Phenotypic Mutation 'Lops'

• Allele: Lops
• Mutation Type: splice site (14 bp from exon)
• Chromosome: 4
• Coordinate: 66,752,117 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Tlr4
• Gene Name: toll-like receptor 4
• Synonym(s): Lps, lipopolysaccharide response, Rasl2-8
• Chromosomal Location: 66,745,788-66,765,338 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015] ; PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000045770 ^†] [ENSMUSP00000102988 ^†] † probably from a misspliced transcript
• AlphaFold: Q9QUK6
• PDB Structure: Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION] ; Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION] ; Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000045770; Gene: ENSMUSG00000039005

Domain	Start	End	E-Value	Type
LRR	76	99	7.36e0	SMART
LRR	100	123	1.86e0	SMART
LRR	173	196	8.24e0	SMART
LRR	370	401	4.33e1	SMART
LRR	468	492	2.54e2	SMART
LRR	493	516	1.86e2	SMART
LRR	517	540	1.67e2	SMART
LRR	541	563	1.92e2	SMART
LRRCT	576	626	4.74e-3	SMART
transmembrane domain	636	658	N/A	INTRINSIC
TIR	671	816	7.3e-39	SMART
low complexity region	822	833	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000102988; Gene: ENSMUSG00000039005

Domain	Start	End	E-Value	Type
PDB:3VQ2|B	22	86	2e-38	PDB
SCOP:d1m0za_	27	86	4e-6	SMART

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• MMRRC Submission: 038156-MU
• Last Updated: 2019-09-04 9:48 PM by Katherine Timer
• Record Created: 2014-08-31 6:27 PM by Zhao Zhang
• Record Posted: 2015-01-23
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Zhao Zhang, Ying Wang, Hexin Shi, Bruce Beutler

Accession Number

NCBI RefSeq: NM_021297.2; MGI:96824

Alleles Listed at MGI

All mutations/alleles(13) : Chemically induced (ENU)(2) Spontaneous(6) Targeted(5)

Phenotypic Description

Figure 1. Lops mice exhibited decreased TNFα secretion in response to TLR4 ligand, LPS. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Lops mice exhibited decreased IL-1β secretion in response to LPS and aluminum adjuvants. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Lops phenotype was identified among G3 mice of the pedigree R0827, some of which exhibited decreased TNFα secretion in response to Toll-like receptor 4 (TLR4) ligand LPS (Figure 1) and impaired peritoneal macrophage inflammatory responses (i.e., decreased secretion of the proinflammatory cytokine interleukin (IL)-1β) following exposure to lipopolysaccharide (LPS) and aluminum adjuvants (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the reduced TNFα secretion in response to LPS using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 86 mutations (X-axis) identified in the G1 male of pedigree R0827. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction , respectively

Whole exome HiSeq sequencing of the G1 grandsire identified 86 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Tlr4:  a T to A transversion at base pair 66,833,880 (v38) on chromosome 4, or base pair 6,070 in the GenBank genomic region NC_000070 encoding Tlr4. The strongest association was found with an additive model of linkage to the normalized amount of TNFα secretion in response to LPS, wherein 11 heterozygotes and 2 homozygous variant mice departed phenotypically from 6 homozygous reference mice [P = 1.355 x 10^-5; Figure 3]. The mutation lies in the splice acceptor site of intron 1 of the 3 exon gene, and affects a thymine base 14 nucleotides from the next exon. One possibility, shown below, is that aberrant splicing may result in skipping of the 167 base pair exon 2, utilization of the acceptor splice site from intron 2, and splicing of exon 1 to exon 3. Deletion of exon 2 would result in a frame-shift and coding of one aberrant amino acid followed by a premature stop codon (the second abnormal codon after exon 1).

exon 1-->            intron 1-->                 exon 2 -->    exon 3 --> 22 ATGATGCCT……TGCATAGAG gtatgtgt……ttgtgtggtatttacag GTAGTTCCTAAT……GTGTGA 1  -M--M--P-……-C--I--E-                             -V--V--P--N-……-V--*          correct                                      deleted     aberrant

Genomic numbering corresponds to NC_000070.  The acceptor splice site of intron 1, which is destroyed by the mutation, is indicated in blue and the mutated nucleotide is indicated in red.

Figure 4. Real-time RT-PCR analysis of Tlr4 in Lops blood. Tlr4 genomic DNA and mRNA (exon 1 and 2) as well as the primer binding sites used in the RT-PCR are shown. The relative level of Tlr4 in heterozygous and homozygous Lops mice using the primer sets indicated are shown.

Real-time PCR using three pairs of primers spanning exons 1 and 2 was performed to examine the expression of Tlr4 in Lops mice. Tlr4 cDNA levels in homozygous Lops mice were reduced compared to wild-type and heterozygous mice (Figure 4), suggesting that the Lops mutation negatively affects the function of the intron 1 acceptor splice site.  It remains possible that a cryptic donor splice site in the 5’ UTR is used for splicing to the intron 1 donor splice site, but the resulting transcript is degraded by the nonsense mediated decay pathway. Reduced expression of TLR4 may account for the observed phenotype.

Protein Prediction

Figure 5. Protein and domain structure of TLR4. A) Schematic representation of TLR9 based on crystalized structures of mouse TLR3 LRR (PBD: 3CIG) and human TLR2 TIR (PDB:1FYW) domains. 3D image was created using UCSF Chimera. B) TLR4 is an 835 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane domain and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain. The Lops mutation is within the splice acceptor site of intron 1. This image is interactive. Click on the image to view other mutations found in TLR4 (red). Click on the mutations for more specific information.

TLR4 has 22 predicted LRRs in its ectodomain at the N-terminal half of the protein (1-3), a transmembrane domain, and a cytoplasmic Toll/IL-1R (TIR) domain (Figure 5). The Lops mutation likely results in abnormal splicing of Tlr4 and may cause an internal deletion of amino acids 31-86 in the extracellular domain of TLR4 (affecting LRR1 and LRR2), coding of one aberrant amino acid followed by a premature stop codon at position 32 of the 835 amino acid protein.

Please see the record for lps3 for information about Tlr4.

Putative Mechanism

TLR4 is the receptor for LPS (4). Stimulation of TLR4 by LPS activates two branches of signaling, one defined by early NF-κB activation (MyD88-dependent pathway, mediated by MyD88), and another distinguished by late NF-κB activation as well as interferon responsive factor (IRF)-3 activation leading to type I IFN production and costimulatory molecule upregulation (MyD88-independent pathway, mediated by Trif) (5-7). The MyD88-dependent pathway activates expression of target genes including interleukin (IL)-6, IL-1, TNF, IL-12p40 and type I interferon (IFN), cytokines required for the inflammatory response. The MyD88-independent pathway results in the production of type I IFN. The reduction in TLR4-associated responses in Lops indicates that the mutation results in loss of TLR4 function.

Primers

PCR Primer
Lops_pcr_F: GAATGGCAGGTATTTTGGGAGTCCAAT
Lops_pcr_R: TTCTTATCTAGTGGCCCATCCAACTGA

Sequencing Primer
Lops_seq_F: GTATAGCTAATTTAAGGCCAGACTG
Lops_seq_R: CAGCAAGTTGTAGCACTACTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 604 nucleotides is amplified (chromosome 4, + strand):

1   gaatggcagg tattttggga gtccaatgtt atctttgact gtatagctaa tttaaggcca
61  gactggtcta taggaaagct tgtttcaacc aaaataaatc atgaacgaat gaatgaatag
121 gtggacaata tgttgagtgg catgtacatg tgagagtttt atcaccccat tattcatctt
181 tggagaggag tgggaacaca cggttggaaa cataacaatt gttgtgtggt atttacaggt
241 agttcctaat attacctacc aatgcatgga tcagaaactc agcaaagtcc ctgatgacat
301 tccttcttca accaagaaca tagatctgag cttcaacccc ttgaagatct taaaaagcta
361 tagcttctcc aatttttcag aacttcagtg gctggattta tccaggtaat gaatgagctt
421 ttatgtgatg cagaatgtga agtagttatt ttttatatca ttgcattctt ggcttagaaa
481 accaaggtgg ttctaactaa acttccttct gtcatctatt cagtagtgct acaacttgct
541 gtaaatcctt ggaaaagcta cttttattta actggtttca gttggatggg ccactagata
601 agaa

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Rock, F. L., Hardiman, G., Timans, J. C., Kastelein, R. A., and Bazan, J. F. (1998) A Family of Human Receptors Structurally Related to Drosophila Toll. Proc Natl Acad Sci U S A. 95, 588-593.

  2. Medzhitov, R., Preston-Hurlburt, P., and Janeway, C. A.,Jr. (1997) A Human Homologue of the Drosophila Toll Protein Signals Activation of Adaptive Immunity. Nature. 388, 394-397.

  3. Bell, J. K., Mullen, G. E., Leifer, C. A., Mazzoni, A., Davies, D. R., and Segal, D. M. (2003) Leucine-Rich Repeats and Pathogen Recognition in Toll-Like Receptors. Trends Immunol. 24, 528-533.

  4. Poltorak, A., He, X., Smirnova, I., Liu, M. -., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M. A., Ricciardi-Castagnoli, P., Layton, B., and Beutler, B. (1998) Defective LPS Signaling in C3H/HeJ and C57BL/10ScCr Mice: Mutations in Tlr4 gene. Science. 282, 2085-2088.

  5. Kawai, T., Adachi, O., Ogawa, T., Takeda, K., and Akira, S. (1999) Unresponsiveness of MyD88-Deficient Mice to Endotoxin. Immunity. 11, 115-122.

  6. Hoshino, K., Kaisho, T., Iwabe, T., Takeuchi, O., and Akira, S. (2002) Differential Involvement of IFN-Beta in Toll-Like Receptor-Stimulated Dendritic Cell Activation. Int Immunol. 14, 1225-1231.

  7. Kawai, T., Takeuchi, O., Fujita, T., Inoue, J., Muhlradt, P. F., Sato, S., Hoshino, K., and Akira, S. (2001) Lipopolysaccharide Stimulates the MyD88-Independent Pathway and Results in Activation of IFN-Regulatory Factor 3 and the Expression of a Subset of Lipopolysaccharide-Inducible Genes. J Immunol. 167, 5887-5894.