Phenotypic Mutation 'Branch' (pdf version)
List |< first << previous [record 39 of 511] next >> last >|
AlleleBranch
Mutation Type missense
Chromosome18
Coordinate46,560,651 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Ticam2
Gene Name toll-like receptor adaptor molecule 2
Synonym(s) Tirp, TRAM
Chromosomal Location 46,559,155-46,574,533 bp (-)
MGI Phenotype Homozygous inactivation of this gene affects TLR4-mediated immune responses.
Accession Number

NCBI RefSeq: NM_173394; MGI:3040056

Mapped Yes 
Amino Acid Change Aspartic acid changed to Valine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000066239]
SMART Domains Protein: ENSMUSP00000066239
Gene: ENSMUSG00000056130
AA Change: D123V

DomainStartEndE-ValueType
Pfam:TIR_2 78 192 2e-10 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000070084)
Phenotypic Category TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: hyposensitivity to R848, TLR signaling defect: TNF production by macrophages
Penetrance  
Alleles Listed at MGI

All mutations/alleles(5) : Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Ticam2 APN 18 46560813 missense possibly damaging 0.68
Messi UTSW 18 46560922 nonsense probably null
R0056:Ticam2 UTSW 18 46560334 missense possibly damaging 0.61
R0056:Ticam2 UTSW 18 46560334 missense possibly damaging 0.61
R0666:Ticam2 UTSW 18 46560651 missense probably damaging 1.00
R1676:Ticam2 UTSW 18 46560610 missense probably damaging 1.00
R2209:Ticam2 UTSW 18 46560400 missense probably damaging 1.00
R4927:Ticam2 UTSW 18 46560779 missense probably damaging 1.00
R4928:Ticam2 UTSW 18 46560922 nonsense probably null
Mode of Inheritance Autosomal Semidominant
Local Stock
MMRRC Submission 037575-MU
Last Updated 03/21/2017 8:35 AM by Katherine Timer
Record Created 08/28/2014 2:09 AM by Zhao Zhang
Record Posted 10/27/2014
Phenotypic Description

Figure 1. Branch mice exhibited decreased TNFα secretion in response to the TLR4 ligand, LPS. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Branch phenotype was identified among ENU-mutagenized G3 mice of the pedigree R0666, some of which exhibited decreased TNFα secretion in response to the Toll-like receptor 4 (TLR4) ligand, LPS (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of reduced TNFα secretion in response to LPS using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 80 mutations (X-axis) identified in the G1 male of pedigree R0666.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 80 mutations. The decreased LPS-induced TNFα secretion phenotype was linked by continuous variable mapping to a mutation in Ticam2:  an A to T transversion at base pair 46,560,651 (v38) on chromosome 18, or base pair 13,978 in the GenBank genomic region NC_000084 encoding Ticam2.  Linkage was found with an additive model of inheritance (P = 3.06 x 10-4), wherein 9 heterozygous mice and one variant homozygous mouse departed phenotypically from 10 homozygous reference mice (Figure 2). The mutation corresponds to residue 844 in the mRNA sequence NM_173394 within exon 3 of 3 total exons.

 

828 CATTTGCAGAATCTAGACGATGCGGTCAATGGG
118 -H--L--Q--N--L--D--D--A--V--N--G-

 

The mutated nucleotide is indicated in red.  The mutation results in an aspartic acid (D) to valine (V) substitution at position 123 (D123V) in the TRAM protein, and is strongly predicted by Polyphen-2 to cause loss of function (probably damaging; score = 1.00).

Protein Prediction

Figure 3. Domain structure of TRAM.  The Toll/IL-1 receptor (TIR) domain is shown.  The Branch mutation is an aspartic acid to valine substitution at amino acid 123. 

Ticam2 [Toll-interleukin 1 receptor (TIR) domain-containing adaptor molecule-2; also TRAM (Trif-related adaptor molecule)] is a 232 amino acid protein adaptor in TLR4 signaling (Figure 3). TRAM is most closely related to the TLR adaptor TRIF (TIR domain-containing adaptor inducing IFN-β; see the record for Lps2) (1;2). Like the other adaptors for TLR signaling, TRAM contains a central Toll/IL-1 receptor (TIR) domain (amino acids 78-222), a conserved region of approximately 200 amino acids which mediates homo- and heterotypic protein interactions during signal transduction (1;3). TIR domains in TLRs, IL receptors and the adapter MyD88 (see the record for pococurante) contain 3 conserved boxes (boxes 1, 2 and 3), which are required for signaling (4). However, conserved sequences in boxes 1, 2 and 3 are lacking in TRAM (5). Specifically, the (F/Y)D in box 1, RD in box 2 and FW in box 3 are missing in TRAM (5). TIR domains contain six α-helices (αA, αB, αC, αC’, αD and αE) and five β-strands (βA, βB, βC, βD and βE) which are connected by seven loops. The crystal structures of the TLR1 (PDB:1FYV) and TLR2 (PDB:1FYW) TIR domains revealed that they fold into a structure with a central five-stranded parallel β-sheet surrounded by five helices (6). Many of the α-helices and connecting loops in the TIR domains of TLR1 and TLR2 are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions. This is true of a proline to histidine mutation in the BB loop of TLR4, which abolishes MyD88 binding (7) and LPS-induced signaling in mice (8). This proline is not conserved in TRAM, where instead a cysteine residue exists (3). A proline is found adjacent to this cysteine (3). TRAM differs from MyD88 in that it lacks a death domain, which in MyD88 recruits IL-1 receptor associated kinase (IRAK) family proteins (see the record for otiose) (9).

 

The Branch mutation (D123V) is within the TIR domain of TRAM.

 

 

Expression/Localization

Northern blot analysis detected Ticam2 transcript in most tissues examined, including spleen, prostate, testis, uterus, small intestine, colon, peripheral blood leukocytes, heart, placenta, lung, liver, skeletal muscle, pancreas, lymph node, thyroid and trachea (1;5). RT-PCR analysis revealed Ticam2 transcript in peripheral blood immature dendritic cells (DC), macrophages and natural killer (NK) cells (5). Three transcripts of different sizes were differentially expressed in each tissue (1). Ticam2 is localized in the cytoplasm (3).

Background

Figure 4. TRAM signaling pathways. TRAM signals specifically in the MyD88-independent TLR4 pathway. In response to vesicular stomatitis virus glycoprotein G (VSV-G), TLR4 can signal through TRAM to induce IRF7 activation, a process that is partially dependent on TICAM1 (TRIF). TLR4 signals through the MyD88-dependent pathway from the cell membrane and is subsequently internalized into late endosomes to signal through the TICAM-dependent pathway. Image is interactive; click to view mutations associated with this pathway.

TLRs are transmembrane receptors that sense molecules of microbial origin and trigger host cell responses. The twelve mouse TLRs and ten human TLRs recognize a wide range of structurally distinct molecules, and all signal through only four adaptor proteins known to date: MyD88, Tirap (Mal; see the record for torpid), TICAM-1 (TRIF) and TRAM (10). TLR signaling through these adaptors initiates a cascade of signaling events involving various kinases, adaptors and ubiquitin ligases, ultimately leading to transcriptional activation of cytokine [e.g., TNF-α, interleukin (IL)-1, IL-6] and other genes through the transcription factors NF-κB, AP-1, interferon responsive factor (IRF)-3, and IRF-7 (Figure 4). Two branches of signaling are known to exist, one defined by early NF-κB activation (MyD88-dependent pathway, mediated by MyD88), and another distinguished by late NF-κB activation as well as IRF-3 activation leading to type I IFN production and costimulatory molecule upregulation (MyD88-independent pathway, mediated by TRIF) (11-13). The TLRs may utilize one or both of these pathways to elicit a ligand-specific response. TLRs -3 and -4 (see the record for lps3) are known to activate both NF-κB (see the finlay) and IRF-3, and do so using the MyD88-independent pathway (for TLR3) or both pathways (for TLR4) (2;14).

 

TRAM was first identified by sequence homology search for TIR domain-containing adaptors (1). In this study, overexpression of TRAM (called TIRP) in HEK 293 cells was found to activate a reporter for NF-κB, but not for an IFN-β promoter (1). TRAM could also potentiate IL-1R- or IL-1RAcP-dependent NF-κB activation (1). No interaction was detected between TRAM and either TLR4 or TLR2, and the authors suggested that TRAM functions in IL-1R-mediated NF-κB activation pathways (1).

 

TRAM was also identified as a chromosome 18 TRIF homologue (by tBLASTn search using TRIF as a query) in a study of the Lps2 mutant strain, which harbors a frameshift mutation in Trif that replaces the 24 C-terminal residues with 11 unrelated amino acids. In this report, a population of homozygous Lps2 macrophages, expected to have little to no response to TLR4 ligands, was observed to produce low levels of TNF-α in response to LPS (2). This response was attributed to an unknown “adaptor X” and hypothesized to be the Trif homologue identified on mouse chromosome 18 (2).

 

Two subsequent reports also identified TRAM by sequence homology searches for TIR domain-containing proteins, and demonstrated that in fact, TRAM activates NF-κB, IRF-3 and IRF-7 downstream of TLR4 (3;5). Overexpression of TRAM in HEK 293 cells resulted in expression of the IFN-inducible genes IFN-β, RANTES and IP-10, and activation of an NF-κB reporter, suggesting that TRAM may function in the TLR4 and/or TLR3 pathways (Figure 4) (3;5). A dominant negative Ticam2 construct (Ticam2 C113H) or siRNA silencing of Ticam2 expression, inhibited TLR4-, but not TLR3-dependent, RANTES promoter activation and NF-κB activation in HEK 293 or U373-CD14 cells (3;5). These data supported the conclusion that TRAM is specifically required for LPS-induced TLR4 signaling.

Putative Mechanism

Generation of Ticam2-/- mice and analysis of TLR signaling in their cells confirmed that TRAM signals specifically in the MyD88-independent TLR4 pathway, filling the role of “adaptor X” [(2;15); see the record for Ticam2tm1Btlr]. IL-1β-induced NF-κB and JNK activation are normal in Ticam2-/- cells, indicating that TRAM is not required for IL-1R-mediated signaling (15). Ticam2-/- macrophages failed to produce TNF-α and IL-6 in response to LPS, but not crude peptidoglycan preparations (which activate the TLR2/6 complex), R-848 (TLR7 ligand), or unmethylated CpG oligodeoxynucleotides (CpG ODN, TLR9 ligand) (15). Upregulation of costimulatory molecules CD69, CD86 and major histocompatibility complex (MHC) class II molecules is also impaired in Ticam2-/- B220-positive splenocytes in response to LPS, but not α-IgM (15). While LPS-stimulated early NF-κB activation is normal in Ticam2-/- cells, late phase NF-κB activation appears diminished, as does JNK activation (15). In addition, expression of IFN-inducible genes is abrogated in response to LPS. In contrast, both NF-κB activation and IFN-inducible gene expression are completely normal in response to poly I:C (TLR3 ligand) in Ticam2-/- cells (15). Thus, Ticam2 specifically mediates the MyD88-independent pathway of TLR4 signaling.

 

In addition to LPS, the TLR4-Ticam signaling pathway is specifically activated by at least one other stimulus, the vesicular stomatitis virus (VSV) glycoprotein G (gpG), a surface protein on the virus envelope (16). TLR4 engagement by VSV gpG requires the coreceptor CD14, and signals predominantly through TRAM (16). Neither MyD88 nor Tirap are required for signaling, although there is a partial requirement for TRIF (16). Downstream from TRAM, VSV gpG leads to a type I IFN response via IRF-7, but does not activate NF-κB. The data suggest that TRAM may in some instances function alone, rather than in combination with TRIF (see below). Interestingly, this pathway functions in myeloid dendritic cells and macrophages rather than plasmacytoid dendritic cells (16).

 

A new study has recently implicated TRAM in TLR2/6 signaling (17). This report demonstrated that IL-6 production by Ticam2-/- mouse embryo fibroblasts is significantly reduced in response to MALP-2 and lipoteichoic acid (TLR2/6 ligands) (17). In addition, dominant negative TRAM inhibited lipoteichoic acid-induced IL-6 production by synovial fibroblasts and human umbilical endothelial cells (17). The reason for discrepancy with previous data on Ticam2-null cells is unknown, but may be due to testing of different cell types which express different species or levels of receptor cofactors (17).

 

TRAM has been shown to bind to TLR4 when coexpressed in cells (3;5) and evidence suggests that TRAM cooperates with TRIF, serving as a bridging molecule linking TLR4 to Trif (5). TRAM and TRIF interact in a yeast two-hybrid system, and studies using dominant negative proteins transfected with reporters into HEK 293 cells, demonstrate that dominant negative TRIF can block TRAM-mediated NF-κB and IFN-β promoter activation, but not vice versa (3;5). These results suggest that TRAM facilitates TRIF function such that TRIF cannot signal optimally without TRAM (3;5).

 

Initial evidence suggested that the MyD88-independent pathway mediates NF-κB activation by converging with the MyD88-dependent pathway at TRAF6 (TNF receptor-associated factor-6), a signaling protein distal to MyD88 and required for NF-κB activation. Both TRIF (18;19) and TRAM (1) bind to TRAF6 when coexpressed in heterologous cells. However, using TRAF6-/- cells, one study demonstrated that TRAF6 is not required for MyD88-independent signaling (late NF-κB activation and IFN-inducible gene expression), and the convergence of the MyD88-dependent and –independent pathways leading to NF-κB activation must lie downstream of TRAF6 (20).

 

The noncanonical IκB kinases (IKK), IKK-ε and TBK1 [Traf-family-member-associated NF-κB activator (TANK)-binding kinase 1; see the record for Pioneer], phosphorylate and activate IRF3 in response to viral infection or activation of TLR3 or TRIF signaling pathways (21-23). Notably, TRAM-dependent IFN-β promoter activation of a reporter could be inhibited by co-expression of dominant negative mutants of IKKε or TBK1, suggesting that these kinases may also function downstream of Ticam2 (3).

Primers PCR Primer
Branch(F):5'- GTTGCCTCTCAAATACAGACTCCCG -3'
Branch(R):5'- ACAGTGTGGATGCCGATCAAGAC -3'

Sequencing Primer
Branch_seq(F):5'- CTCCACTTGTGTGGAAAAGC -3'
Branch_seq(R):5'- GGCCATGAGTCAGACTCCAAG -3'
Genotyping

Branch genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.
 

PCR Primers

Branch(F): 5’- GTTGCCTCTCAAATACAGACTCCCG-3’

Branch(R): 5’- ACAGTGTGGATGCCGATCAAGAC-3’

 

Sequencing Primer

Branch_seq(F): 5’- CTCCACTTGTGTGGAAAAGC-3’
 

Branch_seq(R): 5’- GGCCATGAGTCAGACTCCAAG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 591 nucleotides is amplified (Chr.18: 46560373-46560963, GRCm38; NC_000084):

 

gttgcctctc aaatacagac tcccggaaaa ttctctccac ttgtgtggaa aagccttgac       

tttcttcctc taaggcattg atggtttgca gcgccaaggg agtccgttcc cggggaagag      

ggctgttcag gggccgcatg ggtatgacgg agttgtactt gtgctgcctg ctcacagaat      

tcatcaggga agtgtagaac tggaagttac accaggtgtc tcttaggaag ttctcagtca      

gtaacaagat ggtccaggcc gacccattga ccgcatcgtc tagattctgc aaatgcagtc      

ttccgcacgg catctcggcg aaaacgatcc ccggcctgat accaaagtcg ttttgcagta      

gatcctggac tctgagggcc tcgtcggtgt catcttctgc atgaagtatc acaaatttga      

ggaactcttc ttcatcttgc tcctcaggcc ccgccccctt tgcctcaggt tggtcctgct      

ctcctgttgg tggctctgat ccactgctct gctccacaaa accacgcaag caggcttcct      

cagaattctt ggagtctgac tcatggccgt cttgatcggc atccacactg t

 

FASTA sequence

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (T>A, Chr. (+) strand; A>T, sense strand).

References
Science Writers Eva Marie Y. Moresco, Anne Murray
Illustrators Peter Jurek, Katherine Timer
AuthorsZhao Zhang, Ying Wang, Hexin Shi, Bruce Beutler
List |< first << previous [record 39 of 511] next >> last >|