Phenotypic Mutation 'nymph'

• Allele: nymph
• Mutation Type: missense
• Chromosome: 15
• Coordinate: 100,933,527 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Scn8a
• Gene Name: sodium channel, voltage-gated, type VIII, alpha
• Synonym(s): nmf335, nmf58, NMF335, C630029C19Rik, nur14, mnd2, seal, mnd-2, nmf2, med, ataxia 3, NaCh6, Nav1.6, motor end-plate disease
• Chromosomal Location: 100,767,739-100,943,819 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium channel alpha subunit gene family. The encoded protein forms the ion pore region of the voltage-gated sodium channel. This protein is essential for the rapid membrane depolarization that occurs during the formation of the action potential in excitable neurons. Mutations in this gene are associated with mental retardation, pancerebellar atrophy and ataxia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010] ; PHENOTYPE: Spontaneous mutant homozygotes have ataxia, dystonia, muscular atrophy, progressive paralysis, Purkinje cell loss, in some cases severe head-tossing and for severe alleles, juvenile lethality. A mild, semidominant ENU allele causes deafness of variable penetrance and severity and mild tremor. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000080842] [ENSMUSP00000104536] [ENSMUSP00000104537] [ENSMUSP00000104538] [ENSMUSP00000144371] [ENSMUSP00000144013]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000080842; Gene: ENSMUSG00000023033; AA Change: Y1577C

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	131	422	7.4e-82	PFAM
low complexity region	423	452	N/A	INTRINSIC
Pfam:Na_trans_cytopl	499	700	3.5e-72	PFAM
low complexity region	701	712	N/A	INTRINSIC
Pfam:Ion_trans	750	985	2.2e-57	PFAM
Pfam:Na_trans_assoc	989	1191	2e-59	PFAM
Pfam:Ion_trans	1195	1472	6.2e-69	PFAM
Pfam:Ion_trans	1519	1775	1.2e-56	PFAM
IQ	1892	1914	1.2e-4	SMART
low complexity region	1953	1972	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000082209)
• SMART Domains: Protein: ENSMUSP00000104536; Gene: ENSMUSG00000023033; AA Change: Y1577C

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	72	322	1.9e-76	PFAM
low complexity region	367	378	N/A	INTRINSIC
Pfam:Ion_trans	451	640	1.1e-47	PFAM
Pfam:Na_trans_assoc	655	872	1.9e-71	PFAM
Pfam:Ion_trans	898	1127	4.4e-59	PFAM
PDB:1BYY|A	1129	1181	7e-30	PDB
Pfam:Ion_trans	1220	1429	1.9e-51	PFAM
Pfam:PKD_channel	1281	1436	5.6e-7	PFAM
IQ	1558	1580	1.2e-4	SMART
low complexity region	1619	1638	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000108908)
• SMART Domains: Protein: ENSMUSP00000104537; Gene: ENSMUSG00000023033; AA Change: Y1587C

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	72	322	2.2e-76	PFAM
low complexity region	335	364	N/A	INTRINSIC
Pfam:DUF3451	390	616	8.7e-70	PFAM
Pfam:Ion_trans	697	886	1.3e-47	PFAM
Pfam:Na_trans_assoc	901	1118	2.3e-71	PFAM
Pfam:Ion_trans	1144	1186	9.7e-10	PFAM
Pfam:Ion_trans	1182	1332	1.7e-31	PFAM
PDB:1BYY|A	1334	1386	2e-29	PDB
Pfam:Ion_trans	1425	1634	2.3e-51	PFAM
Pfam:PKD_channel	1486	1641	6.6e-7	PFAM
IQ	1763	1785	1.2e-4	SMART
low complexity region	1824	1843	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000108909)
• SMART Domains: Protein: ENSMUSP00000104538; Gene: ENSMUSG00000023033; AA Change: Y1577C

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	160	410	2.5e-76	PFAM
low complexity region	423	452	N/A	INTRINSIC
Pfam:DUF3451	478	704	9.6e-70	PFAM
Pfam:Ion_trans	785	974	1.4e-47	PFAM
Pfam:Na_trans_assoc	989	1206	2.5e-71	PFAM
Pfam:Ion_trans	1232	1461	5.7e-59	PFAM
PDB:1BYY|A	1463	1515	4e-29	PDB
Pfam:Ion_trans	1554	1763	2.5e-51	PFAM
Pfam:PKD_channel	1615	1770	7.1e-7	PFAM
IQ	1892	1914	1.2e-4	SMART
low complexity region	1953	1972	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000108910)
• SMART Domains: Protein: ENSMUSP00000144371; Gene: ENSMUSG00000023033; AA Change: Y1536C

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	131	422	4.1e-80	PFAM
low complexity region	423	452	N/A	INTRINSIC
Pfam:Na_trans_cytopl	499	700	2.5e-69	PFAM
low complexity region	701	712	N/A	INTRINSIC
Pfam:Ion_trans	750	985	1.2e-55	PFAM
Pfam:Na_trans_assoc	989	1191	9.1e-57	PFAM
Pfam:Ion_trans	1195	1274	7.6e-16	PFAM
Pfam:Ion_trans	1270	1431	2.6e-33	PFAM
Pfam:Ion_trans	1478	1734	6.5e-55	PFAM
IQ	1851	1873	6e-7	SMART
low complexity region	1912	1931	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000200963)
• SMART Domains: Protein: ENSMUSP00000144013; Gene: ENSMUSG00000023033; AA Change: Y1577C

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	131	422	7.4e-82	PFAM
low complexity region	423	452	N/A	INTRINSIC
Pfam:Na_trans_cytopl	499	700	3.5e-72	PFAM
low complexity region	701	712	N/A	INTRINSIC
Pfam:Ion_trans	750	985	2.2e-57	PFAM
Pfam:Na_trans_assoc	989	1191	2e-59	PFAM
Pfam:Ion_trans	1195	1472	6.2e-69	PFAM
Pfam:Ion_trans	1519	1775	1.2e-56	PFAM
IQ	1892	1914	1.2e-4	SMART
low complexity region	1953	1972	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000201549)
• Meta Mutation Damage Score: 0.8854
• Is this an essential gene?: Probably essential (E-score: 0.790)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm
• MMRRC Submission: 038248-MU
• Last Updated: 2019-09-04 9:48 PM by Anne Murray
• Record Created: 2014-10-03 8:43 AM by Jeff SoRelle
• Record Posted: 2014-12-12
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Jeff SoRelle, Zhe Chen, William McAlpine, Noelle Hutchins

Accession Number

NCBI RefSeq: NM_001077499, NM_011323; MGI:103169

Alleles Listed at MGI

All mutations/alleles(25) : Chemically induced (ENU)(9) Endonuclease-mediated(1) Gene trapped(3) Radiation induced(1) Spontaneous(6) Targeted(4) Transgenic(1)

Phenotypic Description

Figure 1. Nymph mice exhibited decreased body weights. Scaled weight data are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Video of the nymph neurological phenotype.

The nymph phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0967, some of which exhibited decreased body weights when compensating for age and sex (Figure 1). These mice also had a mild tremor and an ataxic gait (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the reduced body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 40 mutations (X-axis) identified in the G1 male of pedigree R0967. Scaled weight phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 40 mutations. The decreased body weight was linked to a mutation in Scn8a: an A to G transition at base pair 101,035,646 (v38) on chromosome 15, or base pair 165,824 in the GenBank genomic region NC_000081.  Linkage was found with a recessive model of inheritance, wherein 4 homozygous variant mice departed phenotypically from 14 homozygous reference mice and 15 heterozygous mice with a P value of 1.051 x 10^-5 (Figure 3). The mutation corresponds to residue 4,883 in the mRNA sequence NM_001077499 within exon 26 of 27 total exons. 

4867 TTTGCCTTGAGACACTACTATTTCACCATTGGC

1572 -F--A--L--R--H--Y--Y--F--T--I--G-

The mutated nucleotide is indicated in red.  The mutation results in a tyrosine (Y) to cysteine (C) substitution at amino acid 1577 (Y1577C) in the SCN8A protein, and is strongly predicted by Polyphen-2 to be probably damaging (score = 1.000).

Protein Prediction

Figure 4. A, Domain structure of SCN8A. B, Transmembrane organization of sodium channel subunits. Cylinders represent probable α-helical transmembrane segments (numbered 1-6 for each domain) with green cylinders indicating the pore-lining segments and yellow cylinders indicating the S4 voltage sensors (positively charged residues are represented by the + signs). The extracellular immunoglobulin-like domains of the β1 and β2 subunits are shown and a site of interaction between the  α and β1 subunit is indicated by the wavy, gray lines. Consensus phosphorylation sites are indicated by the orange circles. Purple circles represent the outer (EEDD) and inner (DEKA) rings of amino acid residues forming the ion selectivity filter and the TTX binding site. White circles indicate residues critical for fast inactivation. Binding sites for α- and β-scorpion toxins and anesthetic drugs are also shown. The residue affected by the nymph mutation is located in the cytoplasmic domain between the S2 and S3 helices of repeat IV. Image is interactive; click to see additional Scn8a​ mutations.

Scn8a encodes the voltage-gated sodium channel SCN8A (alternatively, Na_v1.6) (Figure 4). Voltage-gated sodium channels are essential for the initiation and propagation of action potentials in neurons and excitable cells by mediating the rapid influx of sodium. Na_v1.6 contains four homologous domains (I-IV) that each consist of six transmembrane α-helices (S1-S6) (1;2). The S4 helices constitute the voltage sensors of the channel. A membrane reentrant extracellular loop (i.e., the pore loop) is located between S5 and S6 in each of the four domains and lines the extracellular, narrow entrance to the pore (3;4).  The S5 and S6 helices line the intracellular, wider exit of the pore, while amino acids (F1752 and Y1759) in in the S6 helix contribute to drug binding (5;6). The nymph mutation (Y1577C) is within the cytoplasmic domain between the S2 and S3 helices of repeat IV.

For more information about Scn8a, please see the record for TremorD.

Putative Mechanism

Mutations in Scn8a (e.g., Scn8a^med, MGI:1856078; Scn8a^med-tg, MGI:1856414; Scn8a^med-J, MGI:1856079) lead to a range of neurological disorders in mice such as tremor, ataxia, early-onset progressive paralysis of the hind limbs, severe muscle atrophy, degeneration of Purkinje cells, and juvenile lethality (7). Loss of Scn8a expression in Scn8a^med homozygous mice resulted in reduced conduction velocity of the sciatic nerve between postnatal day 17 and 23 and subsequent failure of transmission at the neuromuscular junction and muscle denervation (8-10). Reduced body weights (at all ages) have been observed in another Scn8a ENU mutant model, Scn8a^Clth (cloth-ears; MGI:3827095) mice (11).

Primers

PCR Primer
nymph_pcr_F: TTCGTCACGCAACAAGCCTTCG
nymph_pcr_R: GCTCTCAGAAATCTGGTCCTCACAC

Sequencing Primer
nymph_seq_F: ACAAGCCTTCGACATCGTG
nymph_seq_R: TCCTCACACCTGGGGTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 418 nucleotides is amplified (chromosome 15, + strand):

1   ttcgtcacgc aacaagcctt cgacatcgtg atcatgatgc ttatctgcct taacatggtg
61  accatgatgg tggagacaga cacacagagc aagcagatgg agaacattct ctactggatt
121 aatctggtct tcgtcatctt cttcacctgc gagtgtgtgc tcaaaatgtt tgccttgaga
181 cactactatt tcaccattgg ctggaacatc tttgactttg tggtggtcat tctctccatt
241 gtgggtgagt gggtgcagcc acaggaaggg gggtgagtgg gcggggccac aggaagggtg
301 agtgggcggg gccacaggaa gagggggtga gtgggcgggg ccacgggaag aggggatgag
361 tgggcggggc cacaggaagg accaggaccc caggtgtgag gaccagattt ctgagagc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

1. Burgess, D. L., Kohrman, D. C., Galt, J., Plummer, N. W., Jones, J. M., Spear, B., and Meisler, M. H. (1995) Mutation of a New Sodium Channel Gene, Scn8a, in the Mouse Mutant 'Motor Endplate Disease'. Nat Genet. 10, 461-465.

  2. Schaller, K. L., Krzemien, D. M., Yarowsky, P. J., Krueger, B. K., and Caldwell, J. H. (1995) A Novel, Abundant Sodium Channel Expressed in Neurons and Glia. J Neurosci. 15, 3231-3242.

  3. Catterall, W. A., Goldin, A. L., and Waxman, S. G. (2005) International Union of Pharmacology. XLVII. Nomenclature and Structure-Function Relationships of Voltage-Gated Sodium Channels. Pharmacol Rev. 57, 397-409.

  4. Catterall, W. A. (2000) From Ionic Currents to Molecular Mechanisms: The Structure and Function of Voltage-Gated Sodium Channels. Neuron. 26, 13-25.

  5. Ragsdale, D. S., McPhee, J. C., Scheuer, T., and Catterall, W. A. (1996) Common Molecular Determinants of Local Anesthetic, Antiarrhythmic, and Anticonvulsant Block of Voltage-Gated Na+ Channels. Proc Natl Acad Sci U S A. 93, 9270-9275.

  6. Ragsdale, D. S., McPhee, J. C., Scheuer, T., and Catterall, W. A. (1994) Molecular Determinants of State-Dependent Block of Na+ Channels by Local Anesthetics. Science. 265, 1724-1728.

  7. Noujaim, S. F., Kaur, K., Milstein, M., Jones, J. M., Furspan, P., Jiang, D., Auerbach, D. S., Herron, T., Meisler, M. H., and Jalife, J. (2012) A Null Mutation of the Neuronal Sodium Channel NaV1.6 Disrupts Action Potential Propagation and Excitation-Contraction Coupling in the Mouse Heart. FASEB J. 26, 63-72.

  8. Kearney, J. A., Buchner, D. A., De Haan, G., Adamska, M., Levin, S. I., Furay, A. R., Albin, R. L., Jones, J. M., Montal, M., Stevens, M. J., Sprunger, L. K., and Meisler, M. H. (2002) Molecular and Pathological Effects of a Modifier Gene on Deficiency of the Sodium Channel Scn8a (Na(v)1.6). Hum Mol Genet. 11, 2765-2775.

  9. Duchen, L. W., and Stefani, E. (1971) Electrophysiological Studies of Neuromuscular Transmission in Hereditary 'Motor End-Plate Disease' of the Mouse. J Physiol. 212, 535-548.

  10. Harris, J. B., and Pollard, S. L. (1986) Neuromuscular Transmission in the Murine Mutants "Motor End-Plate Disease" and "Jolting". J Neurol Sci. 76, 239-253.

11. Mackenzie, F.E., Parker, A., Parkinson, N.J., Oliver, P.L., Brooker, D., Underhill, P., Lukashkina, V.A., Lukashkin, A.N., Holmes, C., Brown, S.D. (2009) Analysis of the mouse mutant Cloth-ears shows a role for the voltage-gated sodium channel Scn8a in peripheral neural hearing loss. Genes Brain Behav. 8, 699-713.