Phenotypic Mutation 'Wonton' (pdf version)
AlleleWonton
Mutation Type missense
Chromosome17
Coordinate46,409,692 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Zfp318
Gene Name zinc finger protein 318
Synonym(s) 2610034E08Rik, D530032D06Rik, TZF
Chromosomal Location 46,383,731-46,420,920 bp (+)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit reduced male fertility and altered IgM and IgD levels. Null mutants displayed normal level of circulating B cells with decreased IgD and increased IgM levels. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_207671, NM_207671; MGI:1889348

Mapped Yes 
Amino Acid Change Tyrosine changed to Histidine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000109109] [ENSMUSP00000116544] [ENSMUSP00000116132]
SMART Domains Protein: ENSMUSP00000109109
Gene: ENSMUSG00000015597
AA Change: Y1119H

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 30 127 N/A INTRINSIC
low complexity region 150 169 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
coiled coil region 348 376 N/A INTRINSIC
SCOP:d1eq1a_ 916 995 2e-4 SMART
low complexity region 1018 1055 N/A INTRINSIC
ZnF_U1 1085 1119 5.99e-7 SMART
ZnF_C2H2 1088 1112 4.5e1 SMART
ZnF_U1 1155 1189 2.1e-11 SMART
ZnF_C2H2 1158 1180 4.62e1 SMART
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1358 1371 N/A INTRINSIC
low complexity region 1640 1651 N/A INTRINSIC
Blast:HNHc 1660 1710 3e-17 BLAST
low complexity region 2001 2013 N/A INTRINSIC
low complexity region 2110 2121 N/A INTRINSIC
Predicted Effect possibly damaging

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
(Using ENSMUST00000113481)
SMART Domains Protein: ENSMUSP00000116544
Gene: ENSMUSG00000015597

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 30 127 N/A INTRINSIC
low complexity region 150 169 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
coiled coil region 348 376 N/A INTRINSIC
Blast:HOLI 854 1114 8e-19 BLAST
SCOP:d1eq1a_ 916 995 6e-5 SMART
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000116132
Gene: ENSMUSG00000015597

DomainStartEndE-ValueType
coiled coil region 3 30 N/A INTRINSIC
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
FACS IgD MFI - decreased 24616512
post-MCMV FACS B1b cells - decreased
post-MCMV FACS B2 cells - increased
post-MCMV FACS IgD MFI - decreased 24616512
Penetrance  
Alleles Listed at MGI

All mutations/alleles(8) : Chemically induced (ENU)(1) Gene trapped(3) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Zfp318 APN 17 46412472 missense probably benign 0.01
IGL00978:Zfp318 APN 17 46413726 missense possibly damaging 0.64
IGL01016:Zfp318 APN 17 46400077 missense probably damaging 1.00
IGL01310:Zfp318 APN 17 46413227 missense possibly damaging 0.81
IGL01453:Zfp318 APN 17 46409016 splice site probably null
IGL01887:Zfp318 APN 17 46399168 missense probably benign 0.07
IGL02025:Zfp318 APN 17 46396810 nonsense probably null
IGL02026:Zfp318 APN 17 46396810 nonsense probably null
IGL02070:Zfp318 APN 17 46396718 missense probably damaging 1.00
IGL02182:Zfp318 APN 17 46396810 nonsense probably null
IGL02187:Zfp318 APN 17 46396810 nonsense probably null
IGL02188:Zfp318 APN 17 46396810 nonsense probably null
IGL02189:Zfp318 APN 17 46396810 nonsense probably null
IGL02190:Zfp318 APN 17 46396810 nonsense probably null
IGL02191:Zfp318 APN 17 46396810 nonsense probably null
IGL02192:Zfp318 APN 17 46396810 nonsense probably null
IGL02203:Zfp318 APN 17 46396810 nonsense probably null
IGL02224:Zfp318 APN 17 46396810 nonsense probably null
IGL02230:Zfp318 APN 17 46396810 nonsense probably null
IGL02231:Zfp318 APN 17 46396810 nonsense probably null
IGL02232:Zfp318 APN 17 46396810 nonsense probably null
IGL02233:Zfp318 APN 17 46396810 nonsense probably null
IGL02234:Zfp318 APN 17 46396810 nonsense probably null
IGL02412:Zfp318 APN 17 46409117 nonsense probably null
IGL02792:Zfp318 APN 17 46409178 missense probably damaging 1.00
IGL02826:Zfp318 APN 17 46398754 missense probably damaging 1.00
I0000:Zfp318 UTSW 17 46399559 missense probably damaging 1.00
R0206:Zfp318 UTSW 17 46399019 missense probably benign 0.07
R0240:Zfp318 UTSW 17 46396813 missense probably benign 0.00
R0240:Zfp318 UTSW 17 46396813 missense probably benign 0.00
R0281:Zfp318 UTSW 17 46412614 missense probably benign 0.05
R0350:Zfp318 UTSW 17 46413198 missense probably benign 0.00
R0383:Zfp318 UTSW 17 46413296 missense probably damaging 0.99
R0453:Zfp318 UTSW 17 46396708 missense probably damaging 0.96
R1014:Zfp318 UTSW 17 46412536 nonsense probably null
R1166:Zfp318 UTSW 17 46409692 missense possibly damaging 0.89
R1208:Zfp318 UTSW 17 46412520 unclassified probably benign
R1208:Zfp318 UTSW 17 46412520 unclassified probably benign
R1327:Zfp318 UTSW 17 46413263 missense probably damaging 1.00
R1330:Zfp318 UTSW 17 46413758 missense possibly damaging 0.90
R1737:Zfp318 UTSW 17 46399477 missense probably benign 0.35
R1800:Zfp318 UTSW 17 46412054 missense probably benign 0.00
R1846:Zfp318 UTSW 17 46413666 missense probably benign 0.00
R1848:Zfp318 UTSW 17 46406055 missense possibly damaging 0.92
R1861:Zfp318 UTSW 17 46411440 missense possibly damaging 0.92
R1913:Zfp318 UTSW 17 46412524 unclassified probably benign
R1913:Zfp318 UTSW 17 46412514 unclassified probably benign
R2059:Zfp318 UTSW 17 46397024 missense probably damaging 0.99
R2085:Zfp318 UTSW 17 46409664 intron probably null
R2122:Zfp318 UTSW 17 46413371 missense probably benign 0.01
R2339:Zfp318 UTSW 17 46399463 missense probably benign 0.01
R4526:Zfp318 UTSW 17 46412358 missense probably benign 0.00
R4564:Zfp318 UTSW 17 46412815 missense possibly damaging 0.77
R4689:Zfp318 UTSW 17 46399634 missense probably damaging 0.99
R4795:Zfp318 UTSW 17 46412062 missense probably benign 0.07
R5256:Zfp318 UTSW 17 46412069 missense probably benign 0.19
R5317:Zfp318 UTSW 17 46412537 unclassified probably benign
R5323:Zfp318 UTSW 17 46386736 missense probably damaging 0.99
R5436:Zfp318 UTSW 17 46413049 missense possibly damaging 0.95
R5485:Zfp318 UTSW 17 46412254 missense possibly damaging 0.81
R5627:Zfp318 UTSW 17 46413136 missense probably damaging 1.00
R5643:Zfp318 UTSW 17 46409244 intron probably benign
R5782:Zfp318 UTSW 17 46412514 unclassified probably benign
R5783:Zfp318 UTSW 17 46412514 unclassified probably benign
R5820:Zfp318 UTSW 17 46412773 missense probably benign
R5895:Zfp318 UTSW 17 46399033 missense probably damaging 1.00
R6189:Zfp318 UTSW 17 46412514 unclassified probably benign
R6385:Zfp318 UTSW 17 46411006 missense probably damaging 1.00
R6428:Zfp318 UTSW 17 46399336 missense probably damaging 1.00
R6471:Zfp318 UTSW 17 46399505 missense probably benign 0.05
R6666:Zfp318 UTSW 17 46409214 missense probably benign 0.01
R6812:Zfp318 UTSW 17 46412542 unclassified probably benign
R6825:Zfp318 UTSW 17 46412519 unclassified probably benign
R6852:Zfp318 UTSW 17 46412533 unclassified probably benign
R6852:Zfp318 UTSW 17 46412534 unclassified probably benign
R6852:Zfp318 UTSW 17 46412538 unclassified probably benign
R6854:Zfp318 UTSW 17 46412542 unclassified probably benign
R6873:Zfp318 UTSW 17 46412518 nonsense probably null
R6873:Zfp318 UTSW 17 46412526 unclassified probably benign
X0026:Zfp318 UTSW 17 46410638 missense possibly damaging 0.89
X0054:Zfp318 UTSW 17 46412609 missense possibly damaging 0.79
X0065:Zfp318 UTSW 17 46410989 missense probably benign 0.01
Mode of Inheritance Autosomal Semidominant
Local Stock gDNA
MMRRC Submission 038172-MU
Last Updated 2018-12-06 3:13 PM by Anne Murray
Record Created 2014-10-12 7:58 PM by Ming Zeng
Record Posted 2018-12-06
Phenotypic Description

Figure 1. Wonton mice exhibit reduced IgD mean fluorescence intensity (MFI) on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. A CRISPR-generated Zfp318 knockout mouse exhibits reduced IgD MFI on peripheral blood B cells. Linkage was found with a recessive model of inheritance to the normalized IgD MFI (P = 6.16 x 10-9).

The Wonton phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1166, some of which showed a reduction in IgD mean fluorescence intensity (MFI) on B cells in the peripheral blood (Figure 1). A CRISPR-generated Zfp318 knockout mouse exhibited reduction in IgD MFI on B cells in the peripheral blood (Figure 2; P = 6.16 x 10-9; recessive model of inheritance), confirming that the Zfp318 mutation in the Wonton mice leads to the IgD MFI phenotype.

Nature of Mutation

Figure 3. Linkage mapping of the reduced IgD MFI in the peripheral blood using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 37 mutations (X-axis) identified in the G1 male of pedigree R1166.  Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. The reduced IgD MFI was linked by continuous variable mapping to a mutation in Zfp318: a T to C transition at base pair 46,409,692 (v38) on chromosome 17, or base pair 26,191 in the GenBank genomic region NC_000083 encoding Zfp318. Linkage was found with an additive model of inheritance to the normalized IgD MFI (P value of 5.698 x 10-10), wherein 5 variant homozygotes and 16 heterozygous mice departed phenotypically from 17 homozygous reference mice (Figure 3). The mutation corresponds to residue 3,428 in the mRNA sequence NM_207671 within exon 8 of 10 total exons.

 

3413 CAGACACTGGATCCCTACAACAGACCTTGGGCT

1114 -Q--T--L--D--P--Y--N--R--P--W--A-

 

The mutated nucleotide is indicated in red. The mutation results in a tyrosine (Y) to histidine (H) substitution at position 1119 (Y1119H) in the long isoform of the ZFP318 protein (see Protein Prediction section for more details on the isoforms of ZFP318), and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.892).

Protein Prediction
Figure 4. Domain organization of the ZFP318 isoforms. Zfp318 encodes a short and long isoform. Both proteins share the same 1,114 N-terminal amino acids. The Wonton mutation, marked with a red asterisk, only affects the long isoform. Abbreviations: ZF, C2H2 zinc finger, Ser, serine-rich region; Basic, basic amino acid-rich regions, myosin II, myosin II-homology region; poly-pro, poly-proline.

Zfp318 encodes zinc finger protein 318 [ZFP318; alternatively, testicular zing-finger protein (TZF); Figure 4]. Zinc finger proteins are nucleic acid-binding proteins that function in the activation or repression of downstream target genes. ZFP318 has two C2H2 zinc fingers (amino acids 1085-1119 and amino acids 1155-1189, SMART) (1). C2H2 zinc fingers are found in several transcription factors including Wilms’ tumor WT1, the RNA-binding nuclear protein (NP220), and RIN zinc finger (RIN ZF) (2;3). The C2H2 zinc fingers in ZFP318 are U1-type zinc fingers that are similar to the RNA-binding zinc fingers in the spliceosome U1C protein (4;5). U1C functions in the initiation and regulation of pre-mRNA splicing as part of the U1 snRNP. ZFP318 also has a myosin II-homology region (amino acids 687-799), a serine-rich region (amino acids 799-853), four basic amino acid-rich regions [RRKR (amino acids 143-145), KKSILKKR (amino acids 200-207), KRRR (amino acids 341-344), and RKKRR (amino acids 739-743)] that are putative nuclear localization sequences, a poly-glutamate region, and a poly-proline region (1;6). The myosin II-homology domain is 30% identical and 55% homologous to the coiled-coil domain of the heavy chain of myosin II (1). Amino acids 512-663 are not within a predicted domain, but are essential for ZFP318-mediated repression of androgen receptor expression (see the Background section for more information) (7).

 

Zfp318 encodes two isoforms that share the first 1,114 N-terminal amino acids (6). The 2,237-amino acid long isoform has two C2H2/U1 ribonucleoprotein type zinc finger domains, while the shorter 1,154-amino acid isoform lacks the second zinc finger and poly-proline domain. The two isoforms of ZFP318 can form both homo- and heterodimers (8). Formation of a heterodimer between the two isoforms inhibited ZFP318 homodimer formation (8).

 

The Wonton mutation affects amino acid Tyr1119 within the N-terminal zinc finger domain of the long ZFP318 isoform only.

Expression/Localization

Zfp318 is expressed at high levels in spermatogenic cells of the mouse testis and is upregulated at the pachytene spermatocyte stage of mouse spermatogenesis (1;6). Zfp318 was not detected in spermatogonia, in spermatogenic cells at early stages, or in Sertoli cells (6). Zfp318 was also expressed at moderate levels in the adrenal gland, uterus, prostate gland, muscle, and kidney (6;9). Zfp318 expression increases during B cell maturation from immature B cells into follicular B cells (10-12). Expression of Zfp318 is low in pro-B cells in the bone marrow, with moderate expression in immature (CD93+, CD62L) B cells in the spleen, and high amounts in mature follicular (CD93, CD62L+) B cells (13). Both ZFP318 isoforms localize to the nucleus (6). The short isoform localized to subnuclear speckles that contained histone deacetylase 2 (HDAC2). In addition ZFP318 was adjacent to nuclear speckles that contained serine/arginine-rich splicing factor (SRSF2) (6;7;9).

Background

During B cell differentiation from immature to mature follicular or marginal zone cells, antibody isotypes serve as cell surface markers of B cell maturation, as distinct receptors for B cell activation, and as secreted mediators of antibody effector functions (14). During B cell maturation, immature B cells in the bone marrow only express the IgM isotype on their cell surface (15). The IgM isotype is comprised of heavy (H) chains with an N-terminal variable domain, C-terminal constant region domains, a transmembrane segment, and a cytoplasmic tail. Upon maturation into circulating follicular B cells, the B cells coexpress a second isotype, IgD. Mature follicular B cells display cell surface B cell receptors comprised of the same variable domain joined to either IgD or IgM constant regions (16;17). Upon B cell activation by antigens and helper T cells, the B cells undergo isotype switching and lose IgM and IgD, switching to express the same variable domain linked to IgG, IgA, or IgE constant region domains. Isotype switching involves DNA recombination of the Ig heavy chain locus, Igh, and subsequent deletion of Ighm and Ighd constant region exons and the reorganization of the Ighg, Ighe, or Igha constant region exons immediately 3’ to the VDJH variable exon. The VDJH exon is then spliced to IgG, IgE, or IgA constant region exons in the mRNA (18;19).

 

Figure 5. Antibody heavy-chain gene rearrangement, transcription, and translation. The heavy (H)-chain DNA is shown at the top. In the first step, D-J joining occurs followed by V-DJ joining. The rearranged H-chain is transcribed and the primary RNA transcripts extend from the rearranged VDJ segments through to the Cδ gene. RNA processing (i.e., polyadenylation and splicing) results in the incorporation of either Cμ or Cδ by the transcripts, encoding for an IgM or IgD antibody, respectively.

ZFP318 functions as a transcription factor to regulate the expression of Ighm and Ighd during B cell maturation (13;20). B cell expression of IgD occurs developmentally through alternative splicing of the VDJH exon to the Ighm and Ighd exons (16;21;22). ZFP318 is required for balancing IgD and IgM output from Igh, but is not necessary for B cell maturation (13). Enders et al. proposed that ZFP318 regulates the alternative RNA splicing of Ighm and Ighd constant region exons by binding to HDAC2 (Figure 5) (13;23). Pioli et al. proposed that ZFP318 regulates hRNA transcription of IgD by blocking the recognition of an IgM-specific transcriptional stop site within the final Ighm exon subsequently synthesizing the full Ighm/Ighd hnRNA that is required for IgD production (20).

 

ZFP318 also functions as a corepressor of the androgen receptor (AR), a member of the nuclear receptor subfamily, in the testis (8;9). ZFP318 forms specific foci located in the proximity to the splicing factor compartment in nuclei and is recruited into the AR foci in the presence of 5α-dihydrotestosterone (DHT) (9). In the presence of DHT, ZFP318 recruited HDAC2 and formed a complex with the AR (7). Furthermore, the HDAC inhibitor TSA prevented ZFP318 transcriptional repression (7). Taken together, the recruitment of HDAC2 into the ZFP318/AR complex mediates ZFP318-mediated repression of the AR (7).

Putative Mechanism

Mice with B cell-specific deletion of ZFP318 (B-Zfp318-/-) exhibited normal B cell development (20). However, T1, T2, follicular, and marginal zone B cells from the B-Zfp318-/- mice expressed diminished IgD mRNA and protein (20). In addition, T2, follicular, and marginal zone B cells from the B-Zfp318-/- mice expressed elevated levels of IgM. An ENU-induced mutation, Zfp318m1Anu, resulted in an isolueucine to threonine substitution at amino acid 1347 in the long ZFP318 isoform. The Zfp318m1Anu mice exhibited diminished IgD and increased IgM on mature B cells in the peripheral blood as well as on splenic B cells (13). In the bone marrow, the percentage of B cells as well as the subset distribution of developing B cells was not significantly different in the Zfp318m1Anu mice compared to wild-type mice. However, there was a small increase in the proportion of recirculating B cells. The percentage of circulating B cells in the Zfp318m1Anu mice was normal. The long isoform functions in normal IgD expression, and any residual IgD-promoting activity was proposed to be due to the action of the short isoform (13). Alternatively, the long isoform may be the sole isoform to promote IgD expression, but mutations may only result in partial loss of activity. The Wonton mutation is predicted to only alter the long isoform of ZFP318. The reduced IgD phenotype of the Wonton mice indicates that the mutant ZFP318 protein has loss of function.

Primers
References
  11. Jojic, V., Shay, T., Sylvia, K., Zuk, O., Sun, X., Kang, J., Regev, A., Koller, D., Immunological Genome Project Consortium, Best, A. J., Knell, J., Goldrath, A., Joic, V., Koller, D., Shay, T., Regev, A., Cohen, N., Brennan, P., Brenner, M., Kim, F., Rao, T. N., Wagers, A., Heng, T., Ericson, J., Rothamel, K., Ortiz-Lopez, A., Mathis, D., Benoist, C., Bezman, N. A., Sun, J. C., Min-Oo, G., Kim, C. C., Lanier, L. L., Miller, J., Brown, B., Merad, M., Gautier, E. L., Jakubzick, C., Randolph, G. J., Monach, P., Blair, D. A., Dustin, M. L., Shinton, S. A., Hardy, R. R., Laidlaw, D., Collins, J., Gazit, R., Rossi, D. J., Malhotra, N., Sylvia, K., Kang, J., Kreslavsky, T., Fletcher, A., Elpek, K., Bellemarte-Pelletier, A., Malhotra, D., and Turley, S. (2013) Identification of Transcriptional Regulators in the Mouse Immune System. Nat Immunol. 14, 633-643.
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsMing Zeng, Bruce Beutler