Allele | dim_sum | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | splice site (9 bp from exon) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 163,893,770 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ A (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Sell | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | selectin, lymphocyte | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | CD62L, Ly-22, Lyam1, LECAM-1, Lyam-1, Ly-m22, Lnhr, L-selectin | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 163,889,556-163,908,354 bp (+) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface adhesion molecule that belongs to a family of adhesion/homing receptors. The encoded protein contains a C-type lectin-like domain, a calcium-binding epidermal growth factor-like domain, and two short complement-like repeats. The gene product is required for binding and subsequent rolling of leucocytes on endothelial cells, facilitating their migration into secondary lymphoid organs and inflammation sites. Single-nucleotide polymorphisms in this gene have been associated with various diseases including immunoglobulin A nephropathy. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009] PHENOTYPE: Homozygotes for targeted null mutations exhibit lack of lymphocyte binding to high endothelial venules of peripheral lymph nodes and defects in leukocyte rolling and neutrophil migration into the peritoneum following an inflammatory stimulus. Tumor cellsurvival is also reduced. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_011346, NM_001164059; MGI:98279 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000027871 †] [ENSMUSP00000095099 †] [ENSMUSP00000142237 †] [ENSMUSP00000141365 †] † probably from a misspliced transcript | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P18337 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000027871 Gene: ENSMUSG00000026581
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000095099 Gene: ENSMUSG00000026581
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000142237 Gene: ENSMUSG00000026581
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000141365 Gene: ENSMUSG00000026581
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.9755 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | gDNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 038159-MU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:48 PM by Peter Jurek | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2014-10-14 8:02 PM by Ming Zeng | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2015-02-10 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The dim-sum phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R0800, some of which showed a decreased frequency of naïve CD4+ T cells in CD4+ T cells in the peripheral blood (Figure 1). |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 52 mutations. The reduced frequency of peripheral naïve CD4+ T cells was linked by continuous variable mapping to a mutation in Sell: a T to A transversion at base pair 164,066,201 (v38) on chromosome 1, or base pair 4,389 in the GenBank genomic region NC_000067 encoding Sell. Linkage was found with a recessive model of inheritance (P = 1.874 x 10-8), wherein 7 variant homozygotes departed phenotypically from 7 homozygous reference mice and 21 heterozygous mice (Figure 2). A substantial semidominant effect was observed. The mutation affects a thymine base 9 nucleotides from exon 4 (out of 9 total exons). The mutation is predicted to affect the splice acceptor site of intron 3, resulting in skipping of the 108-base pair exon 4 (encoding amino acids 158-193). Splicing of exon 3 to exon 5 does not generate a frame-shift.
Genomic numbering corresponds to NC_000067. The mutated nucleotide is indicated in red; the splice acceptor sequence is in blue. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Sell encodes L-selectin (alternatively, CD62L), a lymphocyte-specific member of the selectin family that also includes endothelium-specific E-selectin (CD62E) and platelet-specific P-selectin (CD62P). L-selectin shares similar domains to the other selectins including an extracellular C-type (or calcium-dependent) lectin domain (amino acids 29-156, SMART), an epidermal growth factor (EGF)-like domain (amino acids 159-192), two short consensus repeats (SCRs) (amino acids 197-254 and 259-316), a transmembrane domain (amino acids 333-355), and a cytoplasmic tail (amino acids 356-372) (1-3). In addition, L-selectin has a signal peptide at amino acids 1-28; SMART) (1;3-5). The C-type lectin domain of L-selectin recognizes the tetrasaccharide carbohydrate sialyl Lewis X (sLex) on selectin ligands and is essential for the adhesive function of the selectins (6-10). Most L-selectin ligands are glycoproteins [e.g., CD34, glycosylation-dependent cell adhesion molecule-1 (GlyCAM1), and Addressin (alternatively, MAdCAM-1)] that are synthesized by high endothelial venules (HEVs) in the peripheral and mesenteric lymph nodes (11). The EGF-like domain of L-selectin is proposed to have a structural role and facilitates protein-protein, cell-cell, or cell-matrix interactions during leukocyte emigration from HEVs (see Background for more information on leukocyte emigration) (4;12). The SCRs are homologous to domains in complement (C3b and C4b)-binding proteins that dampen the complement cascade at amplification junctures. Similar domains to the SCRs are found in the interleukin 2 receptor (13) and P2 glycoprotein I (14). The SCR domains have roles in cell adhesion. In addition, interactions between the lectin, EGF-like, and SCR domains modify ligand-binding specificity. The cytoplasmic tail of L-selectin binds several proteins including α-actinin, the ezrin/radixin/moesin (ERM) family of proteins, and calmodulin (15). Anchoring of the cytoplasmic domain of L-selectin to the cytoskeleton through its interaction with α-actinin is essential for L-selectin-mediated rolling (16;17). Association of Arg357 and Lys362 of human L-selectin with ERM proteins is essential for the microvillar positioning of L-selectin; the localization of L-selectin on the tips of microvilli is an essential process for L-selectin-mediated tethering under flow (18;19). Association of the cytoplasmic tail (via residues Arg357, Leu358, Lys359, and Lys362 of human L-selectin) with calmodulin regulates the proteolytic cleavage of the ectodomain by blocking access of tumor necrosis factor (TNF)–α–converting enzyme [TACE; alternatively a disintegrin and metalloprotease (ADAM17); see the record for wavedx] to L-selectin (18;20;21); other proteases regulate the shedding of L-selectin, but they have not been identified (22). The extracellular domain of L-selectin is cleaved from the leukocyte cell surface soon after cell activation (23-26). Shedding of the extracellular domain also occurs upon induced and spontaneous apoptosis (27). Cleavage of L-selectin leads to a functionally active receptor and is proposed to facilitate leukocyte detachment from the endothelial surface before entry into tissues (28) as well as to regulate neutrophil and antigen-activated T cell migration by controlling L-selectin cell surface density; preventing homeostatic L-selectin cleavage resulted in a 2-fold increase in L-selectin expression by leukocytes (26;29-31). Blockade of L-selectin shedding using synthetic hydroxamic acid–based matrix metalloproteinase (MMP) inhibitors resulted in reduced rolling velocity, increased numbers of cells that tether from flow, and increased transit time through blood vessels in mice (32;33). Reduced L-selectin cleavage on antigen-stimulated lymphocytes facilitated their continued migration to peripheral lymph nodes (PLNs) and inhibited their short-term redirection to the spleen (26). A transgenic mouse expressing only a non-cleavable L-selectin (LΔP-selectin) on T lymphocytes revealed that L-selectin shedding does not regulate the trafficking of naïve T cells to PLNs, but regulates the entry of antigen-activated T cells (30). L-selectin shedding also regulated L-selectin–dependent β2-integrin activation in vitro and ICAM-1–dependent activation-induced arrest in mice (31) as well as neutrophil-dependent inflammation in rats (34). Alternative splicing of Sell generates two L-selectin isoforms, L-selectin-v1 and L-selectin-v2 (19). The L-selectin-v1 transcript includes a new exon (exon v1) between exon 7 and 8 of Sell. The L-selectin-v2 transcript has an additional 51-bp sequence (exon v2) immediately following the 49-bp L-selectin-v1 insert. L-selectin-v1 and L-selectin-v2 differ from canonical L-selectin at the cytoplasmic tail: L-selectin-v1 has a distinct 24-amino acid sequence (amino acids 362-385) and the eight C-terminal residues of L-selectin-v1 (residues 378–385) are replaced with a distinct 10-amino acid sequence in L-selectin-v2 (residues 378–387) (19). The mRNA of the L-selectin isoforms exhibited a similar pattern of lymphoid organ expression as canonical L-selectin. In B and T lymphocytes and granulocytes L-selectin-v1 mRNA expression was <2% of that of canonical L-selectin, whereas L-selectin-v2 mRNA expression was ∼4–5%. All of the isoforms were localized to microvilli. L-selectin-v1 and L-selectin-v2 both undergo shedding, but the shedding efficiency differs among the isoforms (L-selectin-v1 > canonical L-selectin > L-selectin-v2) (19). L-selectin-v1 and L-selectin-v2 facilitate faster cell rolling than canonical L-selectin under flow conditions (19). Ligation of canonical L-selectin and L-selectin-v1, but not L-selectin-v2, resulted in p38 MAPK phosphorylation, indicating that the cytoplasmic tails of canonical L-selectin and L-selectin-v1 facilitate p38 activation. The dim_sum mutation is predicted to result in deletion of exon 4. Exon 4 encodes amino acids 158-193 which encompasses the EGF-like domain. The expression and localization of the mutant protein has not been examined. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | L-selectin is constitutively expressed on T cells, B cells, neutrophils, and monocytes (1;24;35-37). The expression of L-selectin is higher on circulating T cells than on B cells (29). L-selectin expression is downregulated by proinflammatory mediators (28;38), osmotic stress (39), and bacterial superantigens or toxins (40-42), which enhance the TACE-induce proteolytic cleavage and shedding of the ectodomain. L-selectin expression on T cells is upregulated up to 3-fold 24-48 hours after T cell receptor engagement followed by a steady decrease over the next 5 days (43;44). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
During an inflammatory response, leukocytes migrate to lymphoid organs (e.g., PLNs and Peyer’s patches) and inflamed tissues. The process of leukocyte emigration to tissues involves several steps. (i) Inflammatory cytokines activate endothelial cells, which then express adhesion molecules and synthesize chemokines that promote leukocyte rolling along the activated endothelium. L-selectin is a homing receptor that functions in the initial leukocyte tethering to the HEVs and leukocyte rolling on vascular endothelium (45;46). The interaction of L-selectin with abundant ligand results in continued breakage and reformation of bonds with endothelial cell-derived ligands and subsequent leukocyte rolling. Upon ligand binding, L-selectin clusters and subsequently promotes β1- and β2-integrin activation (47;48) and the mobilization of chemokine receptors (e.g., CXCR4) to the cell surface (49). The interaction of L-selectin with addressin is essential for the tethering and rolling of lymphocytes in HEVs (36;50;51). (ii) Chemoattractants [e.g., secondary lymphoid tissue chemokine (SLC; CCL21)] released from the endothelium activate the leukocytes. (iii) The leukocytes adhere to the endothelium through interactions between immunoglobulin superfamily members [e.g., intercellular adhesion molecule 1 (ICAM-1)] on the leukocyte and β2-integrins (e.g., lymphocyte function antigen 1 (LFA-1) and Mac-1) on the endothelium and leukocyte rolling subsequent arrests. The functions of L-selectin and ICAM-1 in leukocyte rolling and emigration are dependent on, and overlap, each other (52;53). (iv) The leukocytes undergo transendothelial emigration from the postcapillary HEVs to the site of infection (54). L-selectin is essential for directing naïve L-selectinhigh lymphocytes to sites of acute and chronic inflammation where naïve T cells can become antigen activated (31;36;55-58). Leukocyte migration into sites of inflammation is diminished in L-selectin-deficient (Sell-/-) mice (46;55;59;60). Sell-/- mice have impaired T cell responses due to the inability of T cells to home into the PLN (45;46;59-63). Regulatory T (Treg; CD25+Foxp3+CD4+) cells require L-selectin for normal tissue distribution (64). In Sell-/- mice, the number of Treg cells in the PLN was reduced by 90%, with a concomitant increase of Treg cell numbers in the spleen (64). L-selectin expression on natural killer (NK) cells mediates the recruitment of natural killer (NK) cells to draining lymph nodes as well as plasmacytoid dendritic cell-induced NK cell migration (65;66). L-selectin is differentially expressed during the different stages of NK cell maturation. As a result, NK cells can be divided into three groups based on their steps in the maturation process as well as the expression of L-selectin: CD56bright, CD56dim CD62L+, and CD56dim CD62L− (67). CD62L+ NK cells produced more IFN-γ than CD62L− NK cells in response to IL-2 and IL-12 stimulation; however hepatic CD62L+ NK cells produced less IFN-γ than their CD62L− counterparts (68). Hepatic and splenic CD62L+ NK cells possess more potent cytotoxic function than CD62L− NK cells. L-selectin is necessary for NK cell maturation and accumulation in the liver after antigen stimulation. After treatment with poly I:C or adenovirus infection, CD62L+ NK cell frequency and numbers increased in the liver due to alterations in the differentiation from CD62L− NK cells, as well as enhanced NK cell recruitment from the periphery (68). L-selectin also functions in intracellular signaling. Antibody cross-linking activates L-selectin on human neutrophils and cell lines results in an increase in intracellular calcium (69;70), superoxide generation (69), and phosphorylation and activation of signaling proteins (71-73). In addition, sulfatide ligation of L-selectin increased TNF-α and IL-8 expression in human neutrophils (70). Within minutes of L-selectin crosslinking, p38 MAPK is phosphorylated; inhibition of p38 prevents L-selectin-dependent neutrophil shape change, adhesion, and degranulation (74;75). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | The frequency of leukocytes and neutrophils in the peripheral blood of the Sell-/- mice were comparable to wild-type mice (59). In addition, the percentage of B and T cells in the blood, bone marrow, and PLNs were comparable between the Sell-/- and wild-type mice (59). The gross architecture of the spleen, mesenteric LN, and Peyer’s patches were also comparable to those in wild-type mice (59). PLNs in the Sell-/- mice are smaller than those in wild-type mice (59). Reduced expression of L-selectin on Sell+/- T cells resulted in reduced numbers of rolling cells, increased rolling velocity and reduced trafficking to the PLN (29). The size and lymphocyte content of the mesenteric LN, thymus, and spleen were normal in the Sell-/- mice (59). In contrast, another study noted that Sell-/- spleens were increased in size compared to wild-type mice (35). Sell-/- mice exhibited loss of neutrophil migration to the site of a delay-type hypersensitivity (DTH) reaction as well as impaired DTH responses to KLH/CFA (45). Upon immunization of Sell-/- mice with KLH/CFA, draining lymph nodes were smaller than those in immunized wild-type mice, but the gross architecture was comparable to that in wild-type mice. The percentage of CD4, CD8, and B220 cells after KLH/CFA immunization was comparable between the Sell-/- and wild-type mice. Five days post-KLH infection, the T cell proliferative response in draining lymph node cells was reduced in the Sell-/- mice compared that in wild-type mice. The production of IL-2, IL-4, and IFN-y in the Sell-/- mice was reduced compared to wild-type mice. The amount of anti-KLH IgM, total Ig, IgM, IgG1, IgG2a, and IgE levels were comparable between the Sell-/- and wild-type mice. The T cell-independent antibody response to DNP-Ficoll was increased in the Sell-/- mice compared to wild-type mice (76). The antigen-specific IgM response was higher in the Sell-/- mice compared to wild-type mice (76). In addition, the IgG1, IgG3, and IgA responses were also higher in the Sell-/- mice than those in the wild-type mice. Loss of L-selectin expression results in loss of naïve T cell homing to PLNs and reduced T cell responses (61-63). The phenotype of the dim_sum mice indicates that L-selectindim_sum has lost some function; however, antibody responses to T-dependent and T-independent antigens were not changed in dim_sum. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer dim_sum_pcr_F: AAGCATAGCACCTCTGGGCAATC dim_sum_pcr_R: GGGTCTAATGAACACCAGCAGGAAC Sequencing Primer dim_sum_seq_F: TGGACAGACTGTGCCTCAAG dim_sum_seq_R: GGAACAAACAAACAAACAAATGAAG |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 567 nucleotides is amplified (chromosome 1, + strand): 1 aagcatagca cctctgggca atctgcaggt acacaacaac taaataacgt tctatccagg Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Peter Jurek | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Ming Zeng, Bruce Beutler |