Phenotypic Mutation '50-cal' (pdf version)
Mutation Type critical splice donor site (2 bp from exon)
Coordinate13,708,212 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Lyst
Gene Name lysosomal trafficking regulator
Synonym(s) D13Sfk13
Chromosomal Location 13,590,397-13,778,803 bp (+)
MGI Phenotype Strain: 1855968
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010748; MGI: 107448

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000106188]
SMART Domains Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726

low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Pfam:PH_BEACH 3006 3101 5.8e-25 PFAM
Beach 3118 3408 1.25e-193 SMART
Blast:Beach 3441 3478 9e-13 BLAST
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD8a+ DCs (gated in CD11c+ cells) - increased
FACS pDCs - increased
LPS-induced Necroptosis - decreased
Macrophage necroptosis: low
MCMV susceptibility
pigmentation 1651867
skin/coat/nails 1651867
Alleles Listed at MGI

All mutations/alleles(53) : Chemically induced (ENU)(6) Gene trapped(34) Radiation induced(1) Spontaneous(8) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13648878 missense probably benign
IGL00474:Lyst APN 13 13643536 missense possibly damaging 0.48
IGL00484:Lyst APN 13 13709603 missense probably benign 0.02
IGL00492:Lyst APN 13 13678175 missense possibly damaging 0.54
IGL00807:Lyst APN 13 13650423 missense possibly damaging 0.91
IGL00949:Lyst APN 13 13635485 missense possibly damaging 0.87
IGL00952:Lyst APN 13 13678107 missense probably benign 0.05
IGL01305:Lyst APN 13 13678056 missense probably benign 0.01
IGL01317:Lyst APN 13 13670870 missense probably benign
IGL01419:Lyst APN 13 13635838 missense probably benign 0.00
IGL01445:Lyst APN 13 13651714 missense probably benign 0.00
IGL01690:Lyst APN 13 13743246 missense probably damaging 1.00
IGL01791:Lyst APN 13 13635302 missense probably damaging 1.00
IGL01809:Lyst APN 13 13637803 missense probably damaging 1.00
IGL01896:Lyst APN 13 13635577 missense probably benign 0.04
IGL01938:Lyst APN 13 13637424 missense possibly damaging 0.93
IGL01986:Lyst APN 13 13775627 critical splice donor site probably null
IGL02022:Lyst APN 13 13664044 nonsense probably null
IGL02044:Lyst APN 13 13712846 missense probably damaging 1.00
IGL02157:Lyst APN 13 13660956 missense probably benign
IGL02185:Lyst APN 13 13661093 nonsense probably null
IGL02215:Lyst APN 13 13660956 missense probably benign
IGL02245:Lyst APN 13 13660956 missense probably benign
IGL02246:Lyst APN 13 13660956 missense probably benign
IGL02247:Lyst APN 13 13660956 missense probably benign
IGL02297:Lyst APN 13 13638092 nonsense probably null
IGL02411:Lyst APN 13 13660956 missense probably benign
IGL02415:Lyst APN 13 13660956 missense probably benign
IGL02419:Lyst APN 13 13660956 missense probably benign
IGL02420:Lyst APN 13 13660956 missense probably benign
IGL02429:Lyst APN 13 13660956 missense probably benign
IGL02501:Lyst APN 13 13711645 missense probably benign 0.02
IGL02522:Lyst APN 13 13634705 missense possibly damaging 0.81
IGL02535:Lyst APN 13 13650342 missense probably benign 0.00
IGL02596:Lyst APN 13 13660956 missense probably benign
IGL02601:Lyst APN 13 13660956 missense probably benign
IGL02603:Lyst APN 13 13660956 missense probably benign
IGL02608:Lyst APN 13 13712754 missense probably damaging 0.98
IGL02622:Lyst APN 13 13681390 missense probably damaging 1.00
IGL02690:Lyst APN 13 13641125 missense possibly damaging 0.58
IGL02715:Lyst APN 13 13674320 splice site probably null
IGL02725:Lyst APN 13 13760827 missense probably damaging 1.00
IGL02729:Lyst APN 13 13674339 missense possibly damaging 0.81
IGL02729:Lyst APN 13 13746609 missense possibly damaging 0.95
IGL02820:Lyst APN 13 13638058 missense probably benign 0.03
IGL02945:Lyst APN 13 13761198 missense possibly damaging 0.48
IGL02981:Lyst APN 13 13634911 missense probably damaging 0.99
IGL03087:Lyst APN 13 13635056 missense probably damaging 1.00
IGL03149:Lyst APN 13 13681444 missense probably benign 0.14
IGL03158:Lyst APN 13 13651752 critical splice donor site probably null
IGL03226:Lyst APN 13 13709559 missense probably benign 0.01
IGL03242:Lyst APN 13 13656881 nonsense probably null
IGL03385:Lyst APN 13 13656980 nonsense probably null
charcoal UTSW 13 13696761 nonsense probably null
charlotte_gray UTSW 13 13602026 intron probably benign
charzard UTSW 13 13647083 nonsense probably null
grey_wolf UTSW 13 unclassified
lightspeed UTSW 13 13740536 missense possibly damaging 0.91
robin UTSW 13 13648802 nonsense probably null
sooty UTSW 13 unclassified
souris UTSW 13 13683224 unclassified probably benign
Swallow UTSW 13 13757422 missense probably benign 0.00
vulpix UTSW 13 13696794 splice site probably null
ANU22:Lyst UTSW 13 13678056 missense probably benign 0.01
IGL02835:Lyst UTSW 13 13661100 missense possibly damaging 0.82
P0031:Lyst UTSW 13 13664031 missense probably damaging 1.00
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0031:Lyst UTSW 13 13708156 missense probably benign 0.14
R0115:Lyst UTSW 13 13677952 missense probably benign 0.00
R0212:Lyst UTSW 13 13635985 missense possibly damaging 0.93
R0386:Lyst UTSW 13 13708214 splice site probably benign
R0393:Lyst UTSW 13 13647079 missense probably benign 0.01
R0415:Lyst UTSW 13 13711610 splice site probably benign
R0446:Lyst UTSW 13 13638048 missense probably benign 0.00
R0481:Lyst UTSW 13 13677952 missense probably benign 0.00
R0499:Lyst UTSW 13 13616713 missense probably damaging 1.00
R0506:Lyst UTSW 13 13638015 missense probably benign
R0530:Lyst UTSW 13 13757306 splice site probably benign
R0541:Lyst UTSW 13 13681293 missense probably benign 0.00
R0570:Lyst UTSW 13 13709386 missense probably benign 0.26
R0680:Lyst UTSW 13 13650341 missense probably benign 0.01
R0842:Lyst UTSW 13 13678241 nonsense probably null
R0848:Lyst UTSW 13 13634930 missense probably benign 0.00
R1014:Lyst UTSW 13 13634060 missense possibly damaging 0.49
R1205:Lyst UTSW 13 13680202 missense probably benign
R1251:Lyst UTSW 13 13634483 missense probably benign 0.00
R1304:Lyst UTSW 13 13751984 nonsense probably null
R1398:Lyst UTSW 13 13740536 missense possibly damaging 0.91
R1445:Lyst UTSW 13 13640054 missense possibly damaging 0.94
R1475:Lyst UTSW 13 13708212 critical splice donor site probably null
R1479:Lyst UTSW 13 13634482 missense probably benign 0.00
R1484:Lyst UTSW 13 13678190 missense probably benign 0.01
R1498:Lyst UTSW 13 13650375 missense possibly damaging 0.49
R1540:Lyst UTSW 13 13635101 missense possibly damaging 0.81
R1611:Lyst UTSW 13 13634897 missense probably damaging 0.97
R1653:Lyst UTSW 13 13635226 missense probably damaging 1.00
R1669:Lyst UTSW 13 13644087 missense possibly damaging 0.90
R1686:Lyst UTSW 13 13634705 missense possibly damaging 0.81
R1694:Lyst UTSW 13 13661161 missense probably damaging 0.98
R1747:Lyst UTSW 13 13757422 missense probably benign 0.00
R1793:Lyst UTSW 13 13647083 nonsense probably null
R1871:Lyst UTSW 13 13651712 missense probably benign 0.00
R1905:Lyst UTSW 13 13634134 missense probably benign
R1958:Lyst UTSW 13 13616618 missense probably damaging 1.00
R1969:Lyst UTSW 13 13730344 missense probably damaging 0.99
R2040:Lyst UTSW 13 13641222 missense probably benign 0.00
R2109:Lyst UTSW 13 13712820 missense possibly damaging 0.46
R2116:Lyst UTSW 13 13635701 missense probably damaging 0.99
R2121:Lyst UTSW 13 13660971 missense probably damaging 1.00
R2127:Lyst UTSW 13 13635262 missense probably damaging 1.00
R2187:Lyst UTSW 13 13709341 missense possibly damaging 0.61
R2238:Lyst UTSW 13 13743263 missense probably benign 0.41
R2258:Lyst UTSW 13 13637658 missense probably benign 0.00
R2292:Lyst UTSW 13 13740495 missense probably damaging 1.00
R2368:Lyst UTSW 13 13696663 missense probably damaging 0.96
R2908:Lyst UTSW 13 13669873 missense probably benign 0.03
R3001:Lyst UTSW 13 13696705 missense probably benign
R3002:Lyst UTSW 13 13696705 missense probably benign
R3024:Lyst UTSW 13 13658687 missense probably benign
R3113:Lyst UTSW 13 13669927 missense probably benign 0.12
R3406:Lyst UTSW 13 13635230 missense possibly damaging 0.56
R3972:Lyst UTSW 13 13706625 missense possibly damaging 0.67
R3978:Lyst UTSW 13 13634168 missense possibly damaging 0.82
R4032:Lyst UTSW 13 13616665 missense probably damaging 1.00
R4192:Lyst UTSW 13 13740513 missense probably damaging 1.00
R4206:Lyst UTSW 13 13635989 missense probably benign 0.03
R4298:Lyst UTSW 13 13634887 missense probably damaging 1.00
R4344:Lyst UTSW 13 13698466 missense probably benign 0.06
R4441:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4445:Lyst UTSW 13 13709564 missense probably benign 0.42
R4477:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4493:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4494:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4495:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4622:Lyst UTSW 13 13674398 missense probably benign 0.01
R4638:Lyst UTSW 13 13696794 splice site probably null
R4658:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4675:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4719:Lyst UTSW 13 13650350 missense probably benign
R4729:Lyst UTSW 13 13637901 missense probably damaging 1.00
R4774:Lyst UTSW 13 13740597 missense probably damaging 1.00
R4811:Lyst UTSW 13 13777100 missense probably benign 0.33
R4877:Lyst UTSW 13 13683149 missense probably damaging 1.00
R4920:Lyst UTSW 13 13647060 missense possibly damaging 0.79
R4933:Lyst UTSW 13 13637764 missense probably damaging 0.98
R4933:Lyst UTSW 13 13759378 missense probably benign 0.12
R4958:Lyst UTSW 13 13635463 missense probably benign 0.00
R4982:Lyst UTSW 13 13725954 missense probably damaging 1.00
R4992:Lyst UTSW 13 13661163 missense probably damaging 1.00
R5024:Lyst UTSW 13 13634404 missense probably benign
R5049:Lyst UTSW 13 13636064 missense probably damaging 1.00
R5079:Lyst UTSW 13 13757353 missense probably benign 0.08
R5254:Lyst UTSW 13 13683070 missense probably benign 0.00
R5266:Lyst UTSW 13 13660970 missense probably damaging 1.00
R5279:Lyst UTSW 13 13648802 nonsense probably null
R5285:Lyst UTSW 13 13634426 missense probably benign 0.01
R5364:Lyst UTSW 13 13656854 missense probably benign 0.35
R5435:Lyst UTSW 13 13777064 missense possibly damaging 0.64
R5516:Lyst UTSW 13 13644122 missense probably benign 0.10
R5524:Lyst UTSW 13 13746779 missense probably benign 0.03
R5591:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5592:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5593:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13759397 missense probably benign 0.00
R5644:Lyst UTSW 13 13637496 missense possibly damaging 0.58
R5659:Lyst UTSW 13 13634627 missense possibly damaging 0.58
R5741:Lyst UTSW 13 13634030 missense probably benign 0.44
R5908:Lyst UTSW 13 13696761 nonsense probably null
R5969:Lyst UTSW 13 13687813 splice site probably null
R6128:Lyst UTSW 13 13759379 missense possibly damaging 0.67
R6271:Lyst UTSW 13 13658754 missense probably benign 0.30
R6315:Lyst UTSW 13 13643504 missense probably benign
R6318:Lyst UTSW 13 13743311 missense possibly damaging 0.88
R6555:Lyst UTSW 13 13648925 missense probably benign 0.01
R6663:Lyst UTSW 13 13664116 splice site probably null
R6701:Lyst UTSW 13 13681485 missense probably benign 0.06
R6711:Lyst UTSW 13 13635235 missense possibly damaging 0.80
R6909:Lyst UTSW 13 13743375 missense probably damaging 1.00
R6915:Lyst UTSW 13 13726044 missense probably benign 0.01
R6929:Lyst UTSW 13 13743324 missense probably damaging 1.00
R6960:Lyst UTSW 13 13634078 missense probably benign 0.12
X0024:Lyst UTSW 13 13634448 missense probably benign 0.00
X0026:Lyst UTSW 13 13751970 missense probably damaging 0.99
Z1088:Lyst UTSW 13 13743433 missense probably benign 0.09
Mode of Inheritance Autosomal Recessive
Local Stock


Last Updated 2018-08-02 11:38 AM by Diantha La Vine
Record Created 2014-09-10 2:12 PM by Carlos Reyna
Record Posted 2015-02-05
Phenotypic Description
Figure 1. Hypopigmentation phenotype of the 50-cal mice (bottom). C57BL/6J mouse (top) is shown for reference.

Figure 2. 50-cal mice exhibited increased viral titers in the spleen after mouse cytomegalovirus (MCMV) infection. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. 50-cal mice exhibited increased viral titers in the liver after mouse cytomegalovirus (MCMV) infection. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The 50-cal phenotype was identified among ENU-induced G3 mice of the pedigree R1475, some of which had a dark grey coat color (Figure 1). Some mice also showed increased mouse cytomegalovirus (MCMV) titers in the spleen (Figure 2) and liver (Figure 3) after MCMV infection.

Nature of Mutation

Figure 4. Linkage mapping of the increased MCMV titer in the spleen after MCMV infection using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 54 mutations (X-axis) identified in the G1 male of pedigree R1475. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 54 mutations. The increased susceptibility to MCMV infection phenotype was linked by continuous variable mapping to a mutation in Lyst. The Lyst mutation is a T to A transversion at base pair 13,708,212 (v38) on chromosome 13, or base pair 117,881 in the GenBank genomic region NC_000079 within the donor splice site of intron 34. The strongest association was found with a recessive model of linkage to the normalized MCMV titer in the spleen, wherein 1 variant homozygote departed phenotypically from 10 homozygous reference mice and 9 heterozygous mice with a P value of 5.221 x 10-50 (Figure 4).  The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 189-nucleotide exon 34 (out of 53 total exons), resulting in coding of one aberrant amino acid (S2857R); the rest of the protein product is unchanged.


              <--exon 33          <--exon 34 intron 34-->      exon 35-->

2852 ……-N--N--N--Q--Q--S ……-Q--L--T--H--D--R                   --A--V--W--Y--D-……
           correct              deleted                              correct


The donor splice site of intron 34, which is destroyed by the 50-cal mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.  The highlighted amino acid (S2857) is aberrant as the result of the mutation.


Alternatively, the use of a cryptic site in exon 34 may be used resulting in deletion of 89 nucleotides in exon 34. The deletion would result in a frameshift, coding of four aberrant amino acids after amino acid 2890, and coding of a premature stop codon after amino acid 2894.


              <--exon 33                                <--exon 34 intron 34-->      exon 35-->
2852 ……-N--N--N--Q--Q--S ……--R--K--K--V--I--Q--……-Q--L--T--H--D--R                   -S--S--L--V--*
           correct                          deleted                                     aberrant    


The donor splice site of intron 34, which is destroyed by the 50-cal mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.  The putative cryptic splice donor site is highlighted.

Protein Prediction

Figure 5. Domain structure of the Lyst protein. The Lyst protein is a 3788-amino acid protein whose biochemical functions remain unknown. The N-terminal portion of the protein contains approximately twenty repeats with homology to ARM  and HEAT repeat motifs and a perilipin domain (PD). The C-terminal portion of Lyst contains a BEACH  domain and seven WD40 motifs. The 50-cal mutation occurs in intron 34. This image is interactive. This image is interactive. Click on the mutations (red) for more specific information.

The Lyst gene encodes the protein Lyst (also CHS/Beige), a 3788-amino acid protein whose biochemical functions remain unknown (Figure 3). A large N-terminal portion of the protein (amino acids 1-3132) contains approximately twenty repeats with homology to ARM (Armadillo) and HEAT (huntingtin, elongation factor 3, A subunit of protein phosphatase A, target of rapamycin) repeat motifs (1;2). ARM and HEAT motifs are α-helical domains of about 50 amino acids that pack together to form elongated “solenoids” (3); evidence suggests they mediate protein associations at the membrane (4), and vesicle transport (5), respectively. The C-terminus of Lyst contains two distinct domains, a BEACH (beige and chediak) domain (amino acids 3132-3472) and seven WD40 motifs (1). The BEACH domain is a 345-amino acid region of unknown function (1), and WD40 motifs are protein interaction motifs that typically form β sheets arranged in a 7-bladed β propeller fold (6).The 50-cal mutation is predicted to affect the ARM/HEAT domain.


Please see the record for souris for information about Lyst.

Putative Mechanism

In humans, mutations in the LYST gene cause Chediak-Higashi Syndrome (CHS, OMIM #214500), a rare autosomal recessive disorder characterized by oculocutaneous albinism, severe immune deficiency, bleeding tendency, recurrent pyogenic infection, progressive neurologic defects and a lymphoproliferative syndrome [(7;8); reviewed in (2)]. These defects are caused by the aberrant formation of giant granules within a variety of cell types, and disrupted intracellular protein trafficking (2;9;10). The enlarged granules consist of organelles such as lysosomes, melanosomes, cytolytic granules and platelet dense bodies, and it is thought that the increased size of these organelles inhibits their migration and fusion at the cell surface and/or organelle-organelle fusion. There is no clear understanding of the molecular mechanisms of Lyst protein function, or how its loss leads to the formation of enlarged lysosomes and lysosome-related organelles. In mice, mutations in Lyst cause the beige phenotype (7;8). As in humans, beige mice exhibit hypopigmentation, bleeding tendency, and defective immune cell function resulting from the formation of giant granules in melanosomes, lymphocytes, neutrophils, and other cell types (10-12). Beige mice have defective NK cell (13) and cytotoxic T lymphocyte function (14), and increased susceptibility to infections including MCMV (15;16). However, beige mice do not develop lymphoproliferative disorder, even after challenge with infection (15). The 50-cal hypopigmentation and MCMV susceptibility phenotype mimics other known alleles of Lyst (see MGI for a list of Lyst alleles as well as the Beutler alleles souris and charlotte_gray) indicating that there is loss of function in the Lyst50-cal protein.

Primers PCR Primer
50-cal(R):5'- ctccctagccccCTCATAATGTACC -3'

Sequencing Primer
50-cal_seq(F):5'- TCTCCCAAGGCATTGAAAGG -3'
50-cal_seq(R):5'- tccgtaatgagacctgacacc -3'
  11. Kelly, E. M. (1957) Beige, Bg. Mouse News Lett. 16, 36-36.
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsTao Yue, Duanwu Zhang, Carlos Reyna, Tiana Purrington, Bruce Beutler