Phenotypic Mutation 'dim_sum' (pdf version)
List |< first << previous [record 16 of 16]
Alleledim_sum
Mutation Type splice acceptor site (9 bp from exon)
Chromosome1
Coordinate164,066,201 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Sell
Gene Name selectin, lymphocyte
Synonym(s) Lyam1, CD62L, L-selectin, Ly-m22, LECAM-1, Lyam-1, Ly-22, Lnhr
Chromosomal Location 164,061,982-164,084,181 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface adhesion molecule that belongs to a family of adhesion/homing receptors. The encoded protein contains a C-type lectin-like domain, a calcium-binding epidermal growth factor-like domain, and two short complement-like repeats. The gene product is required for binding and subsequent rolling of leucocytes on endothelial cells, facilitating their migration into secondary lymphoid organs and inflammation sites. Single-nucleotide polymorphisms in this gene have been associated with various diseases including immunoglobulin A nephropathy. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lack of lymphocyte binding to high endothelial venules of peripheral lymph nodes and defects in leukocyte rolling and neutrophil migration into the peritoneum following an inflammatory stimulus. Tumor cellsurvival is also reduced. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011346, NM_001164059; MGI:98279

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000027871] [ENSMUSP00000095099] [ENSMUSP00000142237] [ENSMUSP00000141365]
SMART Domains Protein: ENSMUSP00000027871
Gene: ENSMUSG00000026581

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
EGF 159 192 6.55e-1 SMART
CCP 197 254 1.09e-11 SMART
CCP 259 316 1.09e-11 SMART
transmembrane domain 333 355 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000095099
Gene: ENSMUSG00000026581

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
CCP 161 218 1.09e-11 SMART
CCP 223 280 1.09e-11 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000142237
Gene: ENSMUSG00000026581

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
CCP 161 218 1.09e-11 SMART
CCP 223 280 1.09e-11 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000141365
Gene: ENSMUSG00000026581

DomainStartEndE-ValueType
Pfam:Sushi 1 31 1.3e-4 PFAM
transmembrane domain 48 70 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS central memory CD4 T cells in CD4 T cells - decreased
FACS central memory CD8 T cells in CD8 T cells - decreased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
Penetrance  
Alleles Listed at MGI

All mutations/alleles(16) : Gene trapped(1) Targeted(15)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Sell APN 1 164065626 missense probably benign 0.04
IGL02466:Sell APN 1 164069063 splice site probably null
IGL02578:Sell APN 1 164065596 missense probably damaging 1.00
IGL03243:Sell APN 1 164065342 missense possibly damaging 0.94
dim_sum2 UTSW 1 164065661 nonsense probably null
R0125:Sell UTSW 1 164072105 splice site probably benign
R0800:Sell UTSW 1 164066201 unclassified probably null
R1900:Sell UTSW 1 164065338 missense probably damaging 1.00
R3848:Sell UTSW 1 164065661 nonsense probably null
R4553:Sell UTSW 1 164072116 missense probably benign 0.08
R4671:Sell UTSW 1 164065473 missense probably damaging 1.00
R4685:Sell UTSW 1 164066260 missense probably damaging 1.00
R4896:Sell UTSW 1 164063062 missense probably benign 0.02
R4970:Sell UTSW 1 164065318 missense possibly damaging 0.75
R5112:Sell UTSW 1 164065318 missense possibly damaging 0.75
R6549:Sell UTSW 1 164065629 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock gDNA
MMRRC Submission 038159-MU
Last Updated 2016-05-13 3:09 PM by Peter Jurek
Record Created 2014-10-14 8:02 PM by Ming Zeng
Record Posted 2015-02-10
Phenotypic Description

Figure 1. Dim_sum mice exhibit decreased frequencies of peripheral naïve CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine naïve CD4+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The dim-sum phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R0800, some of which showed a decreased frequency of naïve CD4+ T cells in CD4+ T cells in the peripheral blood (Figure 1).

 

Nature of Mutation

Figure 2. Linkage mapping of the reduced frequencies of peripheral naïve CD4+ T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 52 mutations (X-axis) identified in the G1 male of pedigree R0800. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 52 mutations. The reduced frequency of peripheral naïve CD4+ T cells was linked by continuous variable mapping to a mutation in Sell: a T to A transversion at base pair 164,066,201 (v38) on chromosome 1, or base pair 4,389 in the GenBank genomic region NC_000067 encoding Sell. Linkage was found with a recessive model of inheritance (P = 1.874 x 10-8), wherein 7 variant homozygotes departed phenotypically from 7 homozygous reference mice and 21 heterozygous mice (Figure 2).  A substantial semidominant effect was observed. The mutation affects a thymine base 9 nucleotides from exon 4 (out of 9 total exons). The mutation is predicted to affect the splice acceptor site of intron 3, resulting in skipping of the 108-base pair exon 4 (encoding amino acids 158-193). Splicing of exon 3 to exon 5 does not generate a frame-shift.

 

              <--exon 3      <--intron 3       <--exon 4-->         exon 5-->          <--exon 9

3861 ……GCTCTCTGCTACACAG ……taatctgcttaaag CCTCTTGCCAG……CAGTGTCAGTATG TGGTCCAGTGTGAG……GATCCATACTGA
 153 ……-A--L--C--Y--T--                  A--S--C--Q-……-Q--C--Q--Y-- V--V--Q--C--E-……-D--P--Y--*-
           correct                                deleted                       correct

 

Genomic numbering corresponds to NC_000067. The mutated nucleotide is indicated in red; the splice acceptor sequence is in blue.

Protein Prediction

Figure 3. Domain structure of L-selectin. The location of the dim_sum mutation is shown with a red asterisk. Abbreviations: SP, signal peptide; PRO, pro-peptide; Lectin, C-type lectin domain; EGF, epidermal growth factor-like; SCR, short consensus repeats; TM, transmembrane domain; TAIL, cytoplasmic tail. See the text for more details.

Figure 4. Structure of human E-selectin. The structure includes residues 22-301. The domains corresponding to Figure 3 are labeled. This image is interactive; click to rotate. UCSF Chimera was used to generate the figure based on PDB:4C16 and PDB:4CSY.

Sell encodes L-selectin (alternatively, CD62L), a lymphocyte-specific member of the selectin family that also includes endothelium-specific E-selectin (CD62E) and platelet-specific P-selectin (CD62P). L-selectin shares similar domains to the other selectins including an extracellular C-type (or calcium-dependent) lectin domain (amino acids 29-156, SMART), an epidermal growth factor (EGF)-like domain (amino acids 159-192), two short consensus repeats (SCRs) (amino acids 197-254 and 259-316), a transmembrane domain (amino acids 333-355), and a cytoplasmic tail (amino acids 356-372) (1-3). In addition, L-selectin has a signal peptide at amino acids 1-28; SMART) (1;3-5).

 

The C-type lectin domain of L-selectin recognizes the tetrasaccharide carbohydrate sialyl Lewis X (sLex) on selectin ligands and is essential for the adhesive function of the selectins (6-10). Most L-selectin ligands are glycoproteins [e.g., CD34, glycosylation-dependent cell adhesion molecule-1 (GlyCAM1), and Addressin (alternatively, MAdCAM-1)] that are synthesized by high endothelial venules (HEVs) in the peripheral and mesenteric lymph nodes (11). The EGF-like domain of L-selectin is proposed to have a structural role and facilitates protein-protein, cell-cell, or cell-matrix interactions during leukocyte emigration from HEVs (see Background for more information on leukocyte emigration) (4;12). The SCRs are homologous to domains in complement (C3b and C4b)-binding proteins that dampen the complement cascade at amplification junctures. Similar domains to the SCRs are found in the interleukin 2 receptor (13) and P2 glycoprotein I (14). The SCR domains have roles in cell adhesion. In addition, interactions between the lectin, EGF-like, and SCR domains modify ligand-binding specificity.

 

The cytoplasmic tail of L-selectin binds several proteins including α-actinin, the ezrin/radixin/moesin (ERM) family of proteins, and calmodulin (15). Anchoring of the cytoplasmic domain of L-selectin to the cytoskeleton through its interaction with α-actinin is essential for L-selectin-mediated rolling (16;17). Association of Arg357 and Lys362 of human L-selectin with ERM proteins is essential for the microvillar positioning of L-selectin; the localization of L-selectin on the tips of microvilli is an essential process for L-selectin-mediated tethering under flow (18;19). Association of the cytoplasmic tail (via residues Arg357, Leu358, Lys359, and Lys362 of human L-selectin) with calmodulin regulates the proteolytic cleavage of the ectodomain by blocking access of tumor necrosis factor (TNF)–α–converting enzyme [TACE; alternatively a disintegrin and metalloprotease (ADAM17); see the record for wavedx] to L-selectin (18;20;21); other proteases regulate the shedding of L-selectin, but they have not been identified (22). The extracellular domain of L-selectin is cleaved from the leukocyte cell surface soon after cell activation (23-26). Shedding of the extracellular domain also occurs upon induced and spontaneous apoptosis (27). Cleavage of L-selectin leads to a functionally active receptor and is proposed to facilitate leukocyte detachment from the endothelial surface before entry into tissues (28) as well as to regulate neutrophil and antigen-activated T cell migration by controlling L-selectin cell surface density; preventing homeostatic L-selectin cleavage resulted in a 2-fold increase in L-selectin expression by leukocytes (26;29-31). Blockade of L-selectin shedding using synthetic hydroxamic acid–based matrix metalloproteinase (MMP) inhibitors resulted in reduced rolling velocity, increased numbers of cells that tether from flow, and increased transit time through blood vessels in mice (32;33). Reduced L-selectin cleavage on antigen-stimulated lymphocytes facilitated their continued migration to peripheral lymph nodes (PLNs) and inhibited their short-term redirection to the spleen (26). A transgenic mouse expressing only a non-cleavable L-selectin (LΔP-selectin) on T lymphocytes revealed that L-selectin shedding does not regulate the trafficking of naïve T cells to PLNs, but regulates the entry of antigen-activated T cells (30). L-selectin shedding also regulated L-selectin–dependent β2-integrin activation in vitro and ICAM-1–dependent activation-induced arrest in mice (31) as well as neutrophil-dependent inflammation in rats (34).

 

Alternative splicing of Sell generates two L-selectin isoforms, L-selectin-v1 and L-selectin-v2 (19). The L-selectin-v1 transcript includes a new exon (exon v1) between exon 7 and 8 of Sell. The L-selectin-v2 transcript has an additional 51-bp sequence (exon v2) immediately following the 49-bp L-selectin-v1 insert. L-selectin-v1 and L-selectin-v2 differ from canonical L-selectin at the cytoplasmic tail: L-selectin-v1 has a distinct 24-amino acid sequence (amino acids 362-385) and the eight C-terminal residues of L-selectin-v1 (residues 378–385) are replaced with a distinct 10-amino acid sequence in L-selectin-v2 (residues 378–387) (19). The mRNA of the L-selectin isoforms exhibited a similar pattern of lymphoid organ expression as canonical L-selectin. In B and T lymphocytes and granulocytes L-selectin-v1 mRNA expression was <2% of that of canonical L-selectin, whereas L-selectin-v2 mRNA expression was ∼4–5%. All of the isoforms were localized to microvilli. L-selectin-v1 and L-selectin-v2 both undergo shedding, but the shedding efficiency differs among the isoforms (L-selectin-v1 > canonical L-selectin > L-selectin-v2) (19). L-selectin-v1 and L-selectin-v2 facilitate faster cell rolling than canonical L-selectin under flow conditions (19). Ligation of canonical L-selectin and L-selectin-v1, but not L-selectin-v2, resulted in p38 MAPK phosphorylation, indicating that the cytoplasmic tails of canonical L-selectin and L-selectin-v1 facilitate p38 activation.

 

The dim_sum mutation is predicted to result in deletion of exon 4. Exon 4 encodes amino acids 158-193 which encompasses the EGF-like domain. The expression and localization of the mutant protein has not been examined.

Expression/Localization

L-selectin is constitutively expressed on T cells, B cells, neutrophils, and monocytes (1;24;35-37). The expression of L-selectin is higher on circulating T cells than on B cells (29). L-selectin expression is downregulated by proinflammatory mediators (28;38), osmotic stress (39), and bacterial superantigens or toxins (40-42), which enhance the TACE-induce proteolytic cleavage and shedding of the ectodomain. L-selectin expression on T cells is upregulated up to 3-fold 24-48 hours after T cell receptor engagement followed by a steady decrease over the next 5 days (43;44).

Background
Figure 5. L-selectin functions in leukocyte/lymphocyte tethering and rolling. During an inflammatory response, L-selectin binds with sialyl Lewis X (sLex) on selectin ligands to mediate tethering to HEVs and leukocyte rolling. Chemokines subsequently activate integrins to promote adhesion of the leukocyte through interactions between mmunoglobulin superfamily members [e.g., intercellular adhesion molecule 1 (ICAM-1)] on the leukocyte and β2-integrins (e.g., lymphocyte function antigen 1 (LFA-1) and Mac-1) on the endothelium. The leukocytes then undergo transendothelial emigration from the postcapillary HEVs to the site of infection. See the text for more details. Abbreviations: LFA-1, lymphocyte function antigen 1; ICAM-1, intercellular adhesion molecule 1.

During an inflammatory response, leukocytes migrate to lymphoid organs (e.g., PLNs and Peyer’s patches) and inflamed tissues. The process of leukocyte emigration to tissues involves several steps. (i) Inflammatory cytokines activate endothelial cells, which then express adhesion molecules and synthesize chemokines that promote leukocyte rolling along the activated endothelium. L-selectin is a homing receptor that functions in the initial leukocyte tethering to the HEVs and leukocyte rolling on vascular endothelium (45;46). The interaction of L-selectin with abundant ligand results in continued breakage and reformation of bonds with endothelial cell-derived ligands and subsequent leukocyte rolling. Upon ligand binding, L-selectin clusters and subsequently promotes β1- and β2-integrin activation (47;48) and the mobilization of chemokine receptors (e.g., CXCR4) to the cell surface (49). The interaction of L-selectin with addressin is essential for the tethering and rolling of lymphocytes in HEVs (36;50;51). (ii) Chemoattractants [e.g., secondary lymphoid tissue chemokine (SLC; CCL21)] released from the endothelium activate the leukocytes.  (iii) The leukocytes adhere to the endothelium through interactions between immunoglobulin superfamily members [e.g., intercellular adhesion molecule 1 (ICAM-1)] on the leukocyte and β2-integrins (e.g., lymphocyte function antigen 1 (LFA-1) and Mac-1) on the endothelium and leukocyte rolling subsequent arrests. The functions of L-selectin and ICAM-1 in leukocyte rolling and emigration are dependent on, and overlap, each other (52;53). (iv) The leukocytes undergo transendothelial emigration from the postcapillary HEVs to the site of infection (54).

 

L-selectin is essential for directing naïve L-selectinhigh lymphocytes to sites of acute and chronic inflammation where naïve T cells can become antigen activated (31;36;55-58). Leukocyte migration into sites of inflammation is diminished in L-selectin-deficient (Sell-/-) mice (46;55;59;60). Sell-/- mice have impaired T cell responses due to the inability of T cells to home into the PLN (45;46;59-63). Regulatory T (Treg; CD25+Foxp3+CD4+) cells require L-selectin for normal tissue distribution (64). In Sell-/- mice, the number of Treg cells in the PLN was reduced by 90%, with a concomitant increase of Treg cell numbers in the spleen (64). L-selectin expression on natural killer (NK) cells mediates the recruitment of natural killer (NK) cells to draining lymph nodes as well as plasmacytoid dendritic cell-induced NK cell migration (65;66). L-selectin is differentially expressed during the different stages of NK cell maturation. As a result, NK cells can be divided into three groups based on their steps in the maturation process as well as the expression of L-selectin: CD56bright, CD56dim CD62L+, and CD56dim CD62L (67). CD62L+ NK cells produced more IFN-γ than CD62L NK cells in response to IL-2 and IL-12 stimulation; however hepatic CD62L+ NK cells produced less IFN-γ than their CD62L counterparts (68). Hepatic and splenic CD62L+ NK cells possess more potent cytotoxic function than CD62LNK cells. L-selectin is necessary for NK cell maturation and accumulation in the liver after antigen stimulation. After treatment with poly I:C or adenovirus infection, CD62L+ NK cell frequency and numbers increased in the liver due to alterations in the differentiation from CD62L NK cells, as well as enhanced NK cell recruitment from the periphery (68). L-selectin also functions in intracellular signaling. Antibody cross-linking activates L-selectin on human neutrophils and cell lines results in an increase in intracellular calcium (69;70), superoxide generation (69), and phosphorylation and activation of signaling proteins (71-73). In addition, sulfatide ligation of L-selectin increased TNF-α and IL-8 expression in human neutrophils (70). Within minutes of L-selectin crosslinking, p38 MAPK is phosphorylated; inhibition of p38 prevents L-selectin-dependent neutrophil shape change, adhesion, and degranulation (74;75).

Putative Mechanism

The frequency of leukocytes and neutrophils in the peripheral blood of the Sell-/- mice were comparable to wild-type mice (59). In addition, the percentage of B and T cells in the blood, bone marrow, and PLNs were comparable between the Sell-/- and wild-type mice (59). The gross architecture of the spleen, mesenteric LN, and Peyer’s patches were also comparable to those in wild-type mice (59). PLNs in the Sell-/- mice are smaller than those in wild-type mice (59). Reduced expression of L-selectin on Sell+/- T cells resulted in reduced numbers of rolling cells, increased rolling velocity and reduced trafficking to the PLN (29). The size and lymphocyte content of the mesenteric LN, thymus, and spleen were normal in the Sell-/- mice (59). In contrast, another study noted that Sell-/- spleens were increased in size compared to wild-type mice (35). Sell-/- mice exhibited loss of neutrophil migration to the site of a delay-type hypersensitivity (DTH) reaction as well as impaired DTH responses to KLH/CFA (45). Upon immunization of Sell-/- mice with KLH/CFA, draining lymph nodes were smaller than those in immunized wild-type mice, but the gross architecture was comparable to that in wild-type mice. The percentage of CD4, CD8, and B220 cells after KLH/CFA immunization was comparable between the Sell-/- and wild-type mice. Five days post-KLH infection, the T cell proliferative response in draining lymph node cells was reduced in the Sell-/- mice compared that in wild-type mice. The production of IL-2, IL-4, and IFN-y in the Sell-/- mice was reduced compared to wild-type mice. The amount of anti-KLH IgM, total Ig, IgM, IgG1, IgG2a, and IgE levels were comparable between the Sell-/- and wild-type mice. The T cell-independent antibody response to DNP-Ficoll was increased in the Sell-/- mice compared to wild-type mice (76). The antigen-specific IgM response was higher in the Sell-/- mice compared to wild-type mice (76). In addition, the IgG1, IgG3, and IgA responses were also higher in the Sell-/- mice than those in the wild-type mice. Loss of L-selectin expression results in loss of naïve T cell homing to PLNs and reduced T cell responses (61-63). The phenotype of the dim­­_sum mice indicates that L-selectindim_sum has lost some function; however, antibody responses to T-dependent and T-independent antigens were not changed in dim_sum.

Primers PCR Primer
dim_sum(F):5'- AAGCATAGCACCTCTGGGCAATC -3'
dim_sum(R):5'- GGGTCTAATGAACACCAGCAGGAAC -3'

Sequencing Primer
dim_sum_seq(F):5'- TGGACAGACTGTGCCTCAAG -3'
dim_sum_seq(R):5'- GGAACAAACAAACAAACAAATGAAG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsMing Zeng, Bruce Beutler
List |< first << previous [record 16 of 16]