Phenotypic Mutation 'pip-squeak'

• Allele: pip-squeak
• Mutation Type: critical splice acceptor site (2 bp from exon)
• Chromosome: 11
• Coordinate: 70,505,956 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Chrne
• Gene Name: cholinergic receptor, nicotinic, epsilon polypeptide
• Synonym(s): AChrepsilon, Acre
• Chromosomal Location: 70,505,709-70,510,042 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes the epsilon subunit of the muscle-derived nicotinic acetylcholine receptor, a pentameric neurotransmitter receptor and member of the ligand-gated ion channel superfamily. The acetylcholine receptor changes subunit composition shortly after birth when the epsilon subunit replaces the gamma subunit seen in embryonic receptors. In mice, deficiency of this gene can lead to a decline in the number of nicotinic acetylcholine receptors at neuromuscular junctions and causes progressive muscle weakness, atrophy and premature death. Mutations in this gene serve as a pathophysiological model for human congenital myasthenia. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Nov 2012] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced AChR receptor density at neuromuscular synapses, impaired neuromuscular transmission, progressive muscular weakness and atrophy, and lethality at 2-3 months of age. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000014753 ^†] [ENSMUSP00000099616 ^†] † probably from a misspliced transcript
• AlphaFold: P20782
• SMART Domains: Protein: ENSMUSP00000014753; Gene: ENSMUSG00000014609

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Neur_chan_LBD	24	240	2.9e-65	PFAM
Pfam:Neur_chan_memb	247	475	6.5e-58	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000099616; Gene: ENSMUSG00000014609

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Neur_chan_LBD	24	240	5.4e-65	PFAM
Pfam:Neur_chan_memb	247	474	2.9e-53	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9495
• Is this an essential gene?: Probably nonessential (E-score: 0.080)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• Last Updated: 2016-05-13 3:09 PM by Anne Murray
• Record Created: 2014-09-20 11:58 AM by Jeff SoRelle
• Record Posted: 2015-01-13
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Jeff SoRelle, Zhe Chen, William McAlpine, Noelle Hutchins

Accession Number

NCBI RefSeq: NM_009603; MGI:87894

Alleles Listed at MGI

All mutations/alleles(5) : Targeted(5)

Repository

MMRRC:37601

Phenotypic Description

Figure 1. Homozygous pip-squeak mice exhibited reduced body weights. Scaled weight data are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The pip-squeak phenotype was identified among G3 mice of the pedigree R1378, some of which showed reduced body weights (Figure 1). Some mice also exhibited premature lethality by postnatal day (P) 70-80.

Nature of Mutation

Figure 2. Linkage mapping of the pip-squeak phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 50 mutations (X-axis) identified in the G1 male of pedigree R1378. Weight phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 50 mutations.  The body weight phenotype was linked to a mutation in Chrne:  an A to T transversion at base pair 70,615,130 (v38) on chromosome 11, or base pair 4,501 in the GenBank genomic region NC_000077.  Linkage was found with a recessive model of inheritance (P = 3.655 x 10^-16), wherein 3 variant homozygotes departed phenotypically from 9 homozygous reference mice and 14 heterozygous mice (Figure 2). The mutation is located with intron 11, two nucleotides from the next exon (exon 12). The Chrne transcript contains 12 total exons. Currently, it is unknown how the pip-squeak mutation affects splicing of the gene. The placement of putative cryptic acceptor sites within exon 12 are unknown.

exon 11-->          intron 11-->     exon 12-->                     4317 CAGCCCTC……ACTGGAGAG gtggg……ctctcacag GAACTGTCC……CAACCATGA 407  A--A--L-……-T--G--E-                  -E--L--S-……-Q--P--*  493                             correct

    

The mutated nucleotide is indicated in red lettering; the acceptor splice site of intron 11 is indicated in blue lettering.

Protein Prediction

Figure 3. Domain structure of the ɛ subunit of AChR. The pip-squeak mutation within the splice site of intron 11 is indicated. SP, signal peptide; LBD, ligand-binding domain; M1-M4, transmembrane domains.

Chrne encodes the epsilon (ɛ) subunit of the adult-type nicotinic acetylcholine receptor (AChR). Each subunit is similar in size and exhibits the same three-dimensional fold (1) (see the Background section for more details on the AChR channel. Amino acids 1-20 constitute a signal peptide that is removed upon translocation into the endoplasmic reticulum [Figure 3; (2;3)]. The N-terminus of each of the subunits (amino acids 21-239 in the ɛ subunit) is extracellular and consists of a β-sandwich core with ten β-strands and one α-helix (1). The region near Ser126 and Tyr135 within the extracellular N-terminus is important for AChR assembly in the mouse (3). Ser126 and Tyr135 increased surface AChR expression by promoting the formation of a heterodimer between the ɛ and α subunits of the AChR (3). The rat ɛ subunit has amino acid differences at amino acid 126 and 135 compared to the mouse sequence. As a result, the rat ɛ subunit is approximately 10 times less effective than that of the mouse in supporting surface expression of AChRs when expressed in COS cells (3). The transmitter-binding sites of AChR are within the extracellular domain at the α-ε and α-δ interfaces (4;5). The sites form a gate region in the transmembrane domain that regulates ionic conductance (6). Within the transmitter-binding sites are the conserved prolines ProD1 (Pro140 in the ɛ subunit) and ProD2 (Pro141 in the ɛ subunit). Mutation of the ε-ProD2 proline residue to a leucine (ϵProD2-L) has been linked to congenital myasthenic syndrome (CMS) (4).  The mutation reduces the resting affinity of the α-ε transmitter-binding site and the gating equilibrium constant (4).

Each of the AChR subunits has four transmembrane domains designated as M1-M4 (amino acids 240-264 (M1), 273-291 (M2), 307-328 (M3), and 457-480 (M4) in the ɛ subunit) (1;7). The M1 domains of the AChR function in agonist dissociation and channel gating (8). Five amino acids join the β10 strand from the ECD with the M1 helix and is termed the “pre-M1” linker (9). Each of the linkers in the AChR subunits contains a conserved central positively charged Arg (Arg^3’) that is flanked by positively charged amino acids. The role of is Arg^3’ unclear. Some studies proposed that disruption of a salt bridge between Arg^3’ and loop 2 residue αGlu⁴⁵ occurs during gating of the channel (12). Another study propose that the role of Arg^3’ in gating is not significant, but that it is essential for receptor expression (10). A third study found that mutation of Arg^3’ in any of the subunits result in reduced channel expression and alters the gating equilibrium constant (9). The opening and closing of the gate near the M2 equator involves the rearrangement of atoms in all five subunits (9). The M2 domains shape the lumen of the pore and forms the gate of the closed channel (11). The M3 domains also contribute to channel gating (12;13). The M4 domains shift during channel activation and may function in regulating AChR kinetics by interacting with membrane lipids (14;15). The M1, M3, and M4 helices are stabilized in the membrane by clustering of hydrophobic side chains around a central aromatic residue (1;7).

Two Chrne splice variants have been identified. An mouse-specific ε subunit splice variant, ε_s, lacks exon 5 and encodes a truncated protein that lacks a portion of the N-terminal domain that contains an linked glycosylation site (Asn 161) and the two cysteines needed for the formation of a disulfide-bonded intermolecular loop [Cys148 and Cys162; (16)]. An ε subunit splice variant, ε_t, lacks exon 8 and encodes a truncated protein that contains the extracellular N-terminus, the M1 transmembrane domain, and a portion of the first intracellular loop (17). Ghedini et al. propose that if the splice variant is translated, it may be a non-functional isoform due to the loss of the M2 domain that forms the ionic channel (17).

Expression/Localization

Chrne transcription is regulated by cell type and occurs only in the synaptic nuclei of fully differentiated skeletal muscle cells at or around the time of birth (18-21). Chrne is expressed at low levels in neonatal mouse and rat myotubules (22). After birth, the level of Chrne increased 10-fold (23;24) and is confined to the developing motor endplate (19). Chrne levels are maintained in the adult (19;20). In primary mouse muscle cultures, the glycoprotein ARIA (AChR-inducing activity) was able to increase the synthesis of AChR and increase Chrne mRNA levels 10-fold in mouse myotubules (22). Martinou et al. propose that ARIA induces the adult-type AChRs during the first 2 weeks after birth (22). Chrne expression did not change upon treatment with factors known to be associated with neuromuscular junction formation and/or muscle differentiation (CGRP, thyroxine, forskolin, phorbol 12-myristate 13-acetate, A23187, bFGF, or TGFBeta) (22). In the rat, the ε subunit levels increase during the first two weeks of postnatal development from no hybridization signal detected at postnatal day 1 to increasing expression at P5, 9, and 12 (19;23). Expression of the ε subunit is induced locally via a signal restricted to the end-plate region (19). Regulatory elements contribute to the repression of the AChR subunit genes in extrajunctional areas (25). An E box contains a CANNTG consensus target sequence and binds myogenic b-HLH transcription factors of the MyoD gene family (26;27). An 83-nucleotide fragment upstream of the transcription start site of Chrne confers preferential synaptic expression in whole muscle of a LacZ reporter gene (28).  In support of this, Sunyer et al. identified a 151 base pair fragment upstream of Chrne start site is required for cell type- and differentiation-specific promoter activity; the activity was independent of the E-box (29). Electrical activity evoked by the motor nerve during development contributes to the transcriptional repression of AChR genes in extrajunctional areas (30-32). During muscle cell determination and differentiation, specific histone modifications are targeted to the Chrne locus (18). During muscle cell determination, K4 dimethylation is induced, while during differentiation trimethylation is induced (18). During determination and differentiation, loss of trimethylation and appearance of monomethylation occurs at K27 (18). K9/14 acetylation are also induced in a developmental pattern (18).

Chrne has also been detected in adult mouse diaphragm, mouse airway epithelial cells, and fibroblasts as well as in all brain regions examined (cortex, hippocampus, and cerebellum) (17;33;34).  The ɛ_s splice variant is expressed in skeletal muscle and diaphragm as well as in the cortex, hippocampus, and cerebellum (16;17). The ɛ_t splice variant was not expressed in skeletal muscle, but was restricted to the brain (17).

Background

Figure 4. AChR-associated signaling. The AChR regulates the flow of ions across the cell membrane to mediate synaptic transmission at the neuromuscular junction. A detailed description of the function of AChR is detailed in the key below the figure. See the text for more details.

AChR is an ion channel that regulates the flow of water and ions across the cell membrane to mediate synaptic transmission at the neuromuscular junction [Figure 4; (2)]. In the central and peripheral nervous systems, ACh is released from the nerve terminal where it binds to the AChR on the end plate of the muscle fibers to facilitate cation-selective channel opening. Negatively charged amino acids at the ends of the pore prevent negative ions from entering, while encouraging positive ions (e.g., sodium, potassium, and some calcium) to enter. As a result of the large influx of sodium, the membrane depolarizes and signals to the muscle to contract (4;35;36).

Figure 5. Crystal structure of the Torpedo marmorata AChR. Figures generated by Chimera and are based on PDB: 2BG9 and ( 1 ) as well as PDB: 1OED and ( 7 ). (A) View of the AChR parallel to the membrane plane. Trp149, a conserved residue that coordinates ACh, is indicated in the α subunits. Image is interactive; click to rotate. (α, green; β, yellow; δ, blue; γ, purple) (B) Static view of the AChR parallel to the membrane plane. (C) View of the AChR from the synaptic cleft. Each of the subunits are indicated. Trp149 is indicated in the α subunits. (D) The isolated ε/γ subunit from the AChR structure. Colors of the individual domains mimic Figure 3.

The AChR contains five subunits [α₂βδγ (fetal-type) or α₂βδε (adult-type)] encoded by highly conserved separate genes (29;37;38). Approximately 2 weeks after birth in the mouse, the subunit composition and the characteristics of the AChR changes from low-conductance, long open time to high conductance, brief open time (39). The adult form of the AChR exhibits greater channel conductance to Na⁺, K⁺ and Ca²⁺ than the fetal receptors (40). The shift in AChR composition is due to changes in transcription: Chrne is activated postnatally resulting in expression of the ε subunit, while Chrng (encoding the gamma subunit) expression is down-regulated (22;23;41;42). Each of the AChR subunits interacts with two of its neighboring subunits. AChR assembly occurs in the ER before translocation to the Golgi and the cell surface (3). The AChR has an N-terminal extracellular ligand-binding domain, a membrane-spanning pore, and an intracellular domain [PDB:2BG9; (1)]. The β-barrels from each of the subunits forms the extracellular domain of the AChR and the α-helical M1-M4 domains from each of the subunits forms the transmembrane domain (9). The two binding sites for ACh are at the α-γ (or ε) and α-δ interfaces approximately 40Å from the membrane surface and are on opposite sides of the pore (1). The subunits in the ligand-binding domain are organized around two sets of β-sheets packed into a β-sandwhich and joined through the disulfide bridge forming the Cys loop (1). Each subunit resembles the blade of a propeller when viewed from the synaptic cleft [PDB:1OED; (7)]. The AChR forms a narrow pore through the lipid bilayer and has wider vestibules at both ends. The pore has an inner ring of 5 α-helices (i.e., the M2 domains of the subunits) that curve radially to generate a tapering path for the ions (7). The pore also has an outer ring of 15 α-helices that coil around each other and protect the inner ring from lipids (7). Binding of ACh to the ligand binding domains of the α-subunits causes rotation of the protein chains on opposite sides of the entrance of the pore, widening of the lumen of the pore (7). In the closed state, the inner helix ring come together near the middle of the membrane to form a hydrophobic girdle to prevent ion permeation (43) and are proposed to function as a gate (1;44;45). Additional studies determined that in order for the channel to open, ACh triggers the inner β-sheets of the α-subunits to communicate through to the inner helices that break the gate apart (7;46).

Mutations in CHRNE are linked to congenital myasthenic syndrome (associated with acetylcholine receptor deficiency) (OMIM: #608931), autosomal recessive fast-channel myasthenic syndrome (OMIM: #608930), and autosomal dominant slow-channel myasthenic syndrome (OMIM: #601462) (47-51). Myasthenic syndromes are associated with compromised neuromuscular transmission, but the clinical manifestations vary by syndrome subtype [reviewed in (52)]. The slow-channel syndrome can occur at any stage of life (53). Typically, symptoms of the fast-channel syndrome occur in neonates and infants (53-55). Patients with myasthenic syndrome can exhibit hypotonia, delayed motor development, ptosis, ophthalmoplegia, weakness, skeletal deformaties (e.g., arthrogryposis, lordosis, or scoliosis), muscular atrophy, dysphagia, and respiratory difficulty. The myasthenic syndromes occur as the result of abnormal AChR activity after ACh stimulation. In the slow-channel syndrome, the AChR has difficulty closing leading to abnormal entry of calcium into the muscle fiber and subsequent endplate myopathy, while in the fast-channel syndrome, the AChR remains closed [reviewed in (52)]. Mutations in CHRNE often result in the reduced AChR expression and subsequent reduced receptor density on the postsynaptic membrane (53). In addition, there is persistent presence of the fetal form of the AChR that contains the γ subunit (53;55). Patients exhibit some favorable responses to treatment with cholinesterase inhibitors (e.g., pyridostigmine and/or 3,4-diaminopyridine) (56).

Putative Mechanism

Chrne knockout (Chrne^-/-) mice appear normal within the first few weeks after birth, but at approximately 1 month of age they become weaker and less active than their littermates (38). In addition, the mice fail to put on weight (by P28 they were at least 40% smaller than wild-type mice) and died between 8 and 14 weeks of age (35;38;47). By 5 weeks of age, muscle atrophy was observed, but the muscle was free from gross pathology; muscle necrosis or apoptosis were not observed (38). The reduced muscle strength is due to a loss in endplate AChR; the mice have approximately 5% of wild-type AChR numbers at the time of death (35). The number of AChRs at the endplates in the Chrne^-/- mice are normal until approximately P7 (38). Chrne^-/- mice maintain γ-subunit-containing AChRs at their endplates after the usual time of transition (i.e., postnatal day (P) 14) (38). At all ages tested, the endplates from the Chrne^-/- mice were of the fetal composition (α₂βδγ) (38). The phenotype of the pip-squeak mouse included an inability to gain weight and premature lethality, indicating that there is loss of function of the mutant AChR.

Primers

PCR Primer
pip-squeak_pcr_F: TTGCCTCCAAGTGCCTGACCAAAC
pip-squeak_pcr_R: AAATCCGCTGCTGTGTGGATGCTG

Sequencing Primer
pip-squeak_seq_F: ACCAGATTTATTGTCAGCGGC
pip-squeak_seq_R: GTGAACTTTGTGGCTGAGAGC

Genotyping

Pip-squeak genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.
 

PCR Primers

Pip-squeak (F): 5’- TTGCCTCCAAGTGCCTGACCAAAC-3’

Pip-squeak (R): 5’- AAATCCGCTGCTGTGTGGATGCTG-3’

Sequencing Primer

Pip-squeak (F): 5’- ACCAGATTTATTGTCAGCGGC-3’
 

Pip-squeak (R): 5’- GTGAACTTTGTGGCTGAGAGC-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 483 nucleotides is amplified (Chr.11: 70614796-70615278, GRCm38; NC_000077):

ttgcctccaa gtgcctgacc aaaccaccca cccatcttct acttccctga ggagttggac

ccacccacat gaccacacaa cccctcctgc aagttcacaa accagattta ttgtcagcgg

cctgttttca aaatctcttt cttggggggt gggggagagg tgggtgccag tgcaggctca

tggttggatg cacggtgggt aagggagatc aggaacttgg ttgaagtaac ccccaaggaa

gatgagagta gaaccaacgc tgaagagcac caaagctgcc caaaaacaga cattgtccag

ggccttcccc atacgcaccc agtcggacag ttcctgtgag agagagctta gcgagggagg

agcctggagg gcggggcatc tagcactgct ccgcctcaac ctcccaaccc acctctccag

tggcttcctg gtctcttgtg ctctcagcca caaagttcac agcatccaca cagcagcgga

ttt

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide (T) is shown in red text (A>T, sense strand; T>A, Chr.+ strand).

References

  1. Unwin, N. (2005) Refined Structure of the Nicotinic Acetylcholine Receptor at 4A Resolution. J Mol Biol. 346, 967-989.

  2. Beeson, D., Brydson, M., Betty, M., Jeremiah, S., Povey, S., Vincent, A., and Newsom-Davis, J. (1993) Primary Structure of the Human Muscle Acetylcholine Receptor. cDNA Cloning of the Gamma and Epsilon Subunits. Eur J Biochem. 215, 229-238.

  3. Gu, Y., Camacho, P., Gardner, P., and Hall, Z. W. (1991) Identification of Two Amino Acid Residues in the Epsilon Subunit that Promote Mammalian Muscle Acetylcholine Receptor Assembly in COS Cells. Neuron. 6, 879-887.

  4. Gupta, S., Purohit, P., and Auerbach, A. (2013) Function of Interfacial Prolines at the Transmitter-Binding Sites of the Neuromuscular Acetylcholine Receptor. J Biol Chem. 288, 12667-12679.

  5. Nayak, T. K., and Auerbach, A. (2013) Asymmetric Transmitter Binding Sites of Fetal Muscle Acetylcholine Receptors Shape their Synaptic Response. Proc Natl Acad Sci U S A. 110, 13654-13659.

  6. Auerbach, A. (2010) The Gating Isomerization of Neuromuscular Acetylcholine Receptors. J Physiol. 588, 573-586.

  7. Miyazawa, A., Fujiyoshi, Y., and Unwin, N. (2003) Structure and Gating Mechanism of the Acetylcholine Receptor Pore. Nature. 423, 949-955.

  8. Spitzmaul, G., Corradi, J., and Bouzat, C. (2004) Mechanistic Contributions of Residues in the M1 Transmembrane Domain of the Nicotinic Receptor to Channel Gating. Mol Membr Biol. 21, 39-50.

  9. Bruhova, I., and Auerbach, A. (2010) Subunit Symmetry at the Extracellular Domain-Transmembrane Domain Interface in Acetylcholine Receptor Channel Gating. J Biol Chem. 285, 38898-38904.

  10. Purohit, P., and Auerbach, A. (2007) Acetylcholine Receptor Gating at Extracellular Transmembrane Domain Interface: The "Pre-M1" Linker. J Gen Physiol. 130, 559-568.

  11. Hucho, F., Oberthur, W., and Lottspeich, F. (1986) The Ion Channel of the Nicotinic Acetylcholine Receptor is Formed by the Homologous Helices M II of the Receptor Subunits. FEBS Lett. 205, 137-142.

  12. De Rosa, M. J., Corradi, J., and Bouzat, C. (2008) Subunit-Selective Role of the M3 Transmembrane Domain of the Nicotinic Acetylcholine Receptor in Channel Gating. Biochim Biophys Acta. 1778, 521-529.

  13. Wang, H. L., Milone, M., Ohno, K., Shen, X. M., Tsujino, A., Batocchi, A. P., Tonali, P., Brengman, J., Engel, A. G., and Sine, S. M. (1999) Acetylcholine Receptor M3 Domain: Stereochemical and Volume Contributions to Channel Gating. Nat Neurosci. 2, 226-233.

  14. Bouzat, C., Gumilar, F., del Carmen Esandi, M., and Sine, S. M. (2002) Subunit-Selective Contribution to Channel Gating of the M4 Domain of the Nicotinic Receptor. Biophys J. 82, 1920-1929.

  15. Tamamizu, S., Lee, Y., Hung, B., McNamee, M. G., and Lasalde-Dominicci, J. A. (1999) Alteration in Ion Channel Function of Mouse Nicotinic Acetylcholine Receptor by Mutations in the M4 Transmembrane Domain. J Membr Biol. 170, 157-164.

  16. Koishi, K., and McLennan, I. S. (1998) A Murine Specific Splicing Variant of the Acetylcholine Receptor Epsilon-Subunit Gene Transcript. Biochim Biophys Acta. 1401, 315-318.

  17. Ghedini, P. C., Honda, L., Avellar, M. C., and Souccar, C. (2010) Presence of mRNA of Muscle Nicotinic Acetylcholine Receptor Subunits and an Epsilon-Subunit Splice Variant in the Mouse Brain. Brain Res Bull. 81, 453-457.

  18. Herndon, C. A., Snell, J., and Fromm, L. (2011) Chromatin Modifications that Support Acetylcholine Receptor Gene Activation are Established during Muscle Cell Determination and Differentiation. Mol Biol Rep. 38, 1277-1285.

  19. Brenner, H. R., Witzemann, V., and Sakmann, B. (1990) Imprinting of Acetylcholine Receptor Messenger RNA Accumulation in Mammalian Neuromuscular Synapses. Nature. 344, 544-547.

  20. Goldman, D., and Staple, J. (1989) Spatial and Temporal Expression of Acetylcholine Receptor RNAs in Innervated and Denervated Rat Soleus Muscle. Neuron. 3, 219-228.

  21. Witzemann, V., Barg, B., Nishikawa, Y., Sakmann, B., and Numa, S. (1987) Differential Regulation of Muscle Acetylcholine Receptor Gamma- and Epsilon-Subunit mRNAs. FEBS Lett. 223, 104-112.

  22. Martinou, J. C., Falls, D. L., Fischbach, G. D., and Merlie, J. P. (1991) Acetylcholine Receptor-Inducing Activity Stimulates Expression of the Epsilon-Subunit Gene of the Muscle Acetylcholine Receptor. Proc Natl Acad Sci U S A. 88, 7669-7673.

  23. Witzemann, V., Barg, B., Criado, M., Stein, E., and Sakmann, B. (1989) Developmental Regulation of Five Subunit Specific mRNAs Encoding Acetylcholine Receptor Subtypes in Rat Muscle. FEBS Lett. 242, 419-424.

  24. Martinou, J. C., and Merlie, J. P. (1991) Nerve-Dependent Modulation of Acetylcholine Receptor Epsilon-Subunit Gene Expression. J Neurosci. 11, 1291-1299.

  25. Duclert, A., Savatier, N., Schaeffer, L., and Changeux, J. P. (1996) Identification of an Element Crucial for the Sub-Synaptic Expression of the Acetylcholine Receptor Epsilon-Subunit Gene. J Biol Chem. 271, 17433-17438.

  26. Murre, C., McCaw, P. S., Vaessin, H., Caudy, M., Jan, L. Y., Jan, Y. N., Cabrera, C. V., Buskin, J. N., Hauschka, S. D., and Lassar, A. B. (1989) Interactions between Heterologous Helix-Loop-Helix Proteins Generate Complexes that Bind Specifically to a Common DNA Sequence. Cell. 58, 537-544.

  27. Lassar, A. B., Buskin, J. N., Lockshon, D., Davis, R. L., Apone, S., Hauschka, S. D., and Weintraub, H. (1989) MyoD is a Sequence-Specific DNA Binding Protein Requiring a Region of Myc Homology to Bind to the Muscle Creatine Kinase Enhancer. Cell. 58, 823-831.

  28. Duclert, A., Savatier, N., and Changeux, J. P. (1993) An 83-Nucleotide Promoter of the Acetylcholine Receptor Epsilon-Subunit Gene Confers Preferential Synaptic Expression in Mouse Muscle. Proc Natl Acad Sci U S A. 90, 3043-3047.

  29. Sunyer, T., and Merlie, J. P. (1993) Cell Type- and Differentiation-Dependent Expression from the Mouse Acetylcholine Receptor Epsilon-Subunit Promoter. J Neurosci Res. 36, 224-234.

  30. Goldman, D., Brenner, H. R., and Heinemann, S. (1988) Acetylcholine Receptor Alpha-, Beta-, Gamma-, and Delta-Subunit mRNA Levels are Regulated by Muscle Activity. Neuron. 1, 329-333.

  31. Merlie, J. P., and Kornhauser, J. M. (1989) Neural Regulation of Gene Expression by an Acetylcholine Receptor Promoter in Muscle of Transgenic Mice. Neuron. 2, 1295-1300.

  32. Tsay, H. J., and Schmidt, J. (1989) Skeletal Muscle Denervation Activates Acetylcholine Receptor Genes. J Cell Biol. 108, 1523-1526.

  33. Hogg, R. C., Raggenbass, M., and Bertrand, D. (2003) Nicotinic Acetylcholine Receptors: From Structure to Brain Function. Rev Physiol Biochem Pharmacol. 147, 1-46.

  34. Racke, K., Juergens, U. R., and Matthiesen, S. (2006) Control by Cholinergic Mechanisms. Eur J Pharmacol. 533, 57-68.

  35. Witzemann, V., Schwarz, H., Koenen, M., Berberich, C., Villarroel, A., Wernig, A., Brenner, H. R., and Sakmann, B. (1996) Acetylcholine Receptor Epsilon-Subunit Deletion Causes Muscle Weakness and Atrophy in Juvenile and Adult Mice. Proc Natl Acad Sci U S A. 93, 13286-13291.

  36. Lobos, E. A. (1993) Five Subunit Genes of the Human Muscle Nicotinic Acetylcholine Receptor are Mapped to Two Linkage Groups on Chromosomes 2 and 17. Genomics. 17, 642-650.

  37. Buonanno, A., Mudd, J., and Merlie, J. P. (1989) Isolation and Characterization of the Beta and Epsilon Subunit Genes of Mouse Muscle Acetylcholine Receptor. J Biol Chem. 264, 7611-7616.

  38. Missias, A. C., Mudd, J., Cunningham, J. M., Steinbach, J. H., Merlie, J. P., and Sanes, J. R. (1997) Deficient Development and Maintenance of Postsynaptic Specializations in Mutant Mice Lacking an 'Adult' Acetylcholine Receptor Subunit. Development. 124, 5075-5086.

  39. Gu, Y., and Hall, Z. W. (1988) Characterization of Acetylcholine Receptor Subunits in Developing and in Denervated Mammalian Muscle. J Biol Chem. 263, 12878-12885.

  40. Villarroel, A., and Sakmann, B. (1996) Calcium Permeability Increase of Endplate Channels in Rat Muscle during Postnatal Development. J Physiol. 496 ( Pt 2), 331-338.

  41. Missias, A. C., Chu, G. C., Klocke, B. J., Sanes, J. R., and Merlie, J. P. (1996) Maturation of the Acetylcholine Receptor in Skeletal Muscle: Regulation of the AChR Gamma-to-Epsilon Switch. Dev Biol. 179, 223-238.

  42. Sanes, J. R. (1997) Genetic Analysis of Postsynaptic Differentiation at the Vertebrate Neuromuscular Junction. Curr Opin Neurobiol. 7, 93-100.

  43. Corry, B. (2004) Theoretical Conformation of the Closed and Open States of the Acetylcholine Receptor Channel. Biochim Biophys Acta. 1663, 2-5.

  44. Unwin, N. (1993) Nicotinic Acetylcholine Receptor at 9 A Resolution. J Mol Biol. 229, 1101-1124.

  45. Miyazawa, A., Fujiyoshi, Y., Stowell, M., and Unwin, N. (1999) Nicotinic Acetylcholine Receptor at 4.6 A Resolution: Transverse Tunnels in the Channel Wall. J Mol Biol. 288, 765-786.

  46. Unwin, N., Miyazawa, A., Li, J., and Fujiyoshi, Y. (2002) Activation of the Nicotinic Acetylcholine Receptor Involves a Switch in Conformation of the Alpha Subunits. J Mol Biol. 319, 1165-1176.

  47. Cossins, J., Webster, R., Maxwell, S., Burke, G., Vincent, A., and Beeson, D. (2004) A Mouse Model of AChR Deficiency Syndrome with a Phenotype Reflecting the Human Condition. Hum Mol Genet. 13, 2947-2957.

  48. Gomez, C. M., and Gammack, J. T. (1995) A Leucine-to-Phenylalanine Substitution in the Acetylcholine Receptor Ion Channel in a Family with the Slow-Channel Syndrome. Neurology. 45, 982-985.

  49. Ohno, K., Quiram, P. A., Milone, M., Wang, H. L., Harper, M. C., Pruitt, J. N.,2nd, Brengman, J. M., Pao, L., Fischbeck, K. H., Crawford, T. O., Sine, S. M., and Engel, A. G. (1997) Congenital Myasthenic Syndromes due to Heteroallelic nonsense/missense Mutations in the Acetylcholine Receptor Epsilon Subunit Gene: Identification and Functional Characterization of Six New Mutations. Hum Mol Genet. 6, 753-766.

  50. Ohno, K., Wang, H. L., Milone, M., Bren, N., Brengman, J. M., Nakano, S., Quiram, P., Pruitt, J. N., Sine, S. M., and Engel, A. G. (1996) Congenital Myasthenic Syndrome Caused by Decreased Agonist Binding Affinity due to a Mutation in the Acetylcholine Receptor Epsilon Subunit. Neuron. 17, 157-170.

  51. Nichols, P., Croxen, R., Vincent, A., Rutter, R., Hutchinson, M., Newsom-Davis, J., and Beeson, D. (1999) Mutation of the Acetylcholine Receptor Epsilon-Subunit Promoter in Congenital Myasthenic Syndrome. Ann Neurol. 45, 439-443.

  52. Lorenzoni, P. J., Scola, R. H., Kay, C. S., and Werneck, L. C. (2012) Congenital Myasthenic Syndrome: A Brief Review. Pediatr Neurol. 46, 141-148.

  53. Engel, A. G., Shen, X. M., Selcen, D., and Sine, S. M. (2010) What have we Learned from the Congenital Myasthenic Syndromes. J Mol Neurosci. 40, 143-153.

  54. Palace, J., and Beeson, D. (2008) The Congenital Myasthenic Syndromes. J Neuroimmunol. 201-202, 2-5.

  55. Barisic, N., Chaouch, A., Muller, J. S., and Lochmuller, H. (2011) Genetic Heterogeneity and Pathophysiological Mechanisms in Congenital Myasthenic Syndromes. Eur J Paediatr Neurol. 15, 189-196.

  56. Schara, U., and Lochmuller, H. (2008) Therapeutic Strategies in Congenital Myasthenic Syndromes. Neurotherapeutics. 5, 542-547.