Phenotypic Mutation 'Lops' (pdf version)
AlleleLops
Mutation Type splice acceptor site (14 bp from exon)
Chromosome4
Coordinate66,833,880 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Tlr4
Gene Name toll-like receptor 4
Synonym(s) Rasl2-8, Lps, lipopolysaccharide response
Chromosomal Location 66,827,584-66,930,284 bp (+)
MGI Phenotype FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_021297.2; MGI:96824

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000045770] [ENSMUSP00000102988]
PDB Structure
Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005

DomainStartEndE-ValueType
LRR 76 99 7.36e0 SMART
LRR 100 123 1.86e0 SMART
LRR 173 196 8.24e0 SMART
LRR 370 401 4.33e1 SMART
LRR 468 492 2.54e2 SMART
LRR 493 516 1.86e2 SMART
LRR 517 540 1.67e2 SMART
LRR 541 563 1.92e2 SMART
LRRCT 576 626 4.74e-3 SMART
transmembrane domain 636 658 N/A INTRINSIC
TIR 671 816 7.3e-39 SMART
low complexity region 822 833 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005

DomainStartEndE-ValueType
PDB:3VQ2|B 22 86 2e-38 PDB
SCOP:d1m0za_ 27 86 4e-6 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B220 MFI - decreased
NLRP3 inflammasome: low response
TLR signaling defect: hyposensitivity to LPS 10549626
TLR signaling defect: TNF production by macrophages
Penetrance  
Alleles Listed at MGI

All mutations/alleles(13) : Chemically induced (ENU)(2) Spontaneous(6) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66840425 missense probably benign 0.01
IGL01343:Tlr4 APN 4 66833887 splice site probably benign
IGL01669:Tlr4 APN 4 66841267 missense possibly damaging 0.48
IGL01875:Tlr4 APN 4 66839489 missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66840965 missense probably damaging 0.99
IGL02244:Tlr4 APN 4 66834061 critical splice donor site probably null
IGL02793:Tlr4 APN 4 66839444 missense probably damaging 1.00
IGL03269:Tlr4 APN 4 66840796 missense probably damaging 1.00
IGL03288:Tlr4 APN 4 66839753 missense probably damaging 0.99
bugsy UTSW 4 66839254 nonsense probably null
cruyff UTSW 4 66840326 missense probably damaging 1.00
don_knotts UTSW 4 66841172 missense probably damaging 1.00
Guardiola UTSW 4 66839303 missense probably damaging 1.00
lps3 UTSW 4 66841097 missense probably damaging 1.00
Lps4 UTSW 4 66841142 missense probably damaging 1.00
milquetoast UTSW 4 66839444 missense probably damaging 1.00
R0449:Tlr4 UTSW 4 66839620 missense probably damaging 0.99
R0481:Tlr4 UTSW 4 66827916 missense probably benign 0.05
R0576:Tlr4 UTSW 4 66839495 missense probably benign 0.00
R0827:Tlr4 UTSW 4 66833880 splice site probably null
R1488:Tlr4 UTSW 4 66839549 missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66839374 missense possibly damaging 0.56
R1522:Tlr4 UTSW 4 66839696 missense possibly damaging 0.80
R1616:Tlr4 UTSW 4 66839480 missense probably damaging 1.00
R1681:Tlr4 UTSW 4 66841105 missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66841076 missense probably benign 0.19
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1929:Tlr4 UTSW 4 66839444 missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66841035 missense probably benign 0.40
R1998:Tlr4 UTSW 4 66840470 missense probably damaging 1.00
R2186:Tlr4 UTSW 4 66839983 missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66840101 missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66839254 nonsense probably null
R3420:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3422:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3818:Tlr4 UTSW 4 66841316 missense probably benign 0.00
R4212:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4417:Tlr4 UTSW 4 66839303 missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66839240 missense probably benign 0.44
R4735:Tlr4 UTSW 4 66841198 missense probably damaging 1.00
R5191:Tlr4 UTSW 4 66841379 missense probably damaging 0.96
R5613:Tlr4 UTSW 4 66840885 missense possibly damaging 0.94
R5705:Tlr4 UTSW 4 66833980 missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66840415 missense probably benign
R6021:Tlr4 UTSW 4 66840866 missense probably damaging 1.00
R6159:Tlr4 UTSW 4 66839833 missense possibly damaging 0.92
R6227:Tlr4 UTSW 4 66840595 missense probably benign
X0064:Tlr4 UTSW 4 66840140 missense probably damaging 0.99
Z1088:Tlr4 UTSW 4 66929082 missense probably benign 0.01
Mode of Inheritance Autosomal Semidominant
Local Stock
MMRRC Submission 038156-MU
Last Updated 2016-12-09 10:25 AM by Katherine Timer
Record Created 2014-08-31 6:27 PM by Zhao Zhang
Record Posted 2015-01-23
Phenotypic Description

Figure 1. Lops mice exhibited decreased TNFα secretion in response to TLR4 ligand, LPS. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Lops mice exhibited decreased IL-1β secretion in response to LPS and aluminum adjuvants. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Lops phenotype was identified among G3 mice of the pedigree R0827, some of which exhibited decreased TNFα secretion in response to Toll-like receptor 4 (TLR4) ligand LPS (Figure 1) and impaired peritoneal macrophage inflammatory responses (i.e., decreased secretion of the proinflammatory cytokine interleukin (IL)-1β) following exposure to lipopolysaccharide (LPS) and aluminum adjuvants (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the reduced TNFα secretion in response to LPS using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 86 mutations (X-axis) identified in the G1 male of pedigree R0827.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively

Whole exome HiSeq sequencing of the G1 grandsire identified 86 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Tlr4:  a T to A transversion at base pair 66,833,880 (v38) on chromosome 4, or base pair 6,070 in the GenBank genomic region NC_000070 encoding Tlr4. The strongest association was found with an additive model of linkage to the normalized amount of TNFα secretion in response to LPS, wherein 11 heterozygotes and 2 homozygous variant mice departed phenotypically from 6 homozygous reference mice [P = 1.355 x 10-5Figure 3]. The mutation lies in the splice acceptor site of intron 1 of the 3 exon gene, and affects a thymine base 14 nucleotides from the next exon. One possibility, shown below, is that aberrant splicing may result in skipping of the 167 base pair exon 2, utilization of the acceptor splice site from intron 2, and splicing of exon 1 to exon 3. Deletion of exon 2 would result in a frame-shift and coding of one aberrant amino acid followed by a premature stop codon (the second abnormal codon after exon 1).

 

   exon 1-->            intron 1-->                 exon 2 -->    exon 3 -->

22 ATGATGCCT……TGCATAGAG gtatgtgt……ttgtgtggtatttacag GTAGTTCCTAAT……GTGTGA
-M--M--P-……-C--I--E-                             -V--V--P--N-……-V--*
         correct                                      deleted     aberrant

 

Genomic numbering corresponds to NC_000070.  The acceptor splice site of intron 1, which is destroyed by the mutation, is indicated in blue and the mutated nucleotide is indicated in red.

 

Figure 4. Real-time RT-PCR analysis of Tlr4 in Lops blood. Tlr4 genomic DNA and mRNA (exon 1 and 2) as well as the primer binding sites used in the RT-PCR are shown. The relative level of Tlr4 in heterozygous and homozygous Lops mice using the primer sets indicated are shown.

Real-time PCR using three pairs of primers spanning exons 1 and 2 was performed to examine the expression of Tlr4 in Lops mice. Tlr4 cDNA levels in homozygous Lops mice were reduced compared to wild-type and heterozygous mice (Figure 4), suggesting that the Lops mutation negatively affects the function of the intron 1 acceptor splice site.  It remains possible that a cryptic donor splice site in the 5’ UTR is used for splicing to the intron 1 donor splice site, but the resulting transcript is degraded by the nonsense mediated decay pathway. Reduced expression of TLR4 may account for the observed phenotype.

Protein Prediction

Figure 5. Protein and domain structure of TLR4. A) Schematic representation of TLR9 based on crystalized structures of mouse TLR3 LRR (PBD: 3CIG) and human TLR2 TIR (PDB:1FYW) domains. 3D image was created using UCSF Chimera. B) TLR4 is an 835 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane domain and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain. The Lops mutation is within the splice acceptor site of intron 1. This image is interactive. Click on the image to view other mutations found in TLR4 (red). Click on the mutations for more specific information.

TLR4 has 22 predicted LRRs in its ectodomain at the N-terminal half of the protein (1-3), a transmembrane domain, and a cytoplasmic Toll/IL-1R (TIR) domain (Figure 5). The Lops mutation likely results in abnormal splicing of Tlr4 and may cause an internal deletion of amino acids 31-86 in the extracellular domain of TLR4 (affecting LRR1 and LRR2), coding of one aberrant amino acid followed by a premature stop codon at position 32 of the 835 amino acid protein.

 

Please see the record for lps3 for information about Tlr4.

Putative Mechanism

TLR4 is the receptor for LPS (4). Stimulation of TLR4 by LPS activates two branches of signaling, one defined by early NF-κB activation (MyD88-dependent pathway, mediated by MyD88), and another distinguished by late NF-κB activation as well as interferon responsive factor (IRF)-3 activation leading to type I IFN production and costimulatory molecule upregulation (MyD88-independent pathway, mediated by Trif) (5-7). The MyD88-dependent pathway activates expression of target genes including interleukin (IL)-6, IL-1, TNF, IL-12p40 and type I interferon (IFN), cytokines required for the inflammatory response. The MyD88-independent pathway results in the production of type I IFN. The reduction in TLR4-associated responses in Lops indicates that the mutation results in loss of TLR4 function.

Primers PCR Primer
Lops(F):5'- GAATGGCAGGTATTTTGGGAGTCCAAT -3'
Lops(R):5'- TTCTTATCTAGTGGCCCATCCAACTGA -3'

Sequencing Primer
Lops_seq(F):5'- GTATAGCTAATTTAAGGCCAGACTG -3'
Lops_seq(R):5'- CAGCAAGTTGTAGCACTACTG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsZhao Zhang, Ying Wang, Hexin Shi, Bruce Beutler