Phenotypic Mutation 'Phelps' (pdf version)
AllelePhelps
Mutation Type splice site (9 bp from exon)
Chromosome1
Coordinate34,262,876 bp (GRCm39)
Base Change T ⇒ A (forward strand)
Gene Dst
Gene Name dystonin
Synonym(s) bullous pemphigoid antigen 1, BPAG1-n, Macf2, bullous pemphigoid antigen 1, Bpag1, A830042E19Rik, 2310001O04Rik, athetoid, Bpag, BPAG1, nmf203, nmf339, ah
Chromosomal Location 33,947,306-34,347,742 bp (+) (GRCm39)
MGI Phenotype PHENOTYPE: Mutations in this gene produce peripheral nervous system demyelination resulting in impaired muscle function and shorter lifespan. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001276764, NM_134448, NM_133833, NM_010081; MGI:104627

MappedNo 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000095392 ] [ENSMUSP00000095393 ] [ENSMUSP00000110756 ] [ENSMUSP00000138308 ] [ENSMUSP00000141127 ]   † probably from a misspliced transcript
AlphaFold no structure available at present
PDB Structure Crystal Structure of a protease resistant fragment of the plakin domain of Bullous Pemphigoid Antigen1 (BPAG1) [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000095392
Gene: ENSMUSG00000026131

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 1e-42 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 4e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 6e-63 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
PLEC 1537 1581 9.05e-3 SMART
PLEC 1582 1619 2.7e0 SMART
PLEC 1657 1694 2.23e0 SMART
PLEC 1695 1732 4.25e1 SMART
PLEC 1735 1770 1.39e2 SMART
PLEC 1771 1808 7.4e-8 SMART
PLEC 1811 1846 5.8e-1 SMART
PLEC 1847 1884 2.71e1 SMART
PLEC 1886 1922 4.66e0 SMART
low complexity region 2294 2307 N/A INTRINSIC
low complexity region 2366 2381 N/A INTRINSIC
low complexity region 2477 2491 N/A INTRINSIC
low complexity region 2566 2593 N/A INTRINSIC
low complexity region 2661 2675 N/A INTRINSIC
low complexity region 2793 2799 N/A INTRINSIC
low complexity region 2839 2847 N/A INTRINSIC
low complexity region 3046 3057 N/A INTRINSIC
low complexity region 3294 3314 N/A INTRINSIC
SPEC 3321 3427 5.36e-1 SMART
low complexity region 3515 3527 N/A INTRINSIC
low complexity region 3548 3558 N/A INTRINSIC
SPEC 3569 3678 2.19e-1 SMART
internal_repeat_7 3771 3811 5.09e-5 PROSPERO
SPEC 3852 3971 1.75e-9 SMART
SPEC 3978 4084 3.7e-8 SMART
SPEC 4091 4190 4.56e-8 SMART
SPEC 4200 4299 3.78e0 SMART
low complexity region 4372 4388 N/A INTRINSIC
SPEC 4447 4552 1.98e-8 SMART
SPEC 4559 4663 3.62e-11 SMART
SPEC 4673 4773 1.65e-5 SMART
SPEC 4780 4882 7.75e-11 SMART
SPEC 4889 4989 2.3e-4 SMART
SPEC 4999 5098 3.01e0 SMART
SPEC 5105 5208 2.74e-2 SMART
SPEC 5215 5319 2.46e-4 SMART
SPEC 5326 5428 1.27e-15 SMART
SPEC 5435 5537 1.54e-14 SMART
SPEC 5544 5646 8.07e-2 SMART
SPEC 5653 5755 3.67e-12 SMART
SPEC 5762 5863 1.97e-12 SMART
SPEC 5870 5976 4.19e-7 SMART
SPEC 5983 6085 2.06e-15 SMART
SPEC 6092 6195 2.89e-10 SMART
SPEC 6202 6304 2.61e-26 SMART
SPEC 6311 6413 5.31e-18 SMART
SPEC 6420 6522 1.25e-14 SMART
SPEC 6529 6632 9.1e-17 SMART
SPEC 6639 6740 9.3e-23 SMART
SPEC 6747 6849 5.43e-15 SMART
SPEC 6859 6989 1.5e-8 SMART
EFh 7023 7051 4.12e-3 SMART
EFh 7059 7087 1.25e-2 SMART
GAS2 7098 7176 3.08e-51 SMART
low complexity region 7224 7242 N/A INTRINSIC
low complexity region 7252 7264 N/A INTRINSIC
low complexity region 7313 7336 N/A INTRINSIC
PDB:3GJO|H 7364 7393 9e-10 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000095393
Gene: ENSMUSG00000026131

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 6e-43 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 2e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 2e-62 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
SPEC 1555 1664 2.19e-1 SMART
internal_repeat_6 1757 1797 1.18e-5 PROSPERO
SPEC 1838 1957 1.75e-9 SMART
SPEC 1964 2070 3.7e-8 SMART
SPEC 2077 2176 4.56e-8 SMART
SPEC 2186 2285 3.78e0 SMART
low complexity region 2358 2374 N/A INTRINSIC
SPEC 2433 2538 1.98e-8 SMART
SPEC 2545 2649 3.62e-11 SMART
SPEC 2659 2759 1.65e-5 SMART
SPEC 2766 2868 7.75e-11 SMART
SPEC 2875 2975 2.3e-4 SMART
SPEC 2985 3084 3.01e0 SMART
SPEC 3091 3194 2.74e-2 SMART
SPEC 3201 3305 2.46e-4 SMART
SPEC 3312 3414 1.27e-15 SMART
SPEC 3421 3523 1.54e-14 SMART
SPEC 3530 3632 8.07e-2 SMART
SPEC 3639 3741 3.67e-12 SMART
SPEC 3748 3849 1.97e-12 SMART
SPEC 3856 3962 4.19e-7 SMART
SPEC 3969 4071 2.06e-15 SMART
SPEC 4078 4181 2.89e-10 SMART
SPEC 4188 4290 2.61e-26 SMART
SPEC 4297 4399 5.31e-18 SMART
SPEC 4406 4508 1.25e-14 SMART
SPEC 4515 4618 9.1e-17 SMART
SPEC 4625 4726 9.3e-23 SMART
SPEC 4733 4835 5.43e-15 SMART
SPEC 4845 4975 1.5e-8 SMART
EFh 5009 5037 4.12e-3 SMART
EFh 5045 5073 1.25e-2 SMART
GAS2 5084 5162 3.08e-51 SMART
low complexity region 5210 5228 N/A INTRINSIC
low complexity region 5238 5250 N/A INTRINSIC
low complexity region 5299 5322 N/A INTRINSIC
PDB:3GJO|H 5350 5379 1e-9 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000110756
Gene: ENSMUSG00000026131

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 1e-42 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 4e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 6e-63 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
PLEC 1537 1581 9.05e-3 SMART
PLEC 1582 1619 2.7e0 SMART
PLEC 1657 1694 2.23e0 SMART
PLEC 1695 1732 4.25e1 SMART
PLEC 1735 1770 1.39e2 SMART
PLEC 1771 1808 7.4e-8 SMART
PLEC 1811 1846 5.8e-1 SMART
PLEC 1847 1884 2.71e1 SMART
PLEC 1886 1922 4.66e0 SMART
low complexity region 2294 2307 N/A INTRINSIC
low complexity region 2366 2381 N/A INTRINSIC
low complexity region 2477 2491 N/A INTRINSIC
low complexity region 2566 2593 N/A INTRINSIC
low complexity region 2661 2675 N/A INTRINSIC
low complexity region 2793 2799 N/A INTRINSIC
low complexity region 2839 2847 N/A INTRINSIC
low complexity region 3046 3057 N/A INTRINSIC
low complexity region 3294 3314 N/A INTRINSIC
SPEC 3321 3427 5.36e-1 SMART
low complexity region 3515 3527 N/A INTRINSIC
low complexity region 3548 3558 N/A INTRINSIC
SPEC 3569 3678 2.19e-1 SMART
internal_repeat_7 3771 3811 5.08e-5 PROSPERO
SPEC 3852 3971 1.75e-9 SMART
SPEC 3978 4084 3.7e-8 SMART
SPEC 4091 4190 4.56e-8 SMART
SPEC 4200 4299 3.78e0 SMART
low complexity region 4372 4388 N/A INTRINSIC
SPEC 4447 4552 1.98e-8 SMART
SPEC 4559 4663 3.62e-11 SMART
SPEC 4673 4773 1.65e-5 SMART
SPEC 4780 4882 7.75e-11 SMART
SPEC 4889 4989 2.3e-4 SMART
SPEC 4999 5098 3.01e0 SMART
SPEC 5105 5208 2.74e-2 SMART
SPEC 5215 5319 2.46e-4 SMART
SPEC 5326 5428 1.27e-15 SMART
SPEC 5435 5537 1.54e-14 SMART
SPEC 5544 5646 8.07e-2 SMART
SPEC 5653 5755 3.67e-12 SMART
SPEC 5762 5863 1.97e-12 SMART
SPEC 5870 5976 4.19e-7 SMART
SPEC 5983 6085 2.06e-15 SMART
SPEC 6092 6195 2.89e-10 SMART
SPEC 6202 6304 2.61e-26 SMART
SPEC 6311 6413 5.31e-18 SMART
SPEC 6420 6522 1.25e-14 SMART
SPEC 6529 6632 9.1e-17 SMART
SPEC 6639 6740 9.3e-23 SMART
SPEC 6747 6849 5.43e-15 SMART
SPEC 6859 6989 1.5e-8 SMART
EFh 7023 7051 4.12e-3 SMART
EFh 7059 7087 1.25e-2 SMART
GAS2 7098 7176 3.85e-52 SMART
low complexity region 7200 7218 N/A INTRINSIC
low complexity region 7228 7240 N/A INTRINSIC
low complexity region 7326 7349 N/A INTRINSIC
PDB:3GJO|H 7377 7406 9e-10 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000110756
Gene: ENSMUSG00000026131

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 1e-42 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 4e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 6e-63 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
PLEC 1537 1581 9.05e-3 SMART
PLEC 1582 1619 2.7e0 SMART
PLEC 1657 1694 2.23e0 SMART
PLEC 1695 1732 4.25e1 SMART
PLEC 1735 1770 1.39e2 SMART
PLEC 1771 1808 7.4e-8 SMART
PLEC 1811 1846 5.8e-1 SMART
PLEC 1847 1884 2.71e1 SMART
PLEC 1886 1922 4.66e0 SMART
low complexity region 2294 2307 N/A INTRINSIC
low complexity region 2366 2381 N/A INTRINSIC
low complexity region 2477 2491 N/A INTRINSIC
low complexity region 2566 2593 N/A INTRINSIC
low complexity region 2661 2675 N/A INTRINSIC
low complexity region 2793 2799 N/A INTRINSIC
low complexity region 2839 2847 N/A INTRINSIC
low complexity region 3046 3057 N/A INTRINSIC
low complexity region 3294 3314 N/A INTRINSIC
SPEC 3321 3427 5.36e-1 SMART
low complexity region 3515 3527 N/A INTRINSIC
low complexity region 3548 3558 N/A INTRINSIC
SPEC 3569 3678 2.19e-1 SMART
internal_repeat_7 3771 3811 5.08e-5 PROSPERO
SPEC 3852 3971 1.75e-9 SMART
SPEC 3978 4084 3.7e-8 SMART
SPEC 4091 4190 4.56e-8 SMART
SPEC 4200 4299 3.78e0 SMART
low complexity region 4372 4388 N/A INTRINSIC
SPEC 4447 4552 1.98e-8 SMART
SPEC 4559 4663 3.62e-11 SMART
SPEC 4673 4773 1.65e-5 SMART
SPEC 4780 4882 7.75e-11 SMART
SPEC 4889 4989 2.3e-4 SMART
SPEC 4999 5098 3.01e0 SMART
SPEC 5105 5208 2.74e-2 SMART
SPEC 5215 5319 2.46e-4 SMART
SPEC 5326 5428 1.27e-15 SMART
SPEC 5435 5537 1.54e-14 SMART
SPEC 5544 5646 8.07e-2 SMART
SPEC 5653 5755 3.67e-12 SMART
SPEC 5762 5863 1.97e-12 SMART
SPEC 5870 5976 4.19e-7 SMART
SPEC 5983 6085 2.06e-15 SMART
SPEC 6092 6195 2.89e-10 SMART
SPEC 6202 6304 2.61e-26 SMART
SPEC 6311 6413 5.31e-18 SMART
SPEC 6420 6522 1.25e-14 SMART
SPEC 6529 6632 9.1e-17 SMART
SPEC 6639 6740 9.3e-23 SMART
SPEC 6747 6849 5.43e-15 SMART
SPEC 6859 6989 1.5e-8 SMART
EFh 7023 7051 4.12e-3 SMART
EFh 7059 7087 1.25e-2 SMART
GAS2 7098 7176 3.85e-52 SMART
low complexity region 7200 7218 N/A INTRINSIC
low complexity region 7228 7240 N/A INTRINSIC
low complexity region 7326 7349 N/A INTRINSIC
PDB:3GJO|H 7377 7406 9e-10 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000138308
Gene: ENSMUSG00000026131

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
low complexity region 149 163 N/A INTRINSIC
CH 215 314 1.62e-28 SMART
CH 331 428 3.72e-19 SMART
PDB:2ODU|A 439 657 1e-42 PDB
low complexity region 698 723 N/A INTRINSIC
SPEC 780 877 8.64e-9 SMART
SPEC 880 980 2.94e-11 SMART
Blast:SPEC 987 1151 5e-73 BLAST
coiled coil region 1273 1310 N/A INTRINSIC
Blast:SPEC 1354 1463 8e-63 BLAST
SPEC 1470 1599 4.11e0 SMART
SPEC 1617 1716 4.66e0 SMART
PLEC 1715 1759 9.05e-3 SMART
PLEC 1760 1797 2.7e0 SMART
PLEC 1835 1872 2.23e0 SMART
PLEC 1873 1910 4.25e1 SMART
PLEC 1913 1948 1.39e2 SMART
PLEC 1949 1986 7.4e-8 SMART
PLEC 1989 2024 5.8e-1 SMART
PLEC 2025 2062 2.71e1 SMART
PLEC 2064 2100 4.66e0 SMART
low complexity region 2472 2485 N/A INTRINSIC
low complexity region 2544 2559 N/A INTRINSIC
low complexity region 2655 2669 N/A INTRINSIC
low complexity region 2744 2771 N/A INTRINSIC
low complexity region 2839 2853 N/A INTRINSIC
low complexity region 2971 2977 N/A INTRINSIC
low complexity region 3017 3025 N/A INTRINSIC
low complexity region 3224 3235 N/A INTRINSIC
low complexity region 3472 3492 N/A INTRINSIC
SPEC 3499 3605 5.36e-1 SMART
low complexity region 3693 3705 N/A INTRINSIC
low complexity region 3726 3736 N/A INTRINSIC
SPEC 3747 3856 2.19e-1 SMART
internal_repeat_12 3949 3989 5.99e-5 PROSPERO
SPEC 4030 4149 1.75e-9 SMART
SPEC 4156 4262 3.7e-8 SMART
SPEC 4269 4368 4.56e-8 SMART
SPEC 4378 4477 3.78e0 SMART
low complexity region 4550 4566 N/A INTRINSIC
SPEC 4625 4730 1.98e-8 SMART
SPEC 4737 4841 3.62e-11 SMART
SPEC 4851 4951 1.65e-5 SMART
SPEC 4958 5060 7.75e-11 SMART
SPEC 5067 5167 2.3e-4 SMART
SPEC 5177 5276 3.01e0 SMART
SPEC 5283 5386 2.74e-2 SMART
SPEC 5393 5497 2.46e-4 SMART
SPEC 5504 5606 1.27e-15 SMART
SPEC 5613 5715 1.69e-11 SMART
SPEC 5722 5824 9.33e-5 SMART
SPEC 5831 5933 8.07e-2 SMART
SPEC 5940 6042 3.67e-12 SMART
SPEC 6049 6150 1.97e-12 SMART
SPEC 6157 6263 4.19e-7 SMART
SPEC 6270 6372 2.06e-15 SMART
SPEC 6379 6482 2.89e-10 SMART
SPEC 6489 6591 2.61e-26 SMART
SPEC 6598 6700 5.31e-18 SMART
SPEC 6707 6809 1.25e-14 SMART
SPEC 6816 6919 9.1e-17 SMART
SPEC 6926 7027 9.3e-23 SMART
SPEC 7034 7136 5.43e-15 SMART
SPEC 7146 7276 1.5e-8 SMART
EFh 7310 7338 4.12e-3 SMART
EFh 7346 7374 1.25e-2 SMART
GAS2 7385 7463 3.08e-51 SMART
low complexity region 7511 7529 N/A INTRINSIC
low complexity region 7539 7551 N/A INTRINSIC
low complexity region 7637 7660 N/A INTRINSIC
PDB:3GJO|H 7688 7717 9e-10 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000141127
Gene: ENSMUSG00000026131

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
PDB:2ODU|A 56 153 6e-8 PDB
low complexity region 194 219 N/A INTRINSIC
SPEC 276 373 5.4e-11 SMART
SPEC 376 476 1.8e-13 SMART
Blast:SPEC 483 647 1e-73 BLAST
coiled coil region 769 806 N/A INTRINSIC
Blast:SPEC 850 959 1e-62 BLAST
SPEC 966 1095 2.6e-2 SMART
SPEC 1113 1212 2.9e-2 SMART
SPEC 1229 1338 1.4e-3 SMART
internal_repeat_10 1431 1471 9.93e-6 PROSPERO
SPEC 1512 1631 1.1e-11 SMART
SPEC 1638 1744 2.3e-10 SMART
SPEC 1751 1850 2.9e-10 SMART
SPEC 1860 1959 2.4e-2 SMART
low complexity region 2032 2048 N/A INTRINSIC
SPEC 2107 2212 1.2e-10 SMART
SPEC 2219 2323 2.3e-13 SMART
SPEC 2333 2433 1.1e-7 SMART
SPEC 2440 2542 5e-13 SMART
SPEC 2549 2649 1.4e-6 SMART
SPEC 2659 2758 1.9e-2 SMART
SPEC 2765 2868 1.8e-4 SMART
SPEC 2875 2979 1.5e-6 SMART
SPEC 2986 3088 8.2e-18 SMART
SPEC 3095 3197 1.1e-13 SMART
SPEC 3204 3306 6e-7 SMART
SPEC 3313 3415 5.1e-4 SMART
SPEC 3422 3524 2.3e-14 SMART
SPEC 3531 3632 1.3e-14 SMART
SPEC 3639 3745 2.6e-9 SMART
SPEC 3752 3854 1.3e-17 SMART
SPEC 3861 3964 1.8e-12 SMART
SPEC 3971 4073 1.6e-28 SMART
SPEC 4080 4182 3.3e-20 SMART
SPEC 4189 4291 7.6e-17 SMART
SPEC 4298 4401 5.6e-19 SMART
SPEC 4408 4509 5.9e-25 SMART
SPEC 4516 4618 3.4e-17 SMART
SPEC 4628 4758 9.7e-11 SMART
EFh 4792 4820 2e-5 SMART
EFh 4828 4856 6e-5 SMART
GAS2 4867 4945 9.8e-56 SMART
low complexity region 4969 4987 N/A INTRINSIC
low complexity region 4997 5009 N/A INTRINSIC
low complexity region 5095 5118 N/A INTRINSIC
PDB:3GJO|H 5146 5175 3e-9 PDB
Predicted Effect probably null
Meta Mutation Damage Score 0.9755 question?
Is this an essential gene? Possibly nonessential (E-score: 0.342) question?
Phenotypic Category Unknown
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(297) : Chemically induced (ENU)(3) Chemically induced (other)(1) Gene trapped(274) Spontaneous(15) Targeted(3) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Dst APN 1 34290920 missense probably damaging 1.00
IGL00309:Dst APN 1 34199733 missense probably damaging 1.00
IGL00334:Dst APN 1 34205373 missense probably damaging 1.00
IGL00470:Dst APN 1 34228043 missense probably damaging 1.00
IGL00481:Dst APN 1 34208410 splice site probably benign
IGL00499:Dst APN 1 34329504 missense probably damaging 0.99
IGL00803:Dst APN 1 34203205 missense possibly damaging 0.89
IGL00850:Dst APN 1 34345705 missense probably damaging 1.00
IGL00957:Dst APN 1 34267488 missense probably benign 0.27
IGL00975:Dst APN 1 34227393 missense possibly damaging 0.86
IGL00984:Dst APN 1 34295401 missense probably damaging 1.00
IGL01284:Dst APN 1 34203009 missense probably damaging 1.00
IGL01393:Dst APN 1 34206706 missense possibly damaging 0.91
IGL01397:Dst APN 1 34296825 missense probably damaging 1.00
IGL01399:Dst APN 1 34156598 missense probably benign 0.41
IGL01412:Dst APN 1 34281701 missense probably benign 0.21
IGL01527:Dst APN 1 34286734 missense probably damaging 1.00
IGL01537:Dst APN 1 34314401 missense probably damaging 1.00
IGL01618:Dst APN 1 34227990 nonsense probably null
IGL01636:Dst APN 1 34254650 missense probably damaging 1.00
IGL01642:Dst APN 1 34228470 missense probably damaging 1.00
IGL01672:Dst APN 1 34264774 missense probably damaging 1.00
IGL01685:Dst APN 1 34209533 missense probably damaging 0.99
IGL01694:Dst APN 1 34227241 missense probably benign 0.13
IGL01777:Dst APN 1 34238478 missense probably benign 0.07
IGL01800:Dst APN 1 34301173 missense probably damaging 1.00
IGL01811:Dst APN 1 34203173 missense probably damaging 1.00
IGL01960:Dst APN 1 34329570 missense probably damaging 1.00
IGL02031:Dst APN 1 34228998 missense possibly damaging 0.95
IGL02103:Dst APN 1 34229199 missense possibly damaging 0.90
IGL02121:Dst APN 1 34267738 missense probably damaging 1.00
IGL02315:Dst APN 1 34237746 missense probably damaging 1.00
IGL02317:Dst APN 1 34334244 missense probably damaging 1.00
IGL02469:Dst APN 1 34227909 missense probably damaging 1.00
IGL02492:Dst APN 1 34191274 splice site probably benign
IGL02510:Dst APN 1 34268332 splice site probably null
IGL02522:Dst APN 1 34289781 splice site probably benign
IGL02540:Dst APN 1 34174285 missense probably damaging 1.00
IGL02588:Dst APN 1 34156565 missense probably damaging 1.00
IGL02676:Dst APN 1 34346668 missense probably damaging 1.00
IGL02688:Dst APN 1 34235033 missense probably damaging 1.00
IGL02700:Dst APN 1 34301201 missense probably damaging 1.00
IGL02794:Dst APN 1 34309910 missense probably damaging 1.00
IGL02823:Dst APN 1 34231164 missense possibly damaging 0.83
IGL02935:Dst APN 1 34225926 nonsense probably null
IGL02940:Dst APN 1 34328668 missense probably benign 0.36
IGL02994:Dst APN 1 34268333 splice site probably benign
IGL02996:Dst APN 1 34227479 missense possibly damaging 0.93
IGL02998:Dst APN 1 34307356 missense probably damaging 1.00
IGL03027:Dst APN 1 34225106 missense possibly damaging 0.51
IGL03033:Dst APN 1 34208826 splice site probably benign
IGL03099:Dst APN 1 34314862 missense probably damaging 1.00
IGL03119:Dst APN 1 34200143 missense probably damaging 1.00
IGL03121:Dst APN 1 34256884 splice site probably benign
IGL03132:Dst APN 1 34295722 missense probably benign 0.06
IGL03220:Dst APN 1 34225076 missense probably damaging 0.99
IGL03230:Dst APN 1 34223133 nonsense probably null
IGL03245:Dst APN 1 34250229 splice site probably null
IGL03380:Dst APN 1 34296881 missense probably damaging 1.00
Doodle UTSW 1 34247639 nonsense probably null
dyssed UTSW 1 34295434 critical splice donor site probably null
gobble UTSW 1 34204236 critical splice donor site probably null
tinsel UTSW 1 34203248 missense probably damaging 1.00
Wastable UTSW 1 34334370 missense probably damaging 1.00
E0370:Dst UTSW 1 34288552 splice site probably benign
FR4304:Dst UTSW 1 34240045 missense probably damaging 0.99
G1citation:Dst UTSW 1 34314755 missense probably damaging 0.99
IGL02799:Dst UTSW 1 34218930 missense possibly damaging 0.92
R0006:Dst UTSW 1 34267999 missense probably benign 0.30
R0006:Dst UTSW 1 34267999 missense probably benign 0.30
R0023:Dst UTSW 1 34228200 missense probably damaging 1.00
R0023:Dst UTSW 1 34228200 missense probably damaging 1.00
R0024:Dst UTSW 1 34228200 missense probably damaging 1.00
R0027:Dst UTSW 1 34228200 missense probably damaging 1.00
R0049:Dst UTSW 1 34314862 missense probably damaging 1.00
R0053:Dst UTSW 1 34333631 splice site probably null
R0053:Dst UTSW 1 34333631 splice site probably null
R0058:Dst UTSW 1 34045305 missense possibly damaging 0.93
R0066:Dst UTSW 1 34228634 missense possibly damaging 0.67
R0066:Dst UTSW 1 34228634 missense possibly damaging 0.67
R0085:Dst UTSW 1 34268268 missense probably damaging 1.00
R0125:Dst UTSW 1 34309984 missense probably damaging 1.00
R0152:Dst UTSW 1 34228200 missense probably damaging 1.00
R0165:Dst UTSW 1 34193727 splice site probably benign
R0172:Dst UTSW 1 34309935 missense probably damaging 1.00
R0207:Dst UTSW 1 34226016 missense probably benign 0.02
R0219:Dst UTSW 1 34342559 missense probably damaging 0.99
R0349:Dst UTSW 1 34238634 missense probably benign 0.12
R0386:Dst UTSW 1 34256917 missense probably damaging 1.00
R0389:Dst UTSW 1 34333631 splice site probably null
R0395:Dst UTSW 1 34228200 missense probably damaging 1.00
R0423:Dst UTSW 1 34317116 missense possibly damaging 0.95
R0443:Dst UTSW 1 34333631 splice site probably null
R0472:Dst UTSW 1 34306041 critical splice donor site probably null
R0490:Dst UTSW 1 34346449 nonsense probably null
R0513:Dst UTSW 1 34258612 splice site probably benign
R0539:Dst UTSW 1 34228200 missense probably damaging 1.00
R0562:Dst UTSW 1 34267062 missense probably damaging 1.00
R0569:Dst UTSW 1 34332508 missense probably damaging 1.00
R0600:Dst UTSW 1 34228200 missense probably damaging 1.00
R0608:Dst UTSW 1 34329437 splice site probably null
R0609:Dst UTSW 1 34306041 critical splice donor site probably null
R0630:Dst UTSW 1 34238554 missense probably damaging 0.98
R0630:Dst UTSW 1 34232531 missense probably benign 0.05
R0632:Dst UTSW 1 34310494 missense probably damaging 1.00
R0713:Dst UTSW 1 34228200 missense probably damaging 1.00
R0724:Dst UTSW 1 34227758 missense probably benign 0.00
R0761:Dst UTSW 1 34221848 missense probably benign 0.33
R0801:Dst UTSW 1 34209470 missense probably damaging 0.99
R0829:Dst UTSW 1 34202301 missense probably damaging 1.00
R0939:Dst UTSW 1 34283464 missense probably damaging 1.00
R0945:Dst UTSW 1 34310500 missense probably damaging 1.00
R0992:Dst UTSW 1 34238617 missense probably damaging 0.97
R1018:Dst UTSW 1 34233174 missense probably damaging 1.00
R1077:Dst UTSW 1 34203248 missense probably damaging 1.00
R1079:Dst UTSW 1 34225944 missense possibly damaging 0.86
R1127:Dst UTSW 1 34314358 missense probably damaging 1.00
R1129:Dst UTSW 1 34238635 missense probably benign 0.28
R1141:Dst UTSW 1 34227777 missense possibly damaging 0.85
R1167:Dst UTSW 1 34262939 missense probably damaging 1.00
R1195:Dst UTSW 1 34250235 missense probably damaging 1.00
R1195:Dst UTSW 1 34250235 missense probably damaging 1.00
R1195:Dst UTSW 1 34250235 missense probably damaging 1.00
R1333:Dst UTSW 1 34267428 missense probably damaging 1.00
R1352:Dst UTSW 1 34268329 critical splice donor site probably null
R1365:Dst UTSW 1 34227275 missense probably benign 0.02
R1382:Dst UTSW 1 34307914 missense probably damaging 0.99
R1389:Dst UTSW 1 34250313 missense probably damaging 1.00
R1394:Dst UTSW 1 34204236 critical splice donor site probably null
R1395:Dst UTSW 1 34204236 critical splice donor site probably null
R1435:Dst UTSW 1 34153026 missense probably damaging 1.00
R1450:Dst UTSW 1 34251340 missense probably damaging 0.99
R1450:Dst UTSW 1 34227476 missense probably damaging 1.00
R1453:Dst UTSW 1 34228527 missense possibly damaging 0.85
R1479:Dst UTSW 1 34303596 splice site probably null
R1483:Dst UTSW 1 34292079 missense probably damaging 1.00
R1491:Dst UTSW 1 34193675 missense probably damaging 0.99
R1536:Dst UTSW 1 34299453 splice site probably benign
R1551:Dst UTSW 1 34231293 missense probably benign 0.01
R1573:Dst UTSW 1 34240312 missense probably damaging 1.00
R1614:Dst UTSW 1 34314344 missense probably damaging 1.00
R1615:Dst UTSW 1 34238452 missense probably damaging 1.00
R1645:Dst UTSW 1 34264803 missense probably damaging 1.00
R1655:Dst UTSW 1 34321657 nonsense probably null
R1663:Dst UTSW 1 34202466 missense probably damaging 1.00
R1674:Dst UTSW 1 34262876 splice site probably null
R1702:Dst UTSW 1 34206421 missense probably damaging 1.00
R1707:Dst UTSW 1 34206727 missense probably damaging 1.00
R1747:Dst UTSW 1 34199790 missense probably damaging 1.00
R1760:Dst UTSW 1 34267684 missense probably damaging 1.00
R1773:Dst UTSW 1 34330980 missense probably damaging 0.99
R1793:Dst UTSW 1 34191552 nonsense probably null
R1842:Dst UTSW 1 34203200 missense probably null 0.98
R1869:Dst UTSW 1 34291913 missense probably damaging 0.99
R1879:Dst UTSW 1 34227924 missense probably benign 0.15
R1883:Dst UTSW 1 34228389 missense possibly damaging 0.74
R1912:Dst UTSW 1 34330931 missense probably damaging 1.00
R1920:Dst UTSW 1 34200110 missense probably damaging 0.99
R1921:Dst UTSW 1 34200110 missense probably damaging 0.99
R1943:Dst UTSW 1 34267450 missense possibly damaging 0.67
R1958:Dst UTSW 1 34202802 missense probably damaging 1.00
R1962:Dst UTSW 1 34230097 missense possibly damaging 0.47
R1991:Dst UTSW 1 34229339 missense probably benign 0.11
R1998:Dst UTSW 1 34295428 missense probably damaging 1.00
R2001:Dst UTSW 1 34223144 missense probably damaging 0.97
R2007:Dst UTSW 1 34265093 splice site probably benign
R2021:Dst UTSW 1 34205372 missense possibly damaging 0.70
R2022:Dst UTSW 1 34205372 missense possibly damaging 0.70
R2035:Dst UTSW 1 34310494 missense probably damaging 1.00
R2077:Dst UTSW 1 34250251 missense probably damaging 1.00
R2103:Dst UTSW 1 34229339 missense probably benign 0.11
R2111:Dst UTSW 1 34208259 missense probably damaging 1.00
R2112:Dst UTSW 1 34208259 missense probably damaging 1.00
R2113:Dst UTSW 1 34314317 missense probably damaging 0.97
R2201:Dst UTSW 1 34235002 missense possibly damaging 0.60
R2214:Dst UTSW 1 34310482 missense probably damaging 1.00
R2219:Dst UTSW 1 34209514 missense probably damaging 1.00
R2233:Dst UTSW 1 34313343 missense probably damaging 1.00
R2267:Dst UTSW 1 34334547 missense probably damaging 1.00
R2290:Dst UTSW 1 34268281 missense probably damaging 1.00
R2323:Dst UTSW 1 34267518 missense possibly damaging 0.93
R2424:Dst UTSW 1 34206141 missense probably damaging 1.00
R2426:Dst UTSW 1 34231893 missense probably benign 0.03
R2495:Dst UTSW 1 34238454 missense probably damaging 0.99
R2507:Dst UTSW 1 34227498 missense possibly damaging 0.85
R2507:Dst UTSW 1 34050990 missense probably damaging 0.98
R2510:Dst UTSW 1 34251367 missense probably benign
R2831:Dst UTSW 1 34314373 missense probably damaging 1.00
R2929:Dst UTSW 1 34206143 nonsense probably null
R3033:Dst UTSW 1 34191366 missense probably damaging 0.99
R3121:Dst UTSW 1 34328729 missense probably damaging 1.00
R3424:Dst UTSW 1 34237586 splice site probably benign
R3437:Dst UTSW 1 34229303 missense probably damaging 1.00
R3699:Dst UTSW 1 34252155 splice site probably benign
R3739:Dst UTSW 1 34307975 splice site probably benign
R3796:Dst UTSW 1 34220996 missense probably benign 0.15
R3847:Dst UTSW 1 34251400 missense probably damaging 1.00
R3848:Dst UTSW 1 34251400 missense probably damaging 1.00
R3849:Dst UTSW 1 34251400 missense probably damaging 1.00
R3850:Dst UTSW 1 34228355 nonsense probably null
R3850:Dst UTSW 1 34251400 missense probably damaging 1.00
R3873:Dst UTSW 1 34328701 missense probably damaging 1.00
R3875:Dst UTSW 1 34210328 missense probably damaging 1.00
R3973:Dst UTSW 1 34050979 missense probably benign 0.34
R4014:Dst UTSW 1 34230363 nonsense probably null
R4043:Dst UTSW 1 34229765 missense probably benign 0.03
R4057:Dst UTSW 1 34225135 splice site probably benign
R4074:Dst UTSW 1 34267542 missense probably damaging 0.97
R4074:Dst UTSW 1 34231350 missense probably benign 0.20
R4075:Dst UTSW 1 34231350 missense probably benign 0.20
R4076:Dst UTSW 1 34231350 missense probably benign 0.20
R4206:Dst UTSW 1 34251328 missense probably damaging 1.00
R4230:Dst UTSW 1 34234909 missense probably benign 0.04
R4242:Dst UTSW 1 34045297 missense possibly damaging 0.88
R4273:Dst UTSW 1 34231421 missense possibly damaging 0.72
R4366:Dst UTSW 1 34290959 missense probably damaging 1.00
R4370:Dst UTSW 1 34290809 frame shift probably null
R4379:Dst UTSW 1 34267056 missense probably benign 0.07
R4379:Dst UTSW 1 34202316 missense probably damaging 1.00
R4380:Dst UTSW 1 34202316 missense probably damaging 1.00
R4381:Dst UTSW 1 34202316 missense probably damaging 1.00
R4423:Dst UTSW 1 34227474 missense possibly damaging 0.76
R4427:Dst UTSW 1 34220541 missense probably benign 0.19
R4456:Dst UTSW 1 34229800 missense probably benign 0.06
R4469:Dst UTSW 1 34230923 missense probably benign 0.02
R4502:Dst UTSW 1 34286772 missense probably damaging 0.99
R4503:Dst UTSW 1 34301334 critical splice donor site probably null
R4545:Dst UTSW 1 34227819 missense probably damaging 0.99
R4610:Dst UTSW 1 34208937 missense probably damaging 1.00
R4633:Dst UTSW 1 34209515 missense probably damaging 1.00
R4675:Dst UTSW 1 34314784 missense possibly damaging 0.94
R4687:Dst UTSW 1 34240204 missense probably damaging 1.00
R4739:Dst UTSW 1 34230228 missense probably benign 0.01
R4751:Dst UTSW 1 34230965 missense probably benign 0.21
R4754:Dst UTSW 1 34251390 missense probably damaging 1.00
R4771:Dst UTSW 1 34288565 missense probably damaging 1.00
R4819:Dst UTSW 1 34007916 missense probably benign 0.03
R4830:Dst UTSW 1 34237586 splice site probably null
R4839:Dst UTSW 1 34229943 missense probably damaging 0.96
R4845:Dst UTSW 1 34232208 missense probably benign 0.02
R4904:Dst UTSW 1 34208879 missense probably damaging 0.99
R4932:Dst UTSW 1 34267764 missense possibly damaging 0.47
R4934:Dst UTSW 1 34247669 missense probably damaging 1.00
R4952:Dst UTSW 1 34310503 missense probably damaging 1.00
R4961:Dst UTSW 1 34007904 missense possibly damaging 0.53
R4976:Dst UTSW 1 34235050 nonsense probably null
R4980:Dst UTSW 1 34295369 missense probably damaging 1.00
R5011:Dst UTSW 1 34289728 missense probably damaging 1.00
R5013:Dst UTSW 1 34289728 missense probably damaging 1.00
R5059:Dst UTSW 1 34202427 missense possibly damaging 0.70
R5074:Dst UTSW 1 34334344 missense probably damaging 1.00
R5114:Dst UTSW 1 34241640 missense probably damaging 0.98
R5119:Dst UTSW 1 34235050 nonsense probably null
R5182:Dst UTSW 1 34218167 missense probably benign
R5236:Dst UTSW 1 34203498 missense probably damaging 1.00
R5240:Dst UTSW 1 34247639 nonsense probably null
R5254:Dst UTSW 1 34217012 nonsense probably null
R5275:Dst UTSW 1 34219229 missense probably benign 0.13
R5281:Dst UTSW 1 34296863 missense probably benign 0.29
R5299:Dst UTSW 1 34174173 missense probably damaging 1.00
R5316:Dst UTSW 1 34262929 missense probably damaging 0.97
R5319:Dst UTSW 1 34265058 missense possibly damaging 0.95
R5425:Dst UTSW 1 34218831 missense probably benign 0.00
R5443:Dst UTSW 1 34267620 missense probably damaging 1.00
R5522:Dst UTSW 1 34296954 missense possibly damaging 0.46
R5537:Dst UTSW 1 34228959 missense probably benign 0.25
R5548:Dst UTSW 1 34228409 missense probably benign
R5557:Dst UTSW 1 34321667 missense probably damaging 1.00
R5597:Dst UTSW 1 34231794 missense probably benign 0.07
R5623:Dst UTSW 1 34229214 missense possibly damaging 0.56
R5630:Dst UTSW 1 34227866 frame shift probably null
R5660:Dst UTSW 1 34321574 missense probably damaging 1.00
R5730:Dst UTSW 1 34156607 splice site probably null
R5762:Dst UTSW 1 34218438 missense probably damaging 0.99
R5810:Dst UTSW 1 34222121 intron probably benign
R5816:Dst UTSW 1 34218315 missense probably benign
R5846:Dst UTSW 1 34234942 nonsense probably null
R5874:Dst UTSW 1 34218670 missense probably damaging 0.98
R5899:Dst UTSW 1 34334370 missense probably damaging 1.00
R5923:Dst UTSW 1 34220840 missense probably benign 0.00
R5936:Dst UTSW 1 34346539 missense probably damaging 1.00
R5946:Dst UTSW 1 34213273 missense probably benign 0.01
R5950:Dst UTSW 1 34301141 missense probably damaging 1.00
R5958:Dst UTSW 1 34225131 missense probably damaging 0.97
R5973:Dst UTSW 1 34195938 missense probably damaging 1.00
R5979:Dst UTSW 1 34199453 intron probably benign
R5980:Dst UTSW 1 34221972 missense probably benign 0.34
R5984:Dst UTSW 1 34211344 missense probably benign 0.05
R6000:Dst UTSW 1 34251304 missense possibly damaging 0.92
R6014:Dst UTSW 1 34303915 missense probably damaging 1.00
R6042:Dst UTSW 1 34228053 missense probably damaging 1.00
R6064:Dst UTSW 1 34233132 missense probably damaging 1.00
R6126:Dst UTSW 1 34267264 missense probably damaging 1.00
R6157:Dst UTSW 1 34250253 missense probably damaging 1.00
R6162:Dst UTSW 1 34045318 missense probably damaging 0.99
R6185:Dst UTSW 1 34212161 missense probably damaging 0.99
R6226:Dst UTSW 1 34309955 missense probably damaging 1.00
R6227:Dst UTSW 1 34233621 missense probably benign 0.41
R6232:Dst UTSW 1 34227253 missense probably damaging 1.00
R6259:Dst UTSW 1 34221477 missense probably benign 0.26
R6267:Dst UTSW 1 34267753 missense probably damaging 1.00
R6273:Dst UTSW 1 34314347 missense probably damaging 1.00
R6284:Dst UTSW 1 34268166 missense probably damaging 1.00
R6347:Dst UTSW 1 34218765 splice site probably null
R6365:Dst UTSW 1 34231008 missense probably damaging 1.00
R6385:Dst UTSW 1 34346549 missense possibly damaging 0.85
R6389:Dst UTSW 1 34232265 missense probably damaging 0.99
R6395:Dst UTSW 1 34221771 missense probably benign 0.17
R6416:Dst UTSW 1 34155209 missense probably damaging 1.00
R6467:Dst UTSW 1 34334277 missense probably damaging 1.00
R6470:Dst UTSW 1 34334318 missense probably damaging 1.00
R6477:Dst UTSW 1 34247809 splice site probably null
R6485:Dst UTSW 1 34333610 missense probably damaging 1.00
R6491:Dst UTSW 1 34232093 missense probably benign 0.10
R6525:Dst UTSW 1 34202216 missense probably damaging 1.00
R6533:Dst UTSW 1 34342590 missense probably benign 0.08
R6595:Dst UTSW 1 34289761 missense probably damaging 1.00
R6622:Dst UTSW 1 34218332 missense probably benign 0.22
R6646:Dst UTSW 1 34307888 missense possibly damaging 0.80
R6648:Dst UTSW 1 34301122 missense possibly damaging 0.84
R6700:Dst UTSW 1 34295404 missense probably damaging 1.00
R6743:Dst UTSW 1 34309971 missense probably damaging 1.00
R6761:Dst UTSW 1 34253631 missense probably damaging 1.00
R6766:Dst UTSW 1 34333564 missense probably damaging 1.00
R6768:Dst UTSW 1 34220793 missense probably damaging 0.98
R6810:Dst UTSW 1 34251379 missense probably damaging 1.00
R6815:Dst UTSW 1 34267450 missense possibly damaging 0.67
R6820:Dst UTSW 1 34250337 missense probably damaging 1.00
R6822:Dst UTSW 1 34314755 missense probably damaging 0.99
R6831:Dst UTSW 1 34229765 missense probably benign 0.03
R6874:Dst UTSW 1 34328732 missense probably benign 0.29
R6945:Dst UTSW 1 34229571 missense probably damaging 1.00
R6985:Dst UTSW 1 34229934 missense probably benign 0.08
R6995:Dst UTSW 1 34205315 missense probably damaging 1.00
R7038:Dst UTSW 1 34221879 nonsense probably null
R7043:Dst UTSW 1 34296992 missense probably damaging 0.99
R7070:Dst UTSW 1 34314383 missense probably damaging 1.00
R7097:Dst UTSW 1 34208341 missense probably damaging 1.00
R7139:Dst UTSW 1 34338888 missense probably damaging 0.97
R7144:Dst UTSW 1 34191324 missense probably damaging 1.00
R7145:Dst UTSW 1 34228963 missense probably benign
R7158:Dst UTSW 1 34313366 missense probably benign
R7207:Dst UTSW 1 34202418 missense probably damaging 0.98
R7320:Dst UTSW 1 34230175 missense probably benign
R7324:Dst UTSW 1 34045305 missense possibly damaging 0.93
R7327:Dst UTSW 1 34240486 missense probably damaging 1.00
R7340:Dst UTSW 1 34229810 missense probably benign 0.01
R7358:Dst UTSW 1 34230754 missense probably benign
R7373:Dst UTSW 1 34227472 missense probably benign 0.02
R7376:Dst UTSW 1 34231770 missense probably benign
R7453:Dst UTSW 1 34230439 missense possibly damaging 0.95
R7467:Dst UTSW 1 34230236 missense probably benign 0.00
R7471:Dst UTSW 1 34233651 missense possibly damaging 0.49
R7472:Dst UTSW 1 34257578 missense probably benign 0.02
R7485:Dst UTSW 1 34313270 missense probably benign 0.31
R7504:Dst UTSW 1 34240098 missense probably damaging 1.00
R7516:Dst UTSW 1 34209560 missense probably benign 0.10
R7524:Dst UTSW 1 34330974 missense possibly damaging 0.94
R7528:Dst UTSW 1 34333603 missense probably damaging 1.00
R7560:Dst UTSW 1 34221532 missense possibly damaging 0.92
R7582:Dst UTSW 1 34208964 missense probably damaging 1.00
R7585:Dst UTSW 1 34153096 missense possibly damaging 0.50
R7594:Dst UTSW 1 34252094 missense probably damaging 1.00
R7600:Dst UTSW 1 34306011 missense probably damaging 1.00
R7619:Dst UTSW 1 34238509 missense probably benign 0.02
R7623:Dst UTSW 1 34209517 missense probably damaging 0.99
R7649:Dst UTSW 1 34206778 missense probably benign 0.13
R7654:Dst UTSW 1 34268059 missense probably damaging 1.00
R7654:Dst UTSW 1 34268058 missense probably damaging 1.00
R7661:Dst UTSW 1 34295434 critical splice donor site probably null
R7667:Dst UTSW 1 34218116 missense possibly damaging 0.82
R7677:Dst UTSW 1 34208403 critical splice donor site probably null
R7698:Dst UTSW 1 34229468 missense probably benign 0.02
R7765:Dst UTSW 1 34314775 missense probably damaging 0.97
R7772:Dst UTSW 1 34220469 missense possibly damaging 0.90
R7779:Dst UTSW 1 34233678 missense probably damaging 0.99
R7791:Dst UTSW 1 34193673 missense probably damaging 0.99
R7821:Dst UTSW 1 34314443 critical splice donor site probably null
R7834:Dst UTSW 1 34233186 missense probably benign 0.22
R7935:Dst UTSW 1 34329486 missense probably damaging 1.00
R7940:Dst UTSW 1 34206757 missense possibly damaging 0.94
R7951:Dst UTSW 1 34240267 missense probably benign
R7956:Dst UTSW 1 34264699 missense probably damaging 1.00
R7970:Dst UTSW 1 34221828 missense possibly damaging 0.80
R7982:Dst UTSW 1 34221621 missense possibly damaging 0.89
R8048:Dst UTSW 1 34229717 missense probably benign 0.00
R8052:Dst UTSW 1 34323444 missense probably damaging 1.00
R8094:Dst UTSW 1 34228040 missense possibly damaging 0.76
R8116:Dst UTSW 1 34313261 missense probably benign 0.27
R8127:Dst UTSW 1 34217310 missense probably damaging 1.00
R8139:Dst UTSW 1 34230933 missense probably benign
R8205:Dst UTSW 1 34253685 missense probably damaging 1.00
R8211:Dst UTSW 1 34251532 missense probably damaging 1.00
R8237:Dst UTSW 1 34208874 missense possibly damaging 0.96
R8265:Dst UTSW 1 34217603 missense probably benign 0.13
R8309:Dst UTSW 1 34156592 missense probably damaging 1.00
R8315:Dst UTSW 1 34323501 critical splice donor site probably null
R8469:Dst UTSW 1 34268109 missense probably damaging 1.00
R8474:Dst UTSW 1 34208266 missense probably damaging 1.00
R8502:Dst UTSW 1 34206373 missense probably damaging 1.00
R8534:Dst UTSW 1 34229388 missense probably benign 0.12
R8535:Dst UTSW 1 34225082 missense probably damaging 1.00
R8536:Dst UTSW 1 34236327 missense possibly damaging 0.64
R8542:Dst UTSW 1 34231688 missense possibly damaging 0.61
R8560:Dst UTSW 1 34307970 missense probably damaging 1.00
R8737:Dst UTSW 1 34267750 missense probably benign 0.00
R8742:Dst UTSW 1 34251425 missense probably benign 0.01
R8882:Dst UTSW 1 34240005 missense probably damaging 1.00
R8894:Dst UTSW 1 34213214 missense possibly damaging 0.96
R8973:Dst UTSW 1 34267936 missense probably damaging 1.00
R8977:Dst UTSW 1 34286864 missense probably damaging 0.99
R8985:Dst UTSW 1 34288886 missense probably benign 0.00
R9001:Dst UTSW 1 34213292 missense possibly damaging 0.63
R9005:Dst UTSW 1 34267774 missense probably damaging 0.99
R9013:Dst UTSW 1 34217165 missense possibly damaging 0.46
R9015:Dst UTSW 1 34326337 missense probably benign 0.00
R9018:Dst UTSW 1 34235140 missense probably damaging 0.97
R9023:Dst UTSW 1 34153105 critical splice donor site probably null
R9025:Dst UTSW 1 34227585 missense possibly damaging 0.73
R9052:Dst UTSW 1 34236411 nonsense probably null
R9052:Dst UTSW 1 34206045 missense probably damaging 1.00
R9147:Dst UTSW 1 34228149 missense probably damaging 0.99
R9169:Dst UTSW 1 34303652 missense probably damaging 1.00
R9181:Dst UTSW 1 34231818 missense probably benign
R9224:Dst UTSW 1 34330879 missense probably damaging 1.00
R9245:Dst UTSW 1 34228943 missense probably benign
R9267:Dst UTSW 1 34232145 missense probably benign
R9302:Dst UTSW 1 34264636 missense probably damaging 1.00
R9344:Dst UTSW 1 34220676 missense probably damaging 0.99
R9363:Dst UTSW 1 34235060 missense probably damaging 1.00
R9441:Dst UTSW 1 34238432 missense probably damaging 1.00
R9477:Dst UTSW 1 34205292 missense probably damaging 1.00
R9501:Dst UTSW 1 34227849 missense probably damaging 0.98
R9509:Dst UTSW 1 33947465 missense possibly damaging 0.72
R9572:Dst UTSW 1 34250252 missense probably damaging 1.00
R9598:Dst UTSW 1 34153014 missense possibly damaging 0.79
R9651:Dst UTSW 1 34219458 missense probably benign 0.39
R9652:Dst UTSW 1 34219458 missense probably benign 0.39
R9664:Dst UTSW 1 34220736 missense probably benign 0.33
R9666:Dst UTSW 1 34218947 nonsense probably null
R9707:Dst UTSW 1 34228934 missense probably benign 0.28
R9721:Dst UTSW 1 34231866 missense probably benign
R9727:Dst UTSW 1 34314877 missense probably damaging 1.00
R9781:Dst UTSW 1 34218075 missense probably benign
R9787:Dst UTSW 1 34219524 missense probably benign 0.02
RF014:Dst UTSW 1 34286760 missense probably benign 0.00
X0026:Dst UTSW 1 34252136 missense probably damaging 0.97
X0028:Dst UTSW 1 34231280 missense probably damaging 1.00
X0063:Dst UTSW 1 34234976 missense probably damaging 1.00
X0066:Dst UTSW 1 34314784 nonsense probably null
Z1176:Dst UTSW 1 34283526 missense probably benign 0.02
Z1176:Dst UTSW 1 34227548 nonsense probably null
Z1176:Dst UTSW 1 34204224 missense probably benign 0.00
Z1176:Dst UTSW 1 34314289 missense probably damaging 1.00
Z1177:Dst UTSW 1 34233599 missense probably damaging 0.99
Z1177:Dst UTSW 1 34220313 missense probably benign 0.15
Mode of Inheritance Unknown
Local Stock
MMRRC Submission 038169-MU
Last Updated 2019-10-23 1:57 PM by Anne Murray
Record Created 2014-09-24 2:37 PM by Carlos Reyna
Record Posted 2015-03-03
Phenotypic Description

Figure 1. The phenotype of the phelps mice.

The phelps phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1674, some of which showed an ataxic gait and an inability to walk (Figure 1). 

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 96 mutations. A mutation in Dst was presumed to be causative because the phelps phenotype mirrored those of other Dst alleles (see gobble, tinsel, and MGI). The Dst mutation is a T to A transversion at base pair 34,223,795 (v38) on chromosome 1, or base pair 315,589 in the GenBank genomic region NC_000067 affecting the acceptor splice site of intron 54 in the longest isoform (NM_134448). The effect of the mutation at the cDNA and protein levels have not examined, but the mutation is predicted to result in skipping of the 200-base pair exon 55 (out of 98 total exons) causing a frame-shift, coding of 13 aberrant amino acids followed by a premature stop codon after amino acid 4,546.

             <--exon 54         <--intron 54 exon 55-->      exon 56-->
311304 GCACTGGCAGAGATGG……tcctttttcttgttttcag ACACTAAGTGGCAA……ATTCTGCTGCAAGA……GAAACCTCAGTATGA 
4529   -A--L--A--E--M--……                    D--T--K--W--Q-……D--S--A--A--R-……-E--S--S--V--*  4546
         correct                                 deleted                aberrant

Genomic numbering corresponds to NC_000067. The acceptor splice site of intron 54, which is affected by the phelps mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 2. Dst encodes several DST isoforms. The DST-b1, -a1, and e isoforms are shown. Alternative splicing of the first 5' exons yields three dystonin-a/b isoforms (e.g., DST-a1, DST-a2, and DST-a3 and DST-b1, DST-b2, and DST-b3, respectively). Dystonin-a/b1 contain a unique N-terminal region followed by CH1 and CH2 domains in tandem. Dystonin-a/b2 (not shown) contain a highly conserved N-terminal transmembrane (TM) domain followed by a CH1 and CH2 domain in tandem. Dystonin-a/b3 (not shown) harbor a conserved myristoylation motif (myr) followed by a single CH2 domain. The spectrin domain contains several plectin and spectrin repeats. See the text for more details. The phelps mutation is within intron 54 and is predicted to affect the DST-a and DST-b isoforms only; mutation is shown in the DST-b1 isoform only. Image is interactive; click to view other Dst mutations. Abbreviations: SPEC, spectrin repeat domain; EF, EF hands; CH1/2, calponin homology domains; IFBD, intermediate filament-binding domain, PRD, plakin-repeat domain.

Dst encodes dystonin (DST) [alternatively, bullous pemphigoid antigen 1 (Bpag1), a member of the plakin family of proteins [(1); Figure 2]. DST has an N-terminal plakin domain as well as different combinations of structural domains including an actin-binding domain (ABD), a spectrin-repeat (SR)-containing rod domain, and a microtubule-binding domain (MTBD). Dst encodes three tissue-specific DST isoforms, including a neuronal isoform (DST-a), a muscle isoform (DST-b), and an epithelial isoform (DST-e) [(1-4); reviewed in (5)]. DST-e has the plakin domain, rod domain, and a C-terminal intermediate filament-binding domain/plakin-repeat domain 2 (IFBD/PRD2) only (6). The DST-a and DST-b isoforms share similar domains including the ABD, plakin, and rod domains as well as the EF hand calcium-binding motifs and a growth arrest specific protein 2 (GAS2) related (GAR) domain that contains a MTBD and a Gly-Ser-Arg (GSR) repeat region (2;6). DST-b differs from DST-a in that DST-b has a putative IFBD/PRD2 domain following the plakin domain. Alternative splicing of 5’ exons in Dst results in three tissue-specific isoforms in muscle (i.e., DST-b1/2/3) and neurons (i.e., DST-a1/2/3) [(2;7;8); reviewed in (5)]. Each DST isoform has different domains upstream of the ABD (1;9). The unique N-terminal domains in the DST-a isoforms facilitate cell-specific localization and function (8;10-12). DST-a2/b2 have an N-terminal transmembrane domain upstream of tandem calponin-homology (CH)1/CH2 domains (7). The DST-a1/b1 isoforms lack N-terminal transmembrane domains, but have CH1 and CH2 domains [reviewed in (5)]. The DST-a3/b3 isoforms do not have a transmembrane domain or a CH1 domain, but have a myristoylation motif followed by one CH2 domain [reviewed in (5)]. The phelps mutation affects the SR-containing rod domain and is predicted to result in the loss of the C-terminus of DST including several of the SR domains, the EF hand calcium-binding domain, and the MTBD in the DST-a and DST-b isoforms only.

Please see the record gobble for more information about Dst.

Putative Mechanism

Proteins in the plakin family are scaffold proteins that link intermediate filaments to desmosomes and hemidesmosomes to regulate cytoskeletal dynamics, cell migration, differentiation, and stress responses (8;13). Homozygous mutations in DST that cause loss of DST-a1/2/3 expression have been documented to cause hereditary sensory and autonomic neuropathy type 6 (HSAN6) (14;15). Patients with HSAN6 exhibit limb contractures and dysautonomia; HSAN6 is ultimately fatal (15). A mutation within the MTBD of the DST-a/b isoforms leads to sensory autonomic neuropathy with dysautonomia, severe psychomotor retardation, and early death (14). Collectively, the phenotype of mice with mutations in Dst is referred to as dystonia musculorum (dt) and is characterized by sensory neuron degeneration, ataxia, tremor, muscle weakness, low body weights, and reduced numbers of motor neurons at approximately 2 weeks after birth (16-19). The phenotype of the phelps mice indicates that the mutation results in loss of function in the DST protein(s). The expression and localization of DSTphelps has not been examined.

Primers PCR Primer
Phelps_pcr_F: AGCGACCGGCATCTTATTATGGCG
Phelps_pcr_R: CATGTTTGGGTCAATGGACAAGGGG

Sequencing Primer
Phelps_seq_F: gagatgtagcttagggtcatgc
Phelps_seq_R: GACAAGGGGCCGAGCAC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 486 nucleotides is amplified (chromosome 1, + strand):


1   agcgaccggc atcttattat ggcgggctca tgatctaacg tgtagtccat gtatcatctc
61  acacaagtac ttcttgtaag ttggaattaa taggaagggg ggttaccaga tgtgaacaag
121 ctagagatgt agcttagggt catgcttgcc tagtaccaag gccctaggtt tacattctaa
181 caaagggaac aagaggaatg ccatctatta tgtatcgttt gaatacatag ttacagtttt
241 ctgatggtga tattaaatga agaaaaaaag aaaagaaaac aaatagcagc ttggtccttt
301 ttcttgtttt cagacactaa gtggcaagag ctcaaccagt tgaccatgga caggcaacaa
361 aagctggaag agtcctccaa taatctaacc cagttccaga ccacagaggc ccagttaaaa
421 cagtggctca tggagaagga gctgatggtc agcgtgctcg gccccttgtc cattgaccca
481 aacatg


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsCarlos Reyna Tiana Purrington