Phenotypic Mutation 'Lostnf' (pdf version)
AlleleLostnf
Mutation Type missense
Chromosome11
Coordinate116,600,161 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Rhbdf2
Gene Name rhomboid 5 homolog 2
Synonym(s) iRhom2, Rhbdl6, 4732465I17Rik
Chromosomal Location 116,598,165-116,627,019 bp (-)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display impaired TNF secretion and increased sensitivity to bacterial infection induced mortality. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_172572, NM_001167680; MGI:2442473

Mapped Yes 
Amino Acid Change Leucine changed to Glutamine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000021160] [ENSMUSP00000099317] [ENSMUSP00000099318] [ENSMUSP00000115999] [ENSMUSP00000122895]
SMART Domains Protein: ENSMUSP00000099317
Gene: ENSMUSG00000020806
AA Change: L655Q

DomainStartEndE-ValueType
Pfam:Rhomboid_SP 98 306 1.8e-98 PFAM
transmembrane domain 376 398 N/A INTRINSIC
Pfam:Rhomboid 619 763 4.6e-31 PFAM
transmembrane domain 775 797 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000103028)
SMART Domains Protein: ENSMUSP00000099318
Gene: ENSMUSG00000020806
AA Change: L655Q

DomainStartEndE-ValueType
Pfam:Rhomboid_SP 98 304 4.7e-97 PFAM
transmembrane domain 376 398 N/A INTRINSIC
Pfam:Rhomboid 619 763 8.1e-31 PFAM
transmembrane domain 775 797 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000103029)
Meta Mutation Damage Score 0.274 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
TLR signaling defect: hyposensitivity to LPS 22246778 22550345
TLR signaling defect: hyposensitivity to PAM3CSK4 22246778 22550345
TLR signaling defect: hyposensitivity to R848 22246778 22550345
TLR signaling defect: TNF production by macrophages
Candidate Explorer Status CE: potential candidate; human score: 0.5; ML prob: 0.296
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(38) : Chemically induced (ENU)(1) Gene trapped(32) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rhbdf2 APN 11 116601751 missense possibly damaging 0.80
IGL01464:Rhbdf2 APN 11 116600908 missense probably benign 0.18
IGL02060:Rhbdf2 APN 11 116600626 missense probably damaging 1.00
IGL02211:Rhbdf2 APN 11 116600435 missense possibly damaging 0.49
Lostnf2 UTSW 11 116600191 missense possibly damaging 0.94
sinecure UTSW 11 116602260 missense probably damaging 0.99
trapezoid UTSW 11 116601148 missense probably damaging 0.96
R0131:Rhbdf2 UTSW 11 116605344 missense probably damaging 1.00
R0399:Rhbdf2 UTSW 11 116603992 missense probably benign 0.00
R0739:Rhbdf2 UTSW 11 116600161 missense probably damaging 1.00
R1756:Rhbdf2 UTSW 11 116607266 missense probably benign
R1839:Rhbdf2 UTSW 11 116600191 missense possibly damaging 0.94
R2029:Rhbdf2 UTSW 11 116601148 missense probably damaging 0.96
R3833:Rhbdf2 UTSW 11 116604424 missense probably damaging 1.00
R4330:Rhbdf2 UTSW 11 116601956 missense probably benign
R4331:Rhbdf2 UTSW 11 116602296 missense probably damaging 1.00
R4872:Rhbdf2 UTSW 11 116601945 missense probably benign 0.04
R5530:Rhbdf2 UTSW 11 116600662 missense probably damaging 1.00
R5625:Rhbdf2 UTSW 11 116605377 missense probably damaging 0.99
R5841:Rhbdf2 UTSW 11 116602354 unclassified probably benign
R6579:Rhbdf2 UTSW 11 116604463 missense probably benign 0.02
R7047:Rhbdf2 UTSW 11 116603651 critical splice donor site probably null
X0027:Rhbdf2 UTSW 11 116599093 missense probably benign
Mode of Inheritance Autosomal Semidominant
Local Stock
MMRRC Submission 037539-MU
Last Updated 2017-04-06 3:30 PM by Katherine Timer
Record Created 2014-08-26 10:38 PM by Zhao Zhang
Record Posted 2014-09-19
Phenotypic Description

Figure 1. Lostnf mice exhibited decreased TNFα secretion in response to the TLR4 ligand LPS. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Lostnf mice exhibited decreased TNFα secretion in response to the TLR1/2 ligand, Pam3CSK4. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Lostnf mice exhibited decreased TNFα secretion in response to the TLR7/8 ligand, R848. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Lostnf phenotype was identified among ENU-mutagenized G3 mice of the pedigree R0739, some of which exhibited decreased TNFα (see the record for PanR1) secretion in response to the Toll-like receptor (TLR) ligands LPS (TLR4; Figure 1), Pam3CSK4 (TLR1/2; Figure 2) and R848 (TLR7/8; Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of TNFα secretion in response to LPS using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 50 mutations (X-axis) identified in the G1 male of pedigree R0739.  Normalized phenotype data are shown for single locus linkage analysis without consideration for G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 50 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Rhbdf2: a T to A transversion at base pair 116,600,161 (v38) on chromosome 11, or base pair 26,859 in the GenBank genomic region NC_000077.  The strongest association was found with an additive model of linkage to the normalized TLR4 response, wherein 15 variant heterozygotes and one variant homozygote departed phenotypically from 16 homozygous reference mice with a P value of 1.242 x 10-7 (Figure 4). The mutation corresponds to residue 2,485 in the mRNA sequence NM_172572 within exon 18 of 19 total exons.

 

2469 ACCATCCTGAGGGACCTAGAGAAGCTGGCCGGC

650  -T--I--L--R--D--L--E--K--L--A--G-

 

The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to glutamine (Q) substitution at position 655 (L655Q) in the RHBDF2 protein, and is strongly predicted by Polyphen-2 to cause loss of function (probably damaging; score = 1.00).

Protein Prediction

Figure 5. Domains of RHBDF2. (A) RHBDF2 has predicted TMDs occurring at amino acids 382-402, 628-648, 664-684, 687-707, 719-739, 745-765, and 774-794; the 381 N-terminal amino acids are predicted to be cytoplasmic. RHBDF2 has predicted phosphorylation sites at serines 60, 83, 87, 293, 295, and 298 as well as an N-glycosylation site at amino acid 555. The Lostnf mutation causes a leucine to glutamine substitution at amino acid 655. Image is interactive; click to view other Rhbdf2 mutations. (B) The iRhoms have a 6 + 1 TMD membrane topology.  The N-terminus is cytoplasmic; the C-terminus is intracellular.  The Lostnf  mutation (L655Q) is indicated by a red asterisk. Image is interactive; click to view other Rhbdf2 mutations.

Rhbdf2 or iRhom2 encodes an 827 amino acid rhomboid-like protein (Figure 5A). RHBDF2 is considered to be an iRhom, a conserved group of proteolytically inactive rhomboid-like proteins with proline residues in their active site and characteristic luminal loop domains (1). The iRhoms have a 6 + 1 transmembrane domain (TMD) membrane topology (1); the Lostnf mutation occurs within the cytosolic loop between TMD 2 and 3 (alternatively, TMD 1 and 2 within the 6 TMD cluster) (Figure 5B).

 

For more information on RHBDF2, see the record for sinecure.

Putative Mechanism

Rhomboid proteases are involved in many different biological processes in diverse organisms [reviewed in (2)]. The role of RHBDF2 in innate immunity has been studied using Rhbdf2 knockout (Rhbdf2-/-) mouse models (3;4).  Ablation of Rhbdf2 had no effect on the induction of IL-1β, IL-6, and IL-12 by peritoneal macrophages upon LPS stimulation (3).  However, TNF-α secretion by LPS-stimulated macrophages was reduced; TNF-α mRNA and protein levels were upregulated normally and TNF-α was expressed appropriately at the plasma membrane of Rhbdf2-/- macrophages.  Adrain et al. proposed there was a defect in the shedding of the ectodomain of TNF-α, a process necessary for TNF-α activation (3). Further examination of the Rhbdf2-/-macrophages found that TNF-α converting enzyme (TACE; see the record for wavedX) was absent from the cell surface due to an inability of the protein to traffic from the ER to the trans-Golgi network. TACE activity is essential for the cleavage of TNF-α to yield the bioactive form in response to numerous stimuli including PMA and LPS (5-7).  Taken together, RHBDF2 is either involved in the folding and/or maturation of TACE in the ER, or it is a cargo receptor that assists in the trafficking of TACE (3;4). Loss of RHBDF2 function, as in the Lostnf and sinecure mice (8), would lead to an inability of TACE to exit the secretory pathway and a subsequent failure in cleavage and release of TNF from the cell surface. 

Primers PCR Primer
Lostnf(F):5'- TCCTGACAAGCCACAATGGTCCTC -3'
Lostnf(R):5'- AGAACTACTGACCCTGTGTCTCCC -3'

Sequencing Primer
Lostnf_seq(F):5'- ATGGTCCTCCCCATATGTTATAAAGC -3'
Lostnf_seq(R):5'- TAAGAGGCACCCTGTTGC -3'
Genotyping

Lostnf genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.
 

PCR Primers

Lostnf(F): 5’- TCCTGACAAGCCACAATGGTCCTC-3’

Lostnf(R): 5’- AGAACTACTGACCCTGTGTCTCCC-3’

 

Sequencing Primer

Lostnf_seq(F): 5’- ATGGTCCTCCCCATATGTTATAAAGC-3’
 

Lostnf_seq(R): 5’- TAAGAGGCACCCTGTTGC-3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 591 nucleotides is amplified (Chr.11: 116599916-116600528, GRCm38; NC_000077):

 

tccccacagg ccacaatagt cctcctgaca agccacaatg gtcctcccca caggctacaa       

tggtcctccc catatgttat aaagctttag atccaaaagg aagggctcat cccaccctct      

ctgcccttgt ctcccaagtt tgtacctctg cccggtaggg gaggaagatg gcgctggcca      

ggttgcctgt aatgccacta aggatgaaga tgatggagat gcggtgccag ccggccagct      

tctctaggtc cctcaggatg gtcatttgga agaccacaga cacaaggcag tgcactatgc      

tggggtaggc acatgagcac catcagcctt tcctgtgtgc ccatggtcac ccgcagagca      

caccacagcg cagtctagca ctagcaggtt gagccagtgt gctcggtctg gaagcccttt      

tctccggcac ccaagagggg agacatggga gtctgagcat ggggcaacag ggtgcctctt      

acccagcatg caggaataaa gacagccaga tccggtagaa ctggtcaggg acctcagggt      

tgaggaaagg caggagccca cacaccttgt ctaaacagtg cacctgggtg ggagacacag      

ggtcagtagt tct

 

FASTA sequence

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (A>T, Chr. (+) strand; T>A, sense strand).

References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsZhao Zhang, Ying Wang, Hexin Shi, Doan Dao, Bruce Beutler