Phenotypic Mutation 'coward' (pdf version)
List |< first << previous [record 77 of 511] next >> last >|
Allelecoward
Mutation Type missense
Chromosome7
Coordinate98,085,466 bp (GRCm38)
Base Change A ⇒ C (forward strand)
Gene Myo7a
Gene Name myosin VIIA
Synonym(s) Myo7, nmf371, polka, Hdb, USH1B
Chromosomal Location 98,051,060-98,119,524 bp (-)
MGI Phenotype Homozygotes for spontaneous and chemically induced mutations exhibit deafness, hyperactivity, head-shaking, and circling, with degeneration of the organ of Corti, spiral ganglion, stria vascularis in the cochlea, and vestibular ganglion in the labyrinth.
Accession Number

NCBI RefSeq: NM_001256081, NM_008663, NM_001256082, NM_001256083; MGI:104510

Mapped Yes 
Amino Acid Change Leucine changed to Arginine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000082046] [ENSMUSP00000102739] [ENSMUSP00000102744] [ENSMUSP00000102745] [ENSMUSP00000146165]
SMART Domains Protein: ENSMUSP00000082046
Gene: ENSMUSG00000030761
AA Change: L607R

DomainStartEndE-ValueType
MYSc 48 731 N/A SMART
IQ 732 754 2.99e0 SMART
IQ 755 777 8.77e-7 SMART
IQ 801 823 8e0 SMART
IQ 824 846 8.7e0 SMART
low complexity region 854 889 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 972 985 N/A INTRINSIC
MyTH4 1006 1242 1.4e-71 SMART
B41 1243 1458 8.82e-42 SMART
SH3 1557 1622 4.93e-7 SMART
MyTH4 1698 1847 3.95e-57 SMART
B41 1849 2066 8.27e-56 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000084979)
SMART Domains Protein: ENSMUSP00000102739
Gene: ENSMUSG00000030761
AA Change: L613R

DomainStartEndE-ValueType
MYSc 48 737 N/A SMART
IQ 738 760 2.99e0 SMART
IQ 761 783 8.77e-7 SMART
IQ 807 829 8e0 SMART
IQ 830 852 8.7e0 SMART
low complexity region 860 895 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 978 991 N/A INTRINSIC
MyTH4 1012 1248 1.4e-71 SMART
B41 1249 1464 8.82e-42 SMART
SH3 1563 1628 4.93e-7 SMART
MyTH4 1704 1853 3.95e-57 SMART
B41 1855 2072 8.27e-56 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000107122)
SMART Domains Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761
AA Change: L618R

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1568 1633 4.93e-7 SMART
MyTH4 1709 1858 3.95e-57 SMART
B41 1860 2077 8.27e-56 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000107127)
SMART Domains Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761
AA Change: L618R

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1606 1671 4.93e-7 SMART
MyTH4 1747 1896 3.95e-57 SMART
B41 1898 2115 8.27e-56 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000107128)
Predicted Effect noncoding transcript
Phenotypic Category behavior/neurological, nervous system
Penetrance  
Alleles Listed at MGI

All mutations/alleles(22) : Chemically induced (ENU)(13) Spontaneous(5) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Myo7a APN 7 98102626 missense probably damaging 1.00
IGL00785:Myo7a APN 7 98054348 missense probably damaging 0.99
IGL00840:Myo7a APN 7 98051659 missense probably benign 0.25
IGL01362:Myo7a APN 7 98097702 missense probably damaging 1.00
IGL01484:Myo7a APN 7 98085422 missense probably damaging 1.00
IGL01673:Myo7a APN 7 98054708 missense probably benign 0.00
IGL01933:Myo7a APN 7 98083142 missense probably damaging 0.99
IGL01943:Myo7a APN 7 98065647 missense probably damaging 0.96
IGL02188:Myo7a APN 7 98091027 missense probably damaging 0.96
IGL02304:Myo7a APN 7 98077736 missense possibly damaging 0.68
IGL02305:Myo7a APN 7 98051629 makesense probably null
IGL02331:Myo7a APN 7 98053182 missense possibly damaging 0.95
IGL02386:Myo7a APN 7 98075112 missense probably benign 0.16
IGL02389:Myo7a APN 7 98106991 unclassified probably null
IGL02832:Myo7a APN 7 98091020 unclassified probably null
IGL02839:Myo7a APN 7 98091122 missense probably damaging 1.00
IGL03193:Myo7a APN 7 98091057 missense probably damaging 1.00
IGL03237:Myo7a APN 7 98102593 missense probably damaging 1.00
IGL03384:Myo7a APN 7 98093593 missense probably damaging 1.00
H8786:Myo7a UTSW 7 98095778 missense possibly damaging 0.61
IGL03046:Myo7a UTSW 7 98079327 missense probably damaging 1.00
IGL03134:Myo7a UTSW 7 98056767 missense possibly damaging 0.94
R0054:Myo7a UTSW 7 98065698 missense probably damaging 1.00
R0054:Myo7a UTSW 7 98065698 missense probably damaging 1.00
R0071:Myo7a UTSW 7 98056830 missense probably damaging 0.98
R0071:Myo7a UTSW 7 98056830 missense probably damaging 0.98
R0267:Myo7a UTSW 7 98054624 missense probably benign 0.08
R0408:Myo7a UTSW 7 98056781 missense probably damaging 1.00
R0411:Myo7a UTSW 7 98071937 missense probably benign
R0540:Myo7a UTSW 7 98071946 missense probably damaging 1.00
R0607:Myo7a UTSW 7 98071946 missense probably damaging 1.00
R0629:Myo7a UTSW 7 98085466 missense probably damaging 1.00
R0632:Myo7a UTSW 7 98112150 splice donor site noncoding transcript
R0659:Myo7a UTSW 7 98054338 splice donor site probably null
R0735:Myo7a UTSW 7 98081180 splice acceptor site noncoding transcript
R0924:Myo7a UTSW 7 98098256 missense probably damaging 0.99
R0930:Myo7a UTSW 7 98098256 missense probably damaging 0.99
R1018:Myo7a UTSW 7 98107005 missense probably damaging 1.00
R1196:Myo7a UTSW 7 98097673 missense possibly damaging 0.87
R1331:Myo7a UTSW 7 98107008 missense probably benign 0.00
R1487:Myo7a UTSW 7 98053810 missense probably damaging 0.99
R1627:Myo7a UTSW 7 98091736 splice donor site noncoding transcript
R1674:Myo7a UTSW 7 98054595 splice donor site noncoding transcript
R1676:Myo7a UTSW 7 98099472 critical splice donor site probably null
R1695:Myo7a UTSW 7 98092496 missense possibly damaging 0.94
R1768:Myo7a UTSW 7 98065597 splice donor site noncoding transcript
R1770:Myo7a UTSW 7 98112606 critical splice donor site noncoding transcript
R1781:Myo7a UTSW 7 98073124 missense probably damaging 1.00
R1789:Myo7a UTSW 7 98107095 missense probably damaging 0.99
R1827:Myo7a UTSW 7 98076731 missense probably damaging 1.00
R1864:Myo7a UTSW 7 98052256 missense probably damaging 1.00
R1955:Myo7a UTSW 7 98054921 missense probably damaging 1.00
R2011:Myo7a UTSW 7 98054708 missense possibly damaging 0.69
R2229:Myo7a UTSW 7 98054910 missense probably benign 0.12
R2259:Myo7a UTSW 7 98069499 missense probably damaging 0.99
R2443:Myo7a UTSW 7 98095769 missense probably benign 0.07
R2898:Myo7a UTSW 7 98054424 nonsense probably null
R2898:Myo7a UTSW 7 98097206 missense probably damaging 1.00
R3158:Myo7a UTSW 7 98052292 missense probably damaging 1.00
R3408:Myo7a UTSW 7 98081087 missense probably benign 0.00
R4222:Myo7a UTSW 7 98073229 missense possibly damaging 0.92
R4255:Myo7a UTSW 7 98071964 missense probably damaging 0.96
R4374:Myo7a UTSW 7 98102674 missense probably damaging 1.00
R4429:Myo7a UTSW 7 98053188 missense probably damaging 0.99
R4445:Myo7a UTSW 7 98066404 missense probably damaging 1.00
R4579:Myo7a UTSW 7 98073193 missense probably damaging 1.00
R4659:Myo7a UTSW 7 98085466 missense probably damaging 1.00
R5073:Myo7a UTSW 7 98073218 nonsense probably null
R5138:Myo7a UTSW 7 98083599 missense probably damaging 1.00
R5566:Myo7a UTSW 7 98064816 missense possibly damaging 0.93
R5580:Myo7a UTSW 7 98073160 missense probably damaging 1.00
R6079:Myo7a UTSW 7 98065790 nonsense probably null
R6138:Myo7a UTSW 7 98065790 nonsense probably null
U15987:Myo7a UTSW 7 98065790 nonsense probably null
X0028:Myo7a UTSW 7 98065725 missense probably damaging 1.00
X0058:Myo7a UTSW 7 98062648 missense probably benign 0.02
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository

MMRRC:37530

Last Updated 05/13/2016 3:09 PM by Anne Murray
Record Created 08/03/2014 3:51 PM by Jeff SoRelle
Record Posted 09/16/2014
Phenotypic Description

Figure 1. Click to view video of coward phenotype.

The coward phenotype was identified among G3 mice of the pedigree R0629, some of which exhibited head tossing, hyperactivity, and circling (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the vestibular using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 65 mutations (X-axis) identified in the G1 male of pedigree R0629.  Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 65 mutations. The vestibular phenotype was linked to a mutation in Myo7a: a T to G transversion at base pair 98,085,466 (v38) on chromosome 7, or base pair 34,057 in the GenBank genomic region NC_000073. Linkage was found with a recessive model of inheritance (P = 7.884 x 10-6), wherein four affected mice were homozygous for the variant allele, and 17 unaffected mice were either heterozygous (n = 9) or homozygous (n = 7) for the reference allele (Figure 2). The mutation corresponds to residue 2,113 in the mRNA sequence NM_001256081 within exon 4 of 6 total exons.

 

2097 CAGTTCAAGCGGTCTCTGGAGCTGCTGATGCGC

613  -Q--F--K--R--S--L--E--L--L--M--R-

 

The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to arginine (R) substitution at position 618 (L618R) in the myosin VIIa (Myo7a) protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00).

Protein Prediction

Myosins are divided into conventional (muscle myosins and myosins similar in structure and function to muscle myosins, all belonging to class II) and unconventional classes (myosins that do not resemble muscle myosins). Myo7a encodes myosin VIIa, a member of unconventional myosin family (1;2).

 

Figure 3. Domain structure of myosin VIIa.  Within the motor domain, myosin VIIa has an ATP- and actin-binding site. Five IQ motifs are located within the neck of myosin VIIa. The C-terminal tail contains two myosin tail homology 4 (MyTH4) domains, a Src homology 3 (SH3) domain, and two band 4.1/ezrin/radixin/moesin (FERM) domains. The ATP- and actin-binding sites are indicated. The coward mutation (red asterisk;Leu618Arg) is within the motor head domain of myosin VIIa. See the text for more details.

Myosin VIIa has a motor head domain, a regulatory neck domain, and a tail domain [(3;4); Figure 3]. The motor domain (amino acids 59-742) has an adenosine triphosphate (ATP)-binding site (amino acids 158-165) and an actin-binding site (amino acids 632-639). The motor domain facilitates the movement of myosin VIIa along actin filaments by utilizing the energy generated from the hydrolysis of ATP (5-7).

 

The myosin VIIa neck region has five IQ (isoleucine-glutamine) motifs (amino acids 743-765, 766-788, 791-811, 812-834, and 835-857) and a predicted coiled-coil (CC) region (amino acids 858-935). IQ motifs are α-helical structures that often mediate the binding of myosins to calmodulin, to members of the EF-hand family of calcium-binding proteins, or to myosin light chains [(8;9); reviewed in (10;11)]. IQ repeats 1, 2, and 4 of myosin VIIa promote the association of myosin VIIa with calmodulin (8;12;13); IQ repeats 3 and 5 may be associated with calmodulin-like proteins (3). The CC domain of myosin VIIa promotes the homodimerization (3;14).

 

Figure 4. Structure of the MyTH4-FERM-SH3 region of mouse Myo7a. Amino acids 965-1649 were crystallized. See the text for more details. UCSF Chimera structure adapted from PDB:3PVL and (15). Click on the image to view the structure rotate.

Within the tail region of myosin VIIa are two myosin tail homology 4 (MyTH4) domains (amino acids 1017-1253 and 1747-1896), two band 4.1/ezrin/radixin/moesin (FERM)-like domains (amino acids 1254-1469 and 1898-2115), and a Src homology 3 (SH3) domain (amino acids 1606-1671) (3;4;14;15). The tail region of myosin VIIa interacts with vesicle-associated proteins (e.g., Slac2-c/MyRIP) indicating that it might regulate the cargo transport function of myosin VIIa (16-18). MyTH4 domains are proposed to function in microtubule and/or actin binding (19). FERM domains are often found in membrane-associated proteins and mediate the interaction of the FERM-containing proteins with the cytoplasmic domains of integral membrane proteins and/or they function as a mediator between the cell membrane and actin cytoskeleton (20-22). The FERM domains of myosin VIIa link myosin VIIa to other cytoskeletal proteins (2) and facilitate the association of myosin VIIa with melanosomes in the retinal pigment epithelium (RPE) (5). SH3 domains function in recognizing and binding proline-rich sequences (23) and are often found in proteins that function in synaptic vesicle endocytosis (24) and/or those that facilitate the proper localization of proteins (25). The MyTH4-FERM-SH3 (MFS) region of mouse myosin VIIa (amino acids 965-1649) has been crystallized [Figure 4; PDB:3PVL; (15)]. The MFS region exhibited a Y-shaped architecture whereby the MyTH4 domain packed with the F1 lobe of the FERM domain and the F1, F2, and F3 lobes of the FERM domain formed a cloverleaf configuration (15). The SH3 domain coupled to the F3 lobe via a short α-helix (15); the α-helix packed with the βB/βA/βE β-sheet of the SH3 domain to leave the canonical SH3 target-recognition pocket open. The MyTH4 domain consisted of a 10 α-helix bundle. The six central α helices (α2 and α5-α9) of the MyTH4 domain are highly conserved among proteins that contain MyTH4 domains and assembles into a right-handed superhelical core (15). The α9/α10 loop and α10 are also highly conserved among proteins that contain MyTH4 domains; α1, α3, and α4 are more divergent. The α9/α10 loop and α10 cap one end of the six-helix MyTH4 core and contact the F1 lobe of the FERM domain (15).

 

Myo7a encodes several alternatively spliced isoforms (3;4;26). The two primary isoforms of Myo7a are the canonical sequence and a shorter isoform that encodes a protein that differs from canonical myosin VIIa at amino acid 1171, where it diverges and ends 32 amino acids later in a stop codon (4).

 

The coward mutation (Leu618Arg) is within the motor head domain of myosin VIIa and preceeds the actin-binding motif.

Expression/Localization

MYO7A is expressed in adult human kidney and liver, the RPE, the photoreceptor cells of the retina, the embryonic cochlear and vestibular neuroepithelia, and developing olfactory receptor sensory neurons (3;6;27). Within the photoreceptor cells, myosin VIIa is localized in the inner segments and the base of the outer segments as well as in the synaptic region (28;29).

 

In the mouse, Myo7a is expressed in the retina, cochlea, kidney, and liver (6). At embryonic day (E) 9, the myosin VIIa protein is first observed in the optic vesicle (30). By E10, myosin VIIa is expressed in the olfactory epithelium and liver (30). At E12, expression is observed in the RPE, choroid plexus, adrenal gland, and tongue (30). At E13, expression is observed in the testis and anterior pituitary (30). In the mouse inner ear, myosin VIIa is strongly expressed in the sensory epithelia of the vestibular system (i.e., the saccular and utricular maculae and the three cristae) from as early as E14.5 (31). At E15, expression of myosin VIIa is noted in the small intestine, kidney, and hair follicles of the vibrissae (30). Within these tissues, myosin VIIa was only expressed in epithelial cell types (i.e., cell types that have microvilli or cilia) (30). In 16.5-day old mouse embryos, the cochlear and vestibular sensory hair cells of the inner ear as well as the epithelial cells of the small intestine, hepatocytes, and choroidal plexus expressed Myo7a (3;31). In the adult mouse, the myosin VIIa protein is expressed in the inner and outer hair cells of the cochlea, the apical region of RPE cells, testis, brain, ear, lung, and kidney (4;5;14;27). Within the hair cells of the inner ear, myosin VIIa localizes to the entire length of the stereocilia, the cuticular plate, and the pericuticular necklace (32)

 

Both primary Myo7a isoforms were highly expressed in the testis, while the shorter transcript was less abundant than canonical Myo7a (4). In the mouse, the shorter isoform was not detected in either the retina or the cochlea (4).

Background

Myosins are actin-based molecular motors that generate mechanical force using the energy generated from the hydrolysis of ATP. Myosins function in organelle and vesicle movement, cytokinesis, phagocytosis, signal transduction, cellular movement, membrane trafficking, regulation of ion channels, and muscle contraction (33). Several unconventional myosins are essential for stereocilia development and/or maintenance including Myo6 (see the record for mayday circler), Myo15 (see the record for parker), and myosin VIIa (1). Mutations in Myo6, Myo15, or Myo7a result in stereocilia fusion, short stereocilia, and disorganized stereocilia, respectively (31;34;35). For more information about the general functions of myosins see mayday circler (Myo6), new gray (Myo5a), and parker (Myo15a).

 

Figure 5. Sensory cells in the inner ear and retina. (A) Inner hair cells are located within the organ of Corti. The hair bundle is composed of numerous stereocilia that develop from microvilli and have a stiff core of parallel actin filaments anchored in the cuticular plate, a meshwork of horizontal actin filaments beneath the apical cell membrane. Lateral to the tallest stereocilium is the kinocilium, which is formed from the basal body. The stereocilia are connected to each other by numerous filaments, including tip links, horizontal top connectors, transient lateral links and ankle links. The synaptic junction between the hair cell and afferent and efferent neurons is located at the base of the cell and contains ribbons. (B) The molecular components of the cross link complexes of the inner ear hair cell. In the tip link, Cdh23 interacts with Pcdh15, harmonin, myosin VIIa, Myo1c, calmodulin, and Sans to help maintain the structure and function of the inner ear hair cell. (C) Rod and cone cells are highly polarized photoreceptors. The outer segment is a modified cilium and is attached to the inner segment by a connecting cilium. The nucleus is located within the outer nuclear layer. The synaptic terminals contain ribbons and connect the photoreceptor cells with horizontal, ganglion, and bipolar (shown) cells.

Each hair cell in the inner ear is comprised of a bundle of up to 300 stereocilia that project from the apical cell surface (36;37); each stereocilium is filled with up to 1000 polarized and cross-linked actin filaments [Figure 5; (38)]. The stereocilia are organized in a staircase pattern and held together by extracellular lateral projections (side-links). Deflection of the hair bundle results in gating of transducer channels at the tips of the stereocilia and subsequent modulation of the cell membrane potential that converts the sound-evoked mechanical stimulus into an electrical signal (i.e., mechano-electrical transduction) (37;39). For more information about proteins involved in the maintenance and function of the hair cells of the inner ear please see the records for dee dee, squirm, and parker.

 

In the inner ear, myosin VIIa controls hair bundle morphogenesis, organization, and polarity  (31;40) as well as the elongation of the stereocilia (41). Myosin VIIa functions in anchoring and holding membrane-bound elements to the actin core of the stereocilium as well as for normal gating of the transducer channels in the hair cells upon sustained deflection of the hair bundle (40;42;43).

 

Myosin VIIa, harmonin, cadherin 23 (Cdh23; see the record for dee dee), protocadherin 15 (Pcdh15; see the record for squirm), and Sans are all Usher syndrome 1 (USH1)-associated proteins.  The USH1 proteins form a network of complexes within the stereocilia of hair cells (44). Mutations in any of the USH1 proteins results in hair cell stereocilia morphological defects. Myosin VIIa applies tension forces on hair bundle transient lateral links while in complex with Cdh23 and harmonin (40;42). In Myo7a mutant mice, harmonin is absent from the disorganized hair bundles indicating that myosin VIIa is required for harmonin transport along the actin core of the stereocilia during development (44). Myosin VIIa and Pcdh15 cooperate to regulate hair bundle development and function; in Myo7a-deficient mice, Pcdh15 is mislocalized (45). Myosin VIIa also interacts with twinfilin-2, an actin-binding protein that inhibits actin polymerization at the barbed end of the filament (46;47). Twinfilin-2 localizes to the tips of shorter stereocilia within the hair bundle (46). The myosin VIIa-twinfilin interaction is proposed to regulate stereocilia length within the hair bundle staircase (46). In hair cells from Myo7a knockout (Myo7a-/-) mice, whirlin, a protein that functions in stereocilia elongation, was abnormally persistently localized to the tip (41).

 

In the synaptic terminals of the photoreceptor cells of the retina, myosin VIIa colocalizes with Cdh23, Pcdh15, and harmonin. The myosin VIIa/Cdh23/Pcdh15/harmonin complex in the photoreceptor synapse is proposed to have a role in the structural and functional organization of the synaptic junction (48). Myosin VIIa regulates the transport of opsin (see the record for Bemr3) from the inner segment to the outer segment in photoreceptor cells (49), the phagocytosis of shed outer segment discs by the RPE (50), and melanosome localization to the apical processes of the RPE (51). Myosin VIIa is primarily required for the transport of phagosomes into the RPE cell body where they can then fuse with lysosomes (50). Phagocytosis of photoreceptor discs by the RPE is essential for photoreceptor cell viability; defects in this process may contribute to the progressive blindness observed in patients with MYO7A mutations (50). In the retina, myosin VIIa also interacts with the small GTPase Rab27 (see the record for concrete) that binds melanosomes via the linker protein Slac2-c/MyRIP (52;53). Myosin VIIa is required for the light-dependent translocation of the isomerohydrolase RPE65 to the central region of the RPE cells, a process necessary for the regulation of the visual retinoid cycle (54).

 

Mutations in MYO7A are linked to autosomal dominant deafness (DNFA11;OMIM: 601317; (55;56)), recessive deafness (DFNB2; OMIM: 600060; (57;58)), and Usher Syndrome type 1B (USH1B; OMIM: 276900; (3;4;6;26;59). DNFA11 is nonsyndromic, progressive neurosensory hearing loss; some patients exhibit mild vestibular symptoms (60). DFNB2 patients exhibit a variable onset of nonsyndromic neurosensory deafness and can also have vertigo (61;62). Patients with USH1B exhibit audiovestibular and visual defects including congenital sensorineural hearing loss, vestibular dysfunction, and retinitis pigmentosa leading to blindness (3).

Putative Mechanism

Mutant Myo7a mice exhibit disturbances in stereocilia structure leading to varying loss of hearing and/or vestibular phenotypes. Several of these are described in more detail, below. In Myo7a816SB (MGI:2155423) mice, stereocilia grow and form normal graded stereocilia bundles, but the bundles become progressively disorganized (31). The electrophysiological responses of the mice were normal, but some hair cell depolarization occurred in spite of the bundle disorganization (31). Myo7aewaso (Ile487Asn; MGI:5487402) mice had hearing loss by 4 weeks of age along with vestibular dysfunction (i.e., hyperactivity and circling) (63). The Myo7aewaso mice exhibited hair cell degeneration at the basal cochlear region by 8 weeks of age with collapse of the organ of Corti (63). As early as postnatal day 5 (P5), Myo7aewaso mice exhibited abnormal inner hair cell bundle morphology at the basal level (63).  By 2 weeks, inner hair cell bundles at the mid and basal levels of the cochlea were disorganized and some outer hair cell bundles were misoriented (63). The Myo7aewaso mice showed progressive inner and outer hair cell bundle degeneration so that by 8 weeks, outer hair bundles in the basal and mid levels of the cochlea are missing (63). Homozygous Myo7admbo2 (Phe947Ile; MGI:5487403) mice also had progressive hearing loss, but they did not exhibit vestibular dysfunction (63). The morphology of the sensory epithelium of the Myo7admbo2 mice was normal (63). The hair bundles in the Myo7admbo2 mice were affected in the apical level of the cochlea (63). As early as E18.5, the stereocilia bundle arrangement in Myo7aHdb (Ile178Phe; MGI:3511858) mice was abnormal: many inner ear hair stereocilia fused to form abnormally large stereocilia that subsequently degenerated (1). The organ of Corti of the Myo7aHdb mice had abnormal stereocilia bundle formation at the apex of the cochlea in that the stereocilia were all thin and of uniform length instead of in a staircase formation found in wild-type mice (1). As a result, the Myo7aHdb mice exhibited head bobbing and hyperactivity (1). Myo7aHdb mice  showed elevated anxiety compared to wild-type mice in an open-field and elevated plus-maze (64). Shaker-1 mice (Arg502Pro; Myo7ash1, MGI:1856716) had normal early development of stereocilia bundles, but progressive disorganization and degeneration of the stereocilia, resulting in abnormal cochlear responses (1;31). The shaker-1 mice were deaf and exhibited vestibular dysfunction (i.e., head tossing, hyperactivity, and circling) (57;65). Myo7apolka (MGI:3708382) mice have an ENU-induced mutation within intron 42 that results in a splicing defect, coding of 33 aberrant amino acids, and coding of a premature stop codon within the C-terminal FERM domain (5). The Myo7apolka mice exhibited vestibular dysfunction (i.e., a circling behavior and poor performance in forced swim tests) as well as a lack of an acoustic startle response (5;66).

 

The coward mice exhibit vestibular defects similar to those observed for other Myo7a mutant mice with mutations in the motor domain including Myo7a816SB, Myo7aewaso, Myo7aHdb, and Myo7ash1 indicating that stereocilia formation and/or stereocilia bundle arrangement in the inner ear of the coward mice is disturbed. Hearing and retinal function in the coward mice have not been examined.

Primers PCR Primer
coward(F):5'- AACAGGCACTCTACAATCTTCAGGC -3'
coward(R):5'- TACCCCTTGACTGACCTTGGTGAC -3'

Sequencing Primer
coward_seq(F):5'- caaggacaccgaggcac -3'
coward_seq(R):5'- GACTGACCTTGGTGACCTTCC -3'
Genotyping

Coward genotyping is performed by amplifying the region containing the mutation using PCR followed by sequencing of the amplified region to detect the nucleotide change.  The following primers were used for PCR amplification:

 

Primers for PCR amplification

Coward(F):  5’- AACAGGCACTCTACAATCTTCAGGC-3’

Coward(R):  5’- TACCCCTTGACTGACCTTGGTGAC-3’

 

Primers for sequencing

Coward_seq(F):  5’- CAAGGACACCGAGGCAC-3’

Coward_seq(R):  5’-GACTGACCTTGGTGACCTTCC-3’

 

PCR program

1) 94° C        2:00

2) 94° C        0:30

3) 57° C        0:30

4) 72° C        1:00

5) repeat steps (2-4) 29x

6) 72° C        7:00

7) 4° C            ¥

 

The following sequence of 541 nucleotides is amplified (Chr.7: 98085102-98085642, GRCm38; NC_000073):

 

aacaggcact ctacaatctt caggcatggt ctctggggag ttttcattct caaggacacc       

gaggcacagg gcagtgtctg acttaggtac aaccgcccag ctgggagata gcaaagccaa     

ggttaaggtg actgtggagc ccctatgccc tcagcaactt gacaagccct ttagtctcca      

gagagaacaa ggctttcttt ccactgccca cctacctcat ccattttgcc ccctcccttc      

ccaccctcca cccctgccca ccacatcccc tctgaggctc accatgggct tcttgaactc      

attgggtttg atacaacgca caaagaaggg ctggcaggcg cccagtgtgc gcatcagcag      

ctccagagac cgcttgaact ggctgctgag tgtaggcgag cgcttcctgg tctcggcacc      

ctgtggcaga ggacagacag acagtgatgg gaggggccac ctcttccccc tcccaccctc      

caacagctgt cctggaggga ggagagcacc agggaaggtc accaaggtca gtcaaggggt      

a

 

FASTA sequence

 

PCR primer binding sites are underlined and the sequencing primer binding sites are underlined and italicized; the mutated nucleotide is shown in red text (A>C, Chr. (+) strand; T>G, sense strand).

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJeff SoRelle, Zhe Chen, William McAlpine, Dylan Fortman
List |< first << previous [record 77 of 511] next >> last >|