Phenotypic Mutation 'bund'

• Allele: bund
• Mutation Type: missense
• Chromosome: 5
• Coordinate: 66,557,598 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Apbb2
• Gene Name: amyloid beta precursor protein binding family B member 2
• Synonym(s): Zfra, TR2L, 2310007D03Rik, Rirl1, FE65L1
• Chromosomal Location: 66,456,046-66,776,127 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the cytoplasmic domains of amyloid beta (A4) precursor protein and amyloid beta (A4) precursor-like protein 2. This protein contains two phosphotyrosine binding (PTB) domains, which are thought to function in signal transduction. Polymorphisms in this gene have been associated with Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009] ; PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display normal brain morphology. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Threonine changed to Serine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000084511] [ENSMUSP00000124807] [ENSMUSP00000125211] [ENSMUSP00000123778] [ENSMUSP00000123978] [ENSMUSP00000123752] [ENSMUSP00000125116]
• AlphaFold: Q9DBR4
• SMART Domains: Protein: ENSMUSP00000084511; Gene: ENSMUSG00000029207; AA Change: T288S

Domain	Start	End	E-Value	Type
WW	291	322	1.06e-7	SMART
PTB	414	560	3.15e-38	SMART
PTB	587	717	2.5e-41	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
  (Using ENSMUST00000087256)
• SMART Domains: Protein: ENSMUSP00000124807; Gene: ENSMUSG00000029207; AA Change: T289S

Domain	Start	End	E-Value	Type
WW	292	323	1.06e-7	SMART
PTB	394	538	2.87e-41	SMART
PTB	565	695	2.5e-41	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
  (Using ENSMUST00000159512)
• SMART Domains: Protein: ENSMUSP00000125211; Gene: ENSMUSG00000029207; AA Change: T288S

Domain	Start	End	E-Value	Type
WW	291	322	1.06e-7	SMART
PTB	414	560	4.29e-40	SMART
PTB	587	717	2.5e-41	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
  (Using ENSMUST00000159786)
• SMART Domains: Protein: ENSMUSP00000123778; Gene: ENSMUSG00000029207; AA Change: T289S

Domain	Start	End	E-Value	Type
WW	292	323	6.1e-10	SMART
PTB	415	510	1.3e-3	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
  (Using ENSMUST00000160063)
• SMART Domains: Protein: ENSMUSP00000123978; Gene: ENSMUSG00000029207; AA Change: T288S

Domain	Start	End	E-Value	Type
WW	291	322	1.06e-7	SMART
PTB	393	537	2.87e-41	SMART
PTB	564	694	2.5e-41	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
  (Using ENSMUST00000160870)
• SMART Domains: Protein: ENSMUSP00000123752; Gene: ENSMUSG00000029207; AA Change: T288S

Domain	Start	End	E-Value	Type
WW	291	322	1.06e-7	SMART
PTB	414	558	2.87e-41	SMART
PTB	585	715	2.5e-41	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
  (Using ENSMUST00000162349)
• SMART Domains: Protein: ENSMUSP00000125116; Gene: ENSMUSG00000029207; AA Change: T288S

Domain	Start	End	E-Value	Type
WW	291	322	1.06e-7	SMART
PTB	393	537	2.87e-41	SMART
PTB	563	693	2.5e-41	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
  (Using ENSMUST00000162366)
• Meta Mutation Damage Score: 0.0899
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm
• Last Updated: 2021-11-30 7:40 AM by Diantha La Vine
• Record Created: 2014-10-13 3:25 PM by Jeff SoRelle
• Record Posted: 2018-04-05
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Katherine Timer
• Authors: Zhe Chen, Jeff SoRelle, William McAlpine, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_009686 (variant 1), NM_001204143 (variant 2), NM_001201414 (variant 3), NM_001201415 (variant 4), NM_001201416 (variant 5), NM_001310626 (variant 6); MGI:108405

Alleles Listed at MGI

All Mutations and Alleles(154) : Chemically induced (other)(2) Gene trapped(147) Radiation induced(1) Spontaneous(1) Targeted(3)

Phenotypic Description

Figure 1. Bund mice exhibited hyperglycemia 30 minutes after glucose challenge . Normalized gene-based superpedigree data are shown for pedigrees R0882, R4780, and R4299. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The bund phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0882 by gene-based superpedigree analysis in which some mice showed hyperglycemia 30 minutes after glucose challenge (Figure 1).

Nature of Mutation

Figure 2. Gene-based supedigree l inkage mapping of the hyperglycemia 30 minutes after glucose challenge phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of mutations (X-axis) identified in the G1 male of pedigrees R0882, R4780, and R4299. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 3. Mice with CRISPR-mediated knockout of Apbb2 exhibited hyperglycemia 30 minutes after glucose challenge . Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 49 mutations. The hyperglycemia phenotype was linked by continuous variable mapping to a mutation in Apbb2:  an A to T transversion at base pair 66,400,255 (v38) on chromosome 5, or base pair 218,563 in the GenBank genomic region NC_000071 encoding Apbb2. Linkage was found by gene-based superipedigree analysis of Apbb2 mutations in three pedigrees (R0882, R4780, and R4299) with a recessive model of inheritance, wherein five variant homozygotes departed phenotypically from 13 homozygous reference mice and 17 heterozygous mice with a P value of 4.701 x 10^-5 (Figure 2).  

The mutation corresponds to residue 1,433 in the mRNA sequence NM_001201415 within exon 6 of 16 total exons.

1418 GATCACTCATTTCAGACAGATCCCGATTTGCCG 283  -D--H--S--F--Q--T--D--P--D--L--P-

The mutated nucleotide is indicated in red.  The mutation results in a threonine (T) to serine (S) substitution at position 288 (T288S) in the APBB2 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.977).

The mutation in Apbb2 was confirmed to be causative of the hyperglycemia phenotype by CRISPR-mediated knockout of Apbb2 (Figure 3; P = 3.865 x 10^-4).

Protein Prediction

APBB2 (alternatively, FE65L1) is a member of the FE65 family of adaptor proteins, which also includes FE65 (alternatively, APBB1) and APBB3 (alternatively, FE65L2). Each FE65 protein has several conserved domains, including a WW (tryptophan, tryptophan) domain and two phosphotyrosine binding (PTB)/PID domains. The members of the FE65 protein family are different at their respective N-termini. APBB2 has a 290-amino acid N-terminus preceding the WW domain, while the N-terminus of APBB1 and APBB3 are 253- and 29-amino acids in length, respectively. APBB2 also has a putative conserved 56-amino acid TR2_L sequence (1). The TR2_L sequence is an apoptosis inhibitory domain that blocks TNF (see the record for Panr1) cytotoxicity (2).

The mutation results in a threonine (T) to serine (S) substitution at position 288 (T288S) in the APBB2 protein; amino acid 288 is within an undefined region of APBB2 immediately preceding the WW domain. 

For more information about Apbb2, please see the record for Dionysis.

Putative Mechanism

APBB2 is one of four phosphotyrosines-binding proteins (i.e., APBA1, APBA2 (please see the record for guadalupe), APBB1/Fe65, and APBB2) that bind APP to promote APP processing (3-7). APBB2 is also putative regulator of low density lipoprotein (LDL) receptor-related protein 1 (LRP1) by promoting the association of LRP1 with APP (8;9), and overexpression of APBB2 promotes LRP1 degradation (9;10).

Apbb2-deficient mice exhibited prenatal lethality (MGI:5574593) and cortical cataracts (11). Heterozygous Apbb2 mice exhibited reduced circulating insulin levels (MGI:5574593). The grip strength in Apbb2-deficient mice was slightly reduced, but was not significantly different than wild-type mice (12). Apbb2-deficient mice also showed spatial learning defects and neuromuscular abnormalities (12). FE65 and APBB2 putatively have overlapping functions at central and peripheral synapses (12). Fe65 and Apbb2 double knockout mice exhibited neurodevelopmental defects, lens degeneration, limb clasping, defects in peripheral motor function, reduced anxiety, and reduced grip strength (10-13).

Mutations in APBB2 are putatively linked cases of late-onset Alzheimer’s disease due to aberrant increased production of Aβ (14). Furthermore, an APBB2 polymorphism (hCV1558625-rs13133980 AG haplotype) is associated with severe cognitive impairment in centenarians (15).

APBB2 is required for proper β-cell function through its regulation of LRP1 (16). Apbb2-deficient mice showed glucose intolerance with high circulating glucose levels and a lower glucose infusion rate (16). Islets from the Apbb2-deficient mice exhibited reduced insulin secretion upon high glucose stimulation (16).Loss of APBB2 expression was proposed to disrupt the function of LRP1 in cholesterol metabolism as well as the assembly of the LRP1-APP-APBB2 signaling complex.

Primers

PCR Primer
bund_pcr_F: ACTAAGTGACCCTTTCCTAGAGCCG
bund_pcr_R: CCTAAAAGTGTGCAGTGCAGAGTCC

Sequencing Primer
bund_seq_F: TCCTAGAGCCGTGGAGATCTG
bund_seq_R: CAGACATTTCTGGGTGTCGGGTT

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 651 nucleotides is amplified (chromosome 5, - strand):

1   cctaaaagtg tgcagtgcag agtcctggag tcctcaaaaa gacactgctc ctctgtgggt
61  gtctggatgc aaaccagtgc tttatctata gaaagcggtt acagaaactt agacttatag
121 ccaggaagga tgtataatgc cagtcagtca gtctgattga cagcgggatc cggcaggctc
181 tgtacgtaaa caattggaat ttgtcttcac gtttggttat gattcatgga gctttagctt
241 gaggttcttg gaggtatggg gtgacttgaa aataaggtca ttataccaga gatggccacc
301 agtctttcca gttctgtctc ctctcaatta cccctttcac cacattttat atggtaggtt
361 cttctcagtt cagtgcagac atttctgggt gtcgggtttg cctggctgtt ggaagttttc
421 tttttctcct ttaatagtgt ggtttttttt ttctctctct ctctccatct cccagcagat
481 atctggagtg atcactcatt tcagacagat cccgatttgc cgccgggctg gaagagagtc
541 aatgacattg ccgggaccta ttactggcac atcccaacag ggacgactca atgggaacgg
601 cctgtctcca tcccagcaga tctccacggc tctaggaaag ggtcacttag t

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Cao, H., Pratt, N., Mattison, J., Zhao, Y., and Chang, N. S. (2000) Characterization of an Apoptosis Inhibitory Domain at the C-Termini of FE65-Like Protein. Biochem Biophys Res Commun. 276, 843-850.

  2. Lange, A., Thon, L., Mathieu, S., and Adam, D. (2005) The Apoptosis Inhibitory Domain of FE65-Like Protein 1 Regulates both Apoptotic and Caspase-Independent Programmed Cell Death Mediated by Tumor Necrosis Factor. Biochem Biophys Res Commun. 335, 575-583.

  3. Guenette, S. Y., Chen, J., Jondro, P. D., and Tanzi, R. E. (1996) Association of a Novel Human FE65-Like Protein with the Cytoplasmic Domain of the Beta-Amyloid Precursor Protein. Proc Natl Acad Sci U S A. 93, 10832-10837.

  4. Blanco, G., Irving, N. G., Brown, S. D., Miller, C. C., and McLoughlin, D. M. (1998) Mapping of the Human and Murine X11-Like Genes (APBA2 and apba2), the Murine Fe65 Gene (Apbb1), and the Human Fe65-Like Gene (APBB2): Genes Encoding Phosphotyrosine-Binding Domain Proteins that Interact with the Alzheimer's Disease Amyloid Precursor Protein. Mamm Genome. 9, 473-475.

  5. McLoughlin, D. M., and Miller, C. C. (1996) The Intracellular Cytoplasmic Domain of the Alzheimer's Disease Amyloid Precursor Protein Interacts with Phosphotyrosine-Binding Domain Proteins in the Yeast Two-Hybrid System. FEBS Lett. 397, 197-200.

  6. Chang, Y., Tesco, G., Jeong, W. J., Lindsley, L., Eckman, E. A., Eckman, C. B., Tanzi, R. E., and Guenette, S. Y. (2003) Generation of the Beta-Amyloid Peptide and the Amyloid Precursor Protein C-Terminal Fragment Gamma are Potentiated by FE65L1. J Biol Chem. 278, 51100-51107.

  7. Guenette, S. Y., Chen, J., Ferland, A., Haass, C., Capell, A., and Tanzi, R. E. (1999) HFE65L Influences Amyloid Precursor Protein Maturation and Secretion. J Neurochem. 73, 985-993.

  8. Carter, C. J. (2007) Convergence of Genes Implicated in Alzheimer's Disease on the Cerebral Cholesterol Shuttle: APP, Cholesterol, Lipoproteins, and Atherosclerosis. Neurochem Int. 50, 12-38.

  9. Kinoshita, A., Shah, T., Tangredi, M. M., Strickland, D. K., and Hyman, B. T. (2003) The Intracellular Domain of the Low Density Lipoprotein Receptor-Related Protein Modulates Transactivation Mediated by Amyloid Precursor Protein and Fe65. J Biol Chem. 278, 41182-41188.

  10. Guenette, S. Y., Chang, Y., Hyman, B. T., Tanzi, R. E., and Rebeck, G. W. (2002) Low-Density Lipoprotein Receptor-Related Protein Levels and Endocytic Function are Reduced by Overexpression of the FE65 Adaptor Protein, FE65L1. J Neurochem. 82, 755-762.

  11. Suh, J., Moncaster, J. A., Wang, L., Hafeez, I., Herz, J., Tanzi, R. E., Goldstein, L. E., and Guenette, S. Y. (2015) FE65 and FE65L1 Amyloid Precursor Protein-Binding Protein Compound Null Mice Display Adult-Onset Cataract and Muscle Weakness. FASEB J. 29, 2628-2639.

  12. Strecker, P., Ludewig, S., Rust, M., Mundinger, T. A., Gorlich, A., Krachan, E. G., Mehrfeld, C., Herz, J., Korte, M., Guenette, S. Y., and Kins, S. (2016) FE65 and FE65L1 Share Common Synaptic Functions and Genetically Interact with the APP Family in Neuromuscular Junction Formation. Sci Rep. 6, 25652.

  13. Guenette, S., Chang, Y., Hiesberger, T., Richardson, J. A., Eckman, C. B., Eckman, E. A., Hammer, R. E., and Herz, J. (2006) Essential Roles for the FE65 Amyloid Precursor Protein-Interacting Proteins in Brain Development. EMBO J. 25, 420-431.

  14. Li, Y., Hollingworth, P., Moore, P., Foy, C., Archer, N., Powell, J., Nowotny, P., Holmans, P., O'Donovan, M., Tacey, K., Doil, L., van Luchene, R., Garcia, V., Rowland, C., Lau, K., Cantanese, J., Sninsky, J., Hardy, J., Thal, L., Morris, J. C., Goate, A., Lovestone, S., Owen, M., Williams, J., and Grupe, A. (2005) Genetic Association of the APP Binding Protein 2 Gene (APBB2) with Late Onset Alzheimer Disease. Hum Mutat. 25, 270-277.

  15. Golanska, E., Sieruta, M., Gresner, S. M., Pfeffer, A., Chodakowska-Zebrowska, M., Sobow, T. M., Klich, I., Mossakowska, M., Szybinska, A., Barcikowska, M., and Liberski, P. P. (2013) APBB2 Genetic Polymorphisms are Associated with Severe Cognitive Impairment in Centenarians. Exp Gerontol. 48, 391-394.

  16. Ye, R., Gordillo, R., Shao, M., Onodera, T., Chen, Z., Chen, S., Lin, X., Sorelle, J., Li, X., Tang, M., Keller, M. P., Kuliawat, R., Attie, A. D., Gupta, R. K., Holland, W. L., Beutler, B., Herz, J., and Scherer, P. E. (2018) Intracellular Lipid Metabolism Impairs β-Cell Compensation during Diet-Induced Obesity. J Clin Invest. 128, 1178-1189.