Phenotypic Mutation 'cotton' (pdf version)
Allelecotton
Mutation Type missense
Chromosome7
Coordinate56,185,716 bp (GRCm39)
Base Change T ⇒ A (forward strand)
Gene Oca2
Gene Name oculocutaneous albinism II
Synonym(s) p, D7H15S12, D7H15S12
Chromosomal Location 55,889,508-56,186,266 bp (+) (GRCm39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of the mouse p (pink-eyed dilution) gene. The encoded protein is believed to be an integral membrane protein involved in small molecule transport, specifically tyrosine, which is a precursor to melanin synthesis. It is involved in mammalian pigmentation, where it may control skin color variation and act as a determinant of brown or blue eye color. Mutations in this gene result in type 2 oculocutaneous albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mutations generally result in varying degrees of coat and eye pigment dilution. Specific alleles produce cleft palate, reproductive, endocrine or neurological disorders, and/or lethality. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_021879; MGI:97454

MappedNo 
Amino Acid Change Methionine changed to Lysine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000032633] [ENSMUSP00000119529] [ENSMUSP00000119099]
AlphaFold Q62052
SMART Domains Protein: ENSMUSP00000032633
Gene: ENSMUSG00000030450
AA Change: M814K

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ArsB 319 558 2e-10 PFAM
Pfam:CitMHS 337 770 2e-49 PFAM
Pfam:ArsB 562 827 8.9e-9 PFAM
Pfam:Na_sulph_symp 573 832 6e-13 PFAM
Predicted Effect probably benign

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
(Using ENSMUST00000032633)
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000119099
Gene: ENSMUSG00000030450

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Meta Mutation Damage Score 0.0898 question?
Is this an essential gene? Probably nonessential (E-score: 0.106) question?
Phenotypic Category Autosomal Recessive
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(88) : Chemically and radiation induced(3) Chemically induced (ENU)(11) Chemically induced (other)(1) Gene trapped(1) Radiation induced(48) Spontaneous(20) Targeted(3) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Oca2 APN 7 55930594 missense probably damaging 0.99
IGL01022:Oca2 APN 7 55974504 missense probably damaging 1.00
IGL01666:Oca2 APN 7 55964559 splice site probably null
IGL02157:Oca2 APN 7 55974545 splice site probably null
IGL02213:Oca2 APN 7 55971232 splice site probably benign
IGL02314:Oca2 APN 7 56006899 missense probably benign 0.00
IGL03083:Oca2 APN 7 55945232 missense probably benign 0.28
IGL03356:Oca2 APN 7 56185716 missense probably benign 0.01
charbon UTSW 7 55966153 missense probably damaging 1.00
cutworm UTSW 7 55966168 missense probably damaging 1.00
Dirk UTSW 7 56185716 missense probably benign 0.00
draco1 UTSW 7 56073100 missense probably benign 0.00
faded UTSW 7 55974409 missense probably benign 0.19
hardy UTSW 7 55945208 missense probably damaging 1.00
narwhal UTSW 7 55945246 nonsense probably null
quicksilver UTSW 7 55974409 missense probably benign 0.19
renesmee UTSW 7 56185716 missense probably benign 0.00
slush UTSW 7 55927189 critical splice donor site probably null
snowflake UTSW 7 55974428 missense probably damaging 1.00
whitemouse UTSW 7 56064179 missense probably damaging 1.00
R0440:Oca2 UTSW 7 56073100 missense probably benign 0.00
R1067:Oca2 UTSW 7 55966141 missense probably damaging 1.00
R1349:Oca2 UTSW 7 56185716 missense probably benign 0.00
R1372:Oca2 UTSW 7 56185716 missense probably benign 0.00
R1457:Oca2 UTSW 7 55971269 missense probably damaging 1.00
R1737:Oca2 UTSW 7 55978533 missense probably damaging 1.00
R1802:Oca2 UTSW 7 55904728 missense possibly damaging 0.96
R1957:Oca2 UTSW 7 55971246 missense possibly damaging 0.82
R1966:Oca2 UTSW 7 56064215 missense probably damaging 0.99
R2082:Oca2 UTSW 7 55946885 missense probably benign 0.01
R2229:Oca2 UTSW 7 56006903 missense probably benign 0.11
R4120:Oca2 UTSW 7 55904630 missense probably damaging 1.00
R4192:Oca2 UTSW 7 55946997 missense probably damaging 1.00
R4405:Oca2 UTSW 7 56064182 missense possibly damaging 0.63
R4654:Oca2 UTSW 7 55978560 missense probably benign 0.44
R4701:Oca2 UTSW 7 55904750 missense probably benign 0.00
R4887:Oca2 UTSW 7 55980106 nonsense probably null
R5053:Oca2 UTSW 7 55973328 missense probably benign 0.02
R5215:Oca2 UTSW 7 55945246 nonsense probably null
R5430:Oca2 UTSW 7 55945208 missense probably damaging 1.00
R5677:Oca2 UTSW 7 56064210 missense probably damaging 1.00
R6416:Oca2 UTSW 7 55978515 missense probably benign 0.44
R6645:Oca2 UTSW 7 55964522 missense probably benign 0.21
R7257:Oca2 UTSW 7 55929286 intron probably benign
R7409:Oca2 UTSW 7 56064145 missense probably benign 0.00
R7530:Oca2 UTSW 7 55981720 missense probably damaging 0.99
R7820:Oca2 UTSW 7 55981713 missense probably damaging 1.00
R9043:Oca2 UTSW 7 55927189 critical splice donor site probably null
R9153:Oca2 UTSW 7 55943586 missense probably benign 0.00
R9205:Oca2 UTSW 7 55966168 missense probably damaging 1.00
R9681:Oca2 UTSW 7 55943623 missense probably null 1.00
Z1088:Oca2 UTSW 7 55980123 missense probably null 0.83
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 038239-MU
Last Updated 2018-10-14 4:02 PM by Anne Murray
Record Created 2014-10-31 2:56 PM by Lauren Prince
Record Posted 2014-12-12
Phenotypic Description
Figure 1. Cotton is a hypopigmentation mutant. The cotton mice have gray coats and red eyes.

The cotton phenotype was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R1349, some of which exhibited a light gray coat and red eyes (Figure 1). Other phenotypes associated with Oca2 mutations such as slight susceptibility to L. monocytogenes (see the records for charbon and quicksilver) have not been examined in cotton mice.
Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 46 mutations.  Among these, only one affected a gene with known effects on pigmentation, Oca2. The mutation in Oca2 was presumed to be causative because the cotton hypopigmentation phenotype mimics other known alleles of Oca2 (see MGI for a list of Oca2 alleles as well as the Beutler Oca2 alleles: quicksilver, faded, charbon, draco1, snowflake, and whitemouse). The Oca2 mutation is a T to A transversion at base pair 56,535,968 (v38) on chromosome 7, or base pair 296,376 in the GenBank genomic region NC_000073.  The mutation corresponds to residue 2,571 in the mRNA sequence NM_021879 within exon 4 of 24 total exons.

2555 TTCCCTGTGATGCTCATGTCCTGCACCATTGGG

809  -F--P--V--M--L--M--S--C--T--I--G-

The mutated nucleotide is indicated in red.  The mutation results in a methionine (M) to lysine (K) substitution at position 814 (M814K) in the OCA2 protein, and is strongly predicted by Polyphen-2 to be benign (score = 0.005).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 2. Domain organization of the OCA2 protein. (A) Topography. (B) Domain structure. The cotton mutation results in a methionine to lysine substitution at amino acid 814 in the OCA2 protein. Other mutations found in OCA2  are noted in red. This image is interactive. Click on the mutations for more specific information.

OCA2 is a 110-kDa twelve transmembrane-spanning protein (Figure 2) that exhibits homology to a number of bacterial transporters (1). The exact function of OCA2 in melanocytes is unknown. The cotton mutation occurs within the twelfth (of 12 total) transmembrane domain.

Please see the record quicksilver for information about Oca2.

Putative Mechanism

Mutations in Oca2 are known to cause a variable reduction of eumelanin (black-brown) pigment and altered morphology of black pigment granules (eumelanosomes), but have little effect on pheomelanin (yellow-red) pigment (2;3). For example, mice with null alleles of Oca2 have very little to no eumelanin in their coat and eyes, resulting in a hypopigmentation phenotype: light grey fur with pink eyes on a nonagouti background (e.g., C57BL/6J), and cream-colored mice on an agouti background (4;5). The null mice have a reduced number of very small eumelanosomes in pigmented tissue with a concomitant decrease in the expression levels of melanosomal proteins (e.g., tyrosinase; see the record for ghost). The light coat color of cotton mice suggests a reduced function of the OCA2 protein in these animals.

Primers PCR Primer
cotton_pcr_F: TTCGGTATGTGTGTCTGTATGCC
cotton_pcr_R: TCATCCTTTTCTTCTTCGGAGGT

Sequencing Primer
cotton_seq_F: GCCTGTCCTTTCTTCATTCC
cotton_seq_R: AAGCCTTCCACCTGATGCTG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 452 nucleotides is amplified (chromosome 7, + strand):


1   ttcggtatgt gtgtctgtat gcctgtcctt tcttcattcc ctcattgatc tactctggtt
61  tccaggacct agccatatga gttatggcaa aagtatttac aacccgaatg aaaaatcaag
121 ttttccttac gtaaagattc tggggccaca ttcttctgca atacataaca tataaagagt
181 ctgcatctct tagttctctc tgcataccag aggccataac tgtctttctg tttttcaggt
241 tgggcttccc tgtgatgctc atgtcctgca ccattgggat gtgctatctc ctgattgctc
301 acattgtggt gggatggaat taacagccag ccagccatca tttgcagacc aagagagact
361 tgatcagcat cagcatcagc atcagcatca gcatcagcat cagcatcagg tggaaggctt
421 ccccacagca cctccgaaga agaaaaggat ga


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
  4. Silvers, W. K. (1979) The Coat Colors of Mice. .
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsLauren Prince, Jamie Russell