Phenotypic Mutation 'ca-los' (pdf version)
List |< first << previous [record 51 of 511] next >> last >|
Alleleca-los
Mutation Type nonsense
Chromosome4
Coordinate80,844,868 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Tyrp1
Gene Name tyrosinase-related protein 1
Synonym(s) Tyrp, isa, Oca3, TRP1, TRP-1
Chromosomal Location 80,834,123-80,851,719 bp (+)
MGI Phenotype The major influence of mutations at this locus is to change eumelanin from a black to a brown pigment in the coat and eyes. Alleles differ in the distribution of brown pigment granules and therefore differ in color intensity.
Accession Number

Ncbi RefSeq: NM_031202.2; MGI:98881

Mapped Yes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000006151] [ENSMUSP00000099895]
SMART Domains Protein: ENSMUSP00000006151
Gene: ENSMUSG00000005994
AA Change: Q331*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 417 1.7e-37 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000099895
Gene: ENSMUSG00000005994
AA Change: Q331*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 417 4.9e-38 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category pigmentation, skin/coat/nails
Penetrance  
Alleles Listed at MGI

All mutations/alleles(60) : Chemically and radiation induced(1) Chemically induced (ENU)(8) Chemically induced (other)(14) Radiation induced(28) Spontaneous(8) Targeted(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Tyrp1 APN 4 80840765 missense possibly damaging 0.95
IGL01586:Tyrp1 APN 4 80844898 missense probably benign 0.00
IGL01620:Tyrp1 APN 4 80844802 nonsense probably null
IGL02126:Tyrp1 APN 4 80837608 nonsense probably null
IGL02174:Tyrp1 APN 4 80844826 nonsense probably null
IGL02601:Tyrp1 APN 4 80840775 missense probably null 0.00
IGL02630:Tyrp1 APN 4 80840757 missense possibly damaging 0.95
butter UTSW 4 80840806 critical splice donor site probably null
chi UTSW 4 80840778 missense probably damaging 1.00
R0011:Tyrp1 UTSW 4 80840793 missense probably damaging 1.00
R0011:Tyrp1 UTSW 4 80840793 missense probably damaging 1.00
R0145:Tyrp1 UTSW 4 80840778 missense probably damaging 1.00
R1172:Tyrp1 UTSW 4 80844868 nonsense probably null
R1173:Tyrp1 UTSW 4 80844868 nonsense probably null
R1175:Tyrp1 UTSW 4 80844868 nonsense probably null
R1886:Tyrp1 UTSW 4 80840806 critical splice donor site probably null
R2099:Tyrp1 UTSW 4 80835379 missense probably damaging 0.99
R2273:Tyrp1 UTSW 4 80837534 missense probably damaging 1.00
R2274:Tyrp1 UTSW 4 80837534 missense probably damaging 1.00
R2275:Tyrp1 UTSW 4 80837534 missense probably damaging 1.00
R2312:Tyrp1 UTSW 4 80837564 nonsense probably null
R2427:Tyrp1 UTSW 4 80850871 missense probably benign 0.00
R2440:Tyrp1 UTSW 4 80846606 missense probably benign 0.41
R2915:Tyrp1 UTSW 4 80837455 missense possibly damaging 0.60
R4343:Tyrp1 UTSW 4 80849841 missense possibly damaging 0.92
R4512:Tyrp1 UTSW 4 80837512 missense probably damaging 1.00
R4703:Tyrp1 UTSW 4 80840806 unclassified probably null
R4732:Tyrp1 UTSW 4 80844935 missense possibly damaging 0.67
R4733:Tyrp1 UTSW 4 80844935 missense possibly damaging 0.67
R4788:Tyrp1 UTSW 4 80844943 nonsense probably null
R4834:Tyrp1 UTSW 4 80846596 nonsense probably null
R4911:Tyrp1 UTSW 4 80850907 missense unknown
R4938:Tyrp1 UTSW 4 80840646 missense probably damaging 1.00
R5129:Tyrp1 UTSW 4 80846607 missense probably damaging 1.00
R5154:Tyrp1 UTSW 4 80850717 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 037530-MU
Last Updated 12/07/2016 11:29 AM by Anne Murray
Record Created 07/16/2014 12:36 PM by Tiana Purrington
Record Posted 10/27/2014
Phenotypic Description
Figure 1. The ca-los mouse has brown fur and black eyes.

The ca-los phenotype was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R1172, some of which exhibited a brown coat color and black eyes (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 60 mutations. Among these, only one affected a gene with known effects on pigmentation, Tyrp1. The mutation in Tyrp1 was presumed to be causative because the ca-los hypopigmentation phenotype mimics other known alleles of Tyrp1 (see MGI for a list of Tyrp1 alleles and the chi page). The Tyrp1 mutation is a C to T transition at base pair 80,844,868 (v38) on chromosome 4, or base pair 10,661 in the GenBank genomic region NC_000070. The mutation corresponds to residue 1,280 in the mRNA sequence NM_031202 within exon 5 of 8 total exons.

 

1265 CGTCTTCCTGAGCCACAGGATGTCACTCAGTGC
326  -R--L--P--E--P--Q--D--V--T--Q--C-

 

The mutated nucleotide is indicated in red lettering and results in the conversion of glutamine 331 to a stop codon (Q331*) in the Tyrp1 protein. 

Protein Prediction
Figure 2. Domain structure of tyrosinase-related protein 1 (Tyrp1). The ca-los mutation results in a conversion of glutamine 331 to a stop codon (Q331*).  SP, signal peptide; EGF-like, epidermal growth factor-like domain; TM, transmembrane; CT, cytoplasmic tail. Glycosylation and copper binding sites are indicated in light pink and purple, respectively. The EGF-like/Cysteine-rich domain (EGF-like) is labeled. A central cysteine-rich (Cys-rich) region is between the copper binding regions (CuA and CuB; the exact amino acid residues that comprise the Cys-rich region are not documented). The CuA, Cys-rich, and CuB regions comprise the catalytic domain of Tyrp1. Image is interactive, click on the image to view other Tyrp1 mutations.

Tyrp1 (alternatively, Trp1 or gp75) is a member of the tyrosinase-related protein (TRP) family that also consists of tyrosinase (Tyr; see the records for ghost, pale rider, and siamese) and Tyrp2 [alternatively, DOPAchrome tautomerase (DCT)]. The TRP proteins share homologous domains including a signal sequence, an EGF-like/cysteine (Cys)-rich domain, a catalytic domain that has two copper binding regions and a Cys-rich region, a transmembrane domain, and six putative glycosylation sites (Figure 2) (1-5). Mature Tyrp1 can exist both as an intracellular form (75-80 kDa) and a secreted form (78-88 kDa) [(6); reviewed in (4;7)]. Intracellular Tyrp1 has the N-terminal signal peptide, a long N-terminal luminal domain with the N-linked glycosylation sites, the transmembrane region, and the C-terminal domain (6). In contrast, soluble Tyrp1 lacks the transmembrane domain, the C-terminal tail, and a small region in the luminal domain (6). The ca-los mutation is within the catalytic domain of Tyrp1 and would result in the loss of coding of the transmembrane domain and the cytoplasmic tail; the expression and localization of Tyrp1ca-los has not been examined.

 

For more information on Tyrp1, please see the record for chi.

Putative Mechanism
Figure 3. Biochemical pathway leading to the synthesis of eumelanin and pheomelanin. The TRP proteins are labeled in red. Tyrp1 primarily functions as a 5,6-dihydorxyindole 2-carboxylic acid (DHICA) oxidase.

Tyr, Tyrp1, and Tyrp2 are Cu++/Zn++ metalloenzymes that function in melanogenesis leading to the formation of two types of pigments, eumelanins (brown or black) and pheomelanins (yellow or red) (Figure 3).  The primary function attributed to Tyrp1 is that of a DHICA oxidase (8;9), catalyzing the oxidation of DHICA to indole-5,6-quinone-2-carboxylic acid, a product that is eventually converted to eumelanin. Mutations in TYRP1 are linked to oculocuaneous albinism type III [OCA3; OMIM: #203290; (10)] and variations in skin/hair/eye pigmentation linked to 9p23 in Melanesians [OMIM: #612271; (11)]. Individuals with OCA3 have reduced pigment of the skin, hair, and eyes (10). Homozygous Tyrp1 mutant mice [e.g., brown, MGI:1855960; cordovan, MGI: 1855961; light, MGI:1855962; white-based brown, MGI: 1855963] exhibit a brown coat color on a non-agouti background. Loss of pigmentation in brown and light is attributed to disorganized, round melanosomes (12) or to premature death of follicular melanocytes (13), respectively. Similar to the above-mentioned mouse mutants, the Tyrp1 mutation in ca-los results in hypopigmentation, indicating loss of Typr1 function. It is unknown whether the ca-los mutation results in the death of follicular melanocytes or in disorganization of melanosomes.

Primers
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJoel Purrington Tiana Purrington
List |< first << previous [record 51 of 511] next >> last >|