Phenotypic Mutation 'cul-de-sac'

• Allele: cul-de-sac
• Mutation Type: nonsense
• Chromosome: 12
• Coordinate: 31,575,567 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Slc26a4
• Gene Name: solute carrier family 26, member 4
• Synonym(s): pendrin, Pds
• Chromosomal Location: 31,569,826-31,609,968 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Pendred syndrome, the most common form of syndromic deafness, an autosomal-recessive disease. It is highly homologous to the SLC26A3 gene; they have similar genomic structures and this gene is located 3' of the SLC26A3 gene. The encoded protein has homology to sulfate transporters. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous null mutants are completely deaf with vestibular dysfunction. Mutants show endolymphatic dilatation, degeneration of sensory cells and malformations of otoconia and otoconial membranes. They display unsteady gait and circling and head bobbing. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000001253]
• AlphaFold: Q9R155
• SMART Domains: Protein: ENSMUSP00000001253; Gene: ENSMUSG00000020651; AA Change: C706*

Domain	Start	End	E-Value	Type
low complexity region	33	47	N/A	INTRINSIC
Pfam:Sulfate_transp	84	485	1e-105	PFAM
low complexity region	492	507	N/A	INTRINSIC
Pfam:STAS	536	725	1.4e-42	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• Last Updated: 2019-09-04 9:48 PM by Emre Turer
• Record Created: 2014-10-24 10:18 AM by Jeff SoRelle
• Record Posted: 2016-09-19
• Science Writers: Anne Murray
• Illustrators: Peter Jurek, Katherine Timer
• Authors: Jeff SoRelle, Emre Turer, Noelle Hutchins, William McAlpine

Accession Number

NCBI RefSeq: NM_011867; MGI:1346029

Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (ENU) (2) Gene trapped (1) Spontaneous (1) Targeted (6)

Phenotypic Description

Figure 1. Vesitibular phenotype of the cul-de-sac mice.

Figure 2. A homozygous cul-de-sac mouse exhibited weight loss 10 days after exposure to DSS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The cul-de-sac phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1301, some of which showed head tossing, head tilting, and circling (Figure 1). One mouse also was susceptible to a low dose of DSS (1%) showing weight loss 10 days after DSS treatment (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the DSS-induced colitis phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R1301. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 57 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Slc26a4:  a T to A transversion at base pair 31,525,568 (v38) on chromosome 12, or base pair 35,072 in the GenBank genomic region NC_000078 encoding Slc26a4. The strongest association was found with a recessive model of linkage to the normalized DSS Day 10 reading, wherein one variant homozygote departed phenotypically from 13 homozygous reference mice and 15 heterozygous mice with a P value of 8.731 x 10^-7 (Figure 3).  

The mutation corresponds to residue 2,333 in the mRNA sequence NM_011867 within exon 19 of 21 total exons.

2316 GAAAAGATGGAGCAGTGTGGGTTCTTTGATGAC 701  -E--K--M--E--Q--C--G--F--F--D--D-

The mutated nucleotide is indicated in red.  The mutation results in substitution of cysteine (C) 706 to a premature stop codon in the pendrin protein.

Protein Prediction

Figure 4. Domain structure and topology of pendrin. Pendrin has 12 transmembrane domains and a STAS box at the C-terminus. The N- and C-termini of pendrin are within the cytoplasm. The location of the cul-de-sac mutation (C706*) is indicated.

Slc26a4 encodes pendrin, a 780-amino acid member of solute carrier (SLC) family 26 (Figure 4). The gene products include passive transporters, symporters, and antiporters that transport a wide variety of substrates, including amino acids, oligopeptides, glucose, inorganic cations and anions, bile salts, carboxylate, acetyl coenzyme A, essential metals, neurotransmitters, vitamins, fatty acids, lipids, nucleosides, ammonium, choline, thyroid hormone, and urea (1). SLC family members have a variable number of transmembrane domains; pendrin is predicted to have 12 transmembrane domains (2) with a cytoplasmic N- and C-termini. The C-terminus of pendrin has a STAS (sulfate transporter antagonist of anti-sigma factor) domain (amino acids 536-725) (3). The STAS domain is proposed to mediate NTP binding and/or hydrolysis as well as to regulate anion transport by sensing intracellular concentrations of GTP and/or ATP (3).

The Slc26a4 mutation in cul-de-sac results in substitution of cysteine (C) 706 to a premature stop codon in the pendrin protein. Cys706 resides in the STAS domain.

For more information about Slc26a4, please see the record for discobolus.

Putative Mechanism

Pendrin mediates Cl⁻/I⁻ or I⁻/HCO₃⁻ exchange in the salivary duct (4), thyrocytes (5), and renal collecting duct (6;7). In the inner ear, pendrin conditions the endolymph to permit the proper function of sensory cells by facilitating Cl⁻/HCO₃⁻ exchange. Mutations in SLC26A4 are linked to autosomal recessive deafness 4 with enlarged vestibular aqueduct (DFNB4 with EVA; OMIM: #600791) and Pendred syndrome (alternatively, Mondini-like dysplasia of the cochlea and enlargement of the thyroid; OMIM: #274600) (8-14). Slc26a4-deficient (Slc26a4^-/-) mice develop EVA and Mondini-like dysplasia of the cochlea similar to that observed in Pendred syndrome in humans. The Slc26a4^-/- mice are unable to hear and exhibit circling and head bobbing indicative of vestibular defects.

The vestibular phenotype of the cul-de-sac mice mimics that of the Slc26a4 mutant models, indicating that pendrin^cul-de-sac function is defective in the mice. Expression and localization of pendrin^cul-de-sac have not been examined. The putative colitis phenotype in the cul-de-sac mice has not been confirmed.

Primers

PCR Primer
cul-de-sac_pcr_F: CCAGAGGTTAAGCTGGGTTTCAGAC
cul-de-sac_pcr_R: CATTAGGCAAAGCTGCTCAAGCAC

Sequencing Primer
cul-de-sac_seq_F: TAAGCTGGGTTTCAGACTAGAG
cul-de-sac_seq_R: gctgggggatggaatcac

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 650 nucleotides is amplified (chromosome 12, - strand):

1   cattaggcaa agctgctcaa gcacctggtg gcagcagttt gattactcca gaggctttgc
61  ccaggcagga ctggtggtgc aaggccccac ttcatgctct catctgttaa tcagtgaatt
121 ctggtcaggt atgtgtgtgt gtgcagtctc cctggcctct ttgagtcaga cagctcccac
181 cggccagaga aaatactctc tctgagagat tcatggctgt gaactagcgg ccaagctcac
241 agcagctggg ggatggaatc actggcttaa caagaccacc gagtcagact gcaagcaact
301 gtgggatcgc cattctgcaa gctgctggca aataagccat gatagagcag gctcacagtt
361 tagacatgag aacatcatga agagaatgca ctacaaaagc tgatattata aaatcctttt
421 tttttcccct accaacttta aaatttttcc tttgcagatg atgtgttaga aaagatggag
481 cagtgtgggt tctttgatga caacattaga aaggacagat tctttctgac ggttcatgat
541 gcaatcctcc atctgcagaa ccaggtcaaa tccagagaag gccaggattc cctgctagag
601 acggtaaaca tttcacctaa ctctagtctg aaacccagct taacctctgg 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. He, L., Vasiliou, K., and Nebert, D. W. (2009) Analysis and Update of the Human Solute Carrier (SLC) Gene Superfamily. Hum Genomics. 3, 195-206.

  2. Li, J., Xia, F., and Reithmeier, R. A. (2014) N-Glycosylation and Topology of the Human SLC26 Family of Anion Transport Membrane Proteins. Am J Physiol Cell Physiol. 306, C943-60.

  3. Aravind, L., and Koonin, E. V. (2000) The STAS Domain - a Link between Anion Transporters and Antisigma-Factor Antagonists. Curr Biol. 10, R53-5.

  4. Shcheynikov, N., Yang, D., Wang, Y., Zeng, W., Karniski, L. P., So, I., Wall, S. M., and Muallem, S. (2008) The Slc26a4 Transporter Functions as an Electroneutral Cl-/I-/HCO3- Exchanger: Role of Slc26a4 and Slc26a6 in I- and HCO3- Secretion and in Regulation of CFTR in the Parotid Duct. J Physiol. 586, 3813-3824.

  5. Pesce, L., Bizhanova, A., Caraballo, J. C., Westphal, W., Butti, M. L., Comellas, A., and Kopp, P. (2012) TSH Regulates Pendrin Membrane Abundance and Enhances Iodide Efflux in Thyroid Cells. Endocrinology. 153, 512-521.

  6. Royaux, I. E., Wall, S. M., Karniski, L. P., Everett, L. A., Suzuki, K., Knepper, M. A., and Green, E. D. (2001) Pendrin, Encoded by the Pendred Syndrome Gene, Resides in the Apical Region of Renal Intercalated Cells and Mediates Bicarbonate Secretion. Proc Natl Acad Sci U S A. 98, 4221-4226.

  7. Kim, Y. H., Pham, T. D., Zheng, W., Hong, S., Baylis, C., Pech, V., Beierwaltes, W. H., Farley, D. B., Braverman, L. E., Verlander, J. W., and Wall, S. M. (2009) Role of Pendrin in Iodide Balance: Going with the Flow. Am J Physiol Renal Physiol. 297, F1069-79.

  8. Albert, S., Blons, H., Jonard, L., Feldmann, D., Chauvin, P., Loundon, N., Sergent-Allaoui, A., Houang, M., Joannard, A., Schmerber, S., Delobel, B., Leman, J., Journel, H., Catros, H., Dollfus, H., Eliot, M. M., David, A., Calais, C., Drouin-Garraud, V., Obstoy, M. F., Tran Ba Huy, P., Lacombe, D., Duriez, F., Francannet, C., Bitoun, P., Petit, C., Garabedian, E. N., Couderc, R., Marlin, S., and Denoyelle, F. (2006) SLC26A4 Gene is Frequently Involved in Nonsyndromic Hearing Impairment with Enlarged Vestibular Aqueduct in Caucasian Populations. Eur J Hum Genet. 14, 773-779.

  9. Anwar, S., Riazuddin, S., Ahmed, Z. M., Tasneem, S., Ateeq-ul-Jaleel, Khan, S. Y., Griffith, A. J., Friedman, T. B., and Riazuddin, S. (2009) SLC26A4 Mutation Spectrum Associated with DFNB4 Deafness and Pendred's Syndrome in Pakistanis. J Hum Genet. 54, 266-270.

  10. Li, X. C., Everett, L. A., Lalwani, A. K., Desmukh, D., Friedman, T. B., Green, E. D., and Wilcox, E. R. (1998) A Mutation in PDS Causes Non-Syndromic Recessive Deafness. Nat Genet. 18, 215-217.

  11. Choi, B. Y., Stewart, A. K., Madeo, A. C., Pryor, S. P., Lenhard, S., Kittles, R., Eisenman, D., Kim, H. J., Niparko, J., Thomsen, J., Arnos, K. S., Nance, W. E., King, K. A., Zalewski, C. K., Brewer, C. C., Shawker, T., Reynolds, J. C., Butman, J. A., Karniski, L. P., Alper, S. L., and Griffith, A. J. (2009) Hypo-Functional SLC26A4 Variants Associated with Nonsyndromic Hearing Loss and Enlargement of the Vestibular Aqueduct: Genotype-Phenotype Correlation Or Coincidental Polymorphisms? Hum Mutat. 30, 599-608.

  12. Campbell, C., Cucci, R. A., Prasad, S., Green, G. E., Edeal, J. B., Galer, C. E., Karniski, L. P., Sheffield, V. C., and Smith, R. J. (2001) Pendred Syndrome, DFNB4, and PDS/SLC26A4 Identification of Eight Novel Mutations and Possible Genotype-Phenotype Correlations. Hum Mutat. 17, 403-411.

  13. Everett, L. A., Glaser, B., Beck, J. C., Idol, J. R., Buchs, A., Heyman, M., Adawi, F., Hazani, E., Nassir, E., Baxevanis, A. D., Sheffield, V. C., and Green, E. D. (1997) Pendred Syndrome is Caused by Mutations in a Putative Sulphate Transporter Gene (PDS). Nat Genet. 17, 411-422.

  14. Coyle, B., Reardon, W., Herbrick, J. A., Tsui, L. C., Gausden, E., Lee, J., Coffey, R., Grueters, A., Grossman4, A., Phelps, P. D., Luxon, L., Kendall-Taylor, P., Scherer, S. W., and Trembath, R. C. (1998) Molecular Analysis of the PDS Gene in Pendred Syndrome. Hum Mol Genet. 7, 1105-1112.