Phenotypic Mutation 'cul-de-sac' (pdf version)
List |< first << previous [record 97 of 511] next >> last >|
Allelecul-de-sac
Mutation Type nonsense
Chromosome12
Coordinate31,525,568 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Slc26a4
Gene Name solute carrier family 26, member 4
Synonym(s) Pds, pendrin
Chromosomal Location 31,519,827-31,559,969 bp (-)
MGI Phenotype Homozygous null mutants are completely deaf with vestibular dysfunction. Mutants show endolymphatic dilatation, degeneration of sensory cells and malformations of otoconia and otoconial membranes. They display unsteady gait and circling and head bobbing.
Accession Number

NCBI RefSeq: NM_011867; MGI:1346029

Mapped Yes 
Amino Acid Change Cysteine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted sequence gene model
SMART Domains Protein: ENSMUSP00000001253
Gene: ENSMUSG00000020651
AA Change: C706*

DomainStartEndE-ValueType
low complexity region 33 47 N/A INTRINSIC
Pfam:Sulfate_transp 84 485 1e-105 PFAM
low complexity region 492 507 N/A INTRINSIC
Pfam:STAS 536 725 1.4e-42 PFAM
Predicted Effect probably null
Phenotypic Category behavior/neurological, DSS: sensitive day 10, hearing/vestibular/ear
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (ENU) (2) Gene trapped (1) Spontaneous (1) Targeted (6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Slc26a4 APN 12 31528854 splice site 0.00
IGL01763:Slc26a4 APN 12 31528854 splice site 0.00
IGL01778:Slc26a4 APN 12 31528854 splice site 0.00
IGL01779:Slc26a4 APN 12 31528854 splice site 0.00
IGL01872:Slc26a4 APN 12 31539203 missense probably benign 0.09
IGL02016:Slc26a4 APN 12 31535667 missense probably damaging 1.00
IGL02184:Slc26a4 APN 12 31549949 missense probably damaging 1.00
IGL02267:Slc26a4 APN 12 31528854 splice site 0.00
IGL02270:Slc26a4 APN 12 31528854 splice site 0.00
IGL02271:Slc26a4 APN 12 31528854 splice site 0.00
IGL02347:Slc26a4 APN 12 31528854 splice site 0.00
IGL02543:Slc26a4 APN 12 31528689 missense possibly damaging 0.79
IGL02803:Slc26a4 APN 12 31522527 splice site 0.00
IGL02885:Slc26a4 APN 12 31525476 missense probably benign 0.00
IGL02974:Slc26a4 APN 12 31529554 missense probably damaging 1.00
IGL03037:Slc26a4 APN 12 31531687 splice site 0.00
discobolus UTSW 12 31540533 nonsense probably null
R0152:Slc26a4 UTSW 12 31529498 missense probably damaging 1.00
R0677:Slc26a4 UTSW 12 31549911 critical splice donor site probably null
R0961:Slc26a4 UTSW 12 31535619 missense probably benign 0.00
R1025:Slc26a4 UTSW 12 31528737 missense probably damaging 1.00
R1301:Slc26a4 UTSW 12 31525568 nonsense probably null
R1729:Slc26a4 UTSW 12 31544494 missense possibly damaging 0.95
R2258:Slc26a4 UTSW 12 31525610 splice acceptor site probably benign
R2321:Slc26a4 UTSW 12 31540544 missense probably damaging 1.00
R3967:Slc26a4 UTSW 12 31528687 missense probably damaging 1.00
R3970:Slc26a4 UTSW 12 31528687 missense probably damaging 1.00
R4007:Slc26a4 UTSW 12 31540533 nonsense probably null
R4370:Slc26a4 UTSW 12 31529476 missense probably benign 0.01
R4647:Slc26a4 UTSW 12 31540526 missense possibly damaging 0.90
R4648:Slc26a4 UTSW 12 31540526 missense possibly damaging 0.90
R5816:Slc26a4 UTSW 12 31528685 missense probably damaging 1.00
R5932:Slc26a4 UTSW 12 31535249 unclassified probably null
X0022:Slc26a4 UTSW 12 31535687 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
Repository
Last Updated 03/08/2017 11:11 AM by Anne Murray
Record Created 10/24/2014 10:18 AM by Jeff SoRelle
Record Posted 09/19/2016
Phenotypic Description
Figure 1. Vesitibular phenotype of the cul-de-sac mice.

Figure 2. A homozygous cul-de-sac mouse exhibited weight loss 10 days after exposure to DSS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The cul-de-sac phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1301, some of which showed head tossing, head tilting, and circling (Figure 1). One mouse also was susceptible to a low dose of DSS (1%) showing weight loss 10 days after DSS treatment (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the DSS-induced colitis phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R1301. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 57 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Slc26a4:  a T to A transversion at base pair 31,525,568 (v38) on chromosome 12, or base pair 35,072 in the GenBank genomic region NC_000078 encoding Slc26a4. The strongest association was found with a recessive model of linkage to the normalized DSS Day 10 reading, wherein one variant homozygote departed phenotypically from 13 homozygous reference mice and 15 heterozygous mice with a P value of 8.731 x 10-7 (Figure 3).  

 

The mutation corresponds to residue 2,333 in the mRNA sequence NM_011867 within exon 19 of 21 total exons.


 
2316 GAAAAGATGGAGCAGTGTGGGTTCTTTGATGAC
701  -E--K--M--E--Q--C--G--F--F--D--D-

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of cysteine (C) 706 to a premature stop codon in the pendrin protein.

Protein Prediction
Figure 4. Domain structure and topology of pendrin. Pendrin has 12 transmembrane domains and a STAS box at the C-terminus. The N- and C-termini of pendrin are within the cytoplasm. The location of the cul-de-sac mutation (C706*) is indicated.

Slc26a4 encodes pendrin, a 780-amino acid member of solute carrier (SLC) family 26 (Figure 4). The gene products include passive transporters, symporters, and antiporters that transport a wide variety of substrates, including amino acids, oligopeptides, glucose, inorganic cations and anions, bile salts, carboxylate, acetyl coenzyme A, essential metals, neurotransmitters, vitamins, fatty acids, lipids, nucleosides, ammonium, choline, thyroid hormone, and urea (1). SLC family members have a variable number of transmembrane domains; pendrin is predicted to have 12 transmembrane domains (2) with a cytoplasmic N- and C-termini. The C-terminus of pendrin has a STAS (sulfate transporter antagonist of anti-sigma factor) domain (amino acids 536-725) (3). The STAS domain is proposed to mediate NTP binding and/or hydrolysis as well as to regulate anion transport by sensing intracellular concentrations of GTP and/or ATP (3).

 

The Slc26a4 mutation in cul-de-sac results in substitution of cysteine (C) 706 to a premature stop codon in the pendrin protein. Cys706 resides in the STAS domain.

 

For more information about Slc26a4, please see the record for discobolus.

Putative Mechanism

Pendrin mediates Cl/I or I/HCO3 exchange in the salivary duct (4), thyrocytes (5), and renal collecting duct (6;7). In the inner ear, pendrin conditions the endolymph to permit the proper function of sensory cells by facilitating Cl/HCO3 exchange. Mutations in SLC26A4 are linked to autosomal recessive deafness 4 with enlarged vestibular aqueduct (DFNB4 with EVA; OMIM: #600791) and Pendred syndrome (alternatively, Mondini-like dysplasia of the cochlea and enlargement of the thyroid; OMIM: #274600) (8-14). Slc26a4-deficient (Slc26a4-/-) mice develop EVA and Mondini-like dysplasia of the cochlea similar to that observed in Pendred syndrome in humans. The Slc26a4-/- mice are unable to hear and exhibit circling and head bobbing indicative of vestibular defects.

 

The vestibular phenotype of the cul-de-sac mice mimics that of the Slc26a4 mutant models, indicating that pendrincul-de-sac function is defective in the mice. Expression and localization of pendrincul-de-sac have not been examined. The putative colitis phenotype in the cul-de-sac mice has not been confirmed.

Primers PCR Primer
cul-de-sac(F):5'- CCAGAGGTTAAGCTGGGTTTCAGAC -3'
cul-de-sac(R):5'- CATTAGGCAAAGCTGCTCAAGCAC -3'

Sequencing Primer
cul-de-sac_seq(F):5'- TAAGCTGGGTTTCAGACTAGAG -3'
cul-de-sac_seq(R):5'- gctgggggatggaatcac -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek, Katherine Timer
AuthorsJeff SoRelle, Emre Turer, Noelle Hutchins, William McAlpine
List |< first << previous [record 97 of 511] next >> last >|