κB signaling in response to receptor activator of NF-κB ligand (RANKL) and TNFα (see the record for Panr1) (32;53). RANKL binding to RANK stimulates the non-canonical NF-κB signaling pathway (see the record for xander). TNFα binding to TNFR-1 results in activation of the TAB2/TAK1 complex, and subsequent activation of the IKK complex to phosphorylate IκB, resulting in release of NF-κB for translocation to the nucleus and activation of gene expression. TNFR1 also activates JNK through sequential recruitment of TRAF2, MEKK1 and MKK7. MAPK activation involves signaling through TRADD, RIP and MKK3. TRADD recruitment to TNFR1 also leads to the induction of apoptosis through FAS (see the record for cherry)-associated death domain (FADD) protein, caspase-8 and caspase-3. TSH/TSHR inhibits osteoblast differentiation in a Runx2- and osterix-independent manner by downregulating Wnt and VEGF signaling (32).

 

TSH/TSHR promotes cholesterol synthesis and fasting glucose homeostasis through the cAMP/PKA/CREB pathway (54). Tshr-/- mice exhibited reduced fasting blood glucose levels and increased insulin sensitivity, but normal fasting plasma insulin levels (55). Loss of Tshr expression resulted in reduced hepatic glucose production due to a downregulation in the expression of mRNAs associated with hepatic gluoconeogenesis [i.e., glucose-6-phosphatase and phosphoenolpyruvate pyruvate carboxylase (PEPCK)] as well as an upregulation in enzymes associated with glycogen synthesis (e.g., hepatic glucokinase) (55).

 

Mutations in TSHR are linked to familial gestational hyperthyroidism [OMIM: #603373; (56;57)], nonautoimmune hyperthyroidism [OMIM: #609152; (58;59)], congenital nongoitrous hypothyroidism 1 [OMIM: #275200; (60-62)], somatic hyperfunctioning thyroid adenoma (63), and thyroid carcinoma with thyrotoxicosis (64). Non-autoimmune hyperthyroidism and toxic nodules are caused by mutations (e.g., Gly431Ser) that cause constitutive activation of the TSHR-Gs-adenylyl cyclase signaling pathway or the activation of the TSHR-Gq/11-phospholipase Cβ (PLCβ) pathway. Impaired function of the TSHR results in either TSH elevation with normal thyroid hormone levels (hyperthyrotropinemia) or as more severe congenital hypothyroidism with thyroid gland hypoplasia (e.g., Cys41Ser and Cys600Arg) (65;66). In Graves’ disease, thyroid stimulating antibody (TSAb) targets the TSHR, subsequently resulting in continuous stimulation of hormone synthesis, hormone secretion, and cell growth.

 

Similar to human patients with inactivating TSHR mutations, Tshrhyt/Tshrhyt and Tshr-/- mice exhibit hypothyroidism (46;48;67;68). The TSHRhyt protein does not stimulate an increase in cAMP in response to TSH as opposed to wild-type TSHR that exhibits a 7.4-fold increase in cAMP upon TSH stimulation because the TSHRhyt protein failed to bind TSH (67). The Tshrhyt/Tshrhyt mice exhibited hearing loss as well as inner ear defects including tectorial membrane distortion, tunnel of Corti dysplasia, outer hair cell abnormalities, and a contiguous membrane along the apices of the outer hair cell stereocilia (69;70); Tshr-/- mice exhibit middle ear abnormalities including enlarged ossicles, delayed ossficiation of the ossicles, and chronic persistence of mesenchyme in the middle ear into adulthood (71). Some studies have noted a variable spontaneous, asymmetrical circling behavior in the Tshrhyt/Tshrhyt mice (72). The mice that exhibited the circling behavior had a reduced number of midbrain dopamine neurons compared to mice that did not circle (72). Both male and female Tshrhyt/Tshrhyt mice are infertile (73); male infertility can be reversed by supplementing them with thyroid. Egg development was not affected in the Tshrhyt/Tshrhyt female mice; however, the female Tshrhyt/Tshrhyt mice exhibited continuous dioestrus (73). In addition, follicles were degenerative and corpora lutea was not observed in the ovaries. The number of ovaluted eggs was lower than that in wild-type mice.

Putative Mechanism

Tshrhyt/Tshrhyt and Tshr-/- mice exhibit a retarded growth rate at weaning that becomes more pronounced with age (34;46;68), similar to the freckle mice.  The reduced size/growth rate of the freckle mice indicates that there is loss of TSHRfreckle function and/or expression.   

Primers PCR Primer
freckle(F):5'- AAGGTCAGCATCTGCCTGCCAATG -3'
freckle(R):5'- TCACTGTGACTAGCGTAGCCTTTCC -3'

Sequencing Primer
freckle_seq(F):5'- TCTGCCTGCCAATGGACAC -3'
freckle_seq(R):5'- GGAGTTTCCAAGCAGTTCATAG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsCarlos Reyna Tiana Purrington Jeff SoRelle
List |< first << previous [record 9 of 30] next >> last >|