Phenotypic Mutation 'cotton' (pdf version)
List |< first << previous [record 76 of 511] next >> last >|
Allelecotton
Mutation Type missense
Chromosome7
Coordinate56,535,968 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Oca2
Gene Name oculocutaneous albinism II
Synonym(s) D7H15S12, p, D7H15S12
Chromosomal Location 56,239,760-56,536,517 bp (+)
MGI Phenotype Mutations generally result in varying degrees of coat and eye pigment dilution. Specific alleles produce cleft palate, reproductive, endocrine or neurological disorders, and/or lethality.
Accession Number

NCBI RefSeq: NM_021879; MGI:97454

Mapped No 
Amino Acid Change Methionine changed to Lysine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000032633]
SMART Domains Protein: ENSMUSP00000032633
Gene: ENSMUSG00000030450
AA Change: M814K

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ArsB 319 558 2e-10 PFAM
Pfam:CitMHS 337 770 2e-49 PFAM
Pfam:ArsB 562 827 8.9e-9 PFAM
Pfam:Na_sulph_symp 573 832 6e-13 PFAM
Predicted Effect probably benign

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
(Using ENSMUST00000032633)
Phenotypic Category skin/coat/nails
Penetrance  
Alleles Listed at MGI

All mutations/alleles(88) : Chemically and radiation induced(3) Chemically induced (ENU)(11) Chemically induced (other)(1) Gene trapped(1) Radiation induced(48) Spontaneous(20) Targeted(3) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Oca2 APN 7 56280846 missense possibly damaging 0.46
IGL01022:Oca2 APN 7 56324756 missense probably damaging 1.00
IGL01666:Oca2 APN 7 56314811 splice site 0.00
IGL02157:Oca2 APN 7 56324797 splice site 0.00
IGL02213:Oca2 APN 7 56321484 splice site 0.00
IGL02314:Oca2 APN 7 56357151 missense probably damaging 0.99
IGL03083:Oca2 APN 7 56295484 missense probably benign 0.00
IGL03356:Oca2 APN 7 56535968 missense probably benign 0.25
charbon UTSW 7 56316405 missense probably damaging 1.00
Dirk UTSW 7 56535968 missense
draco1 UTSW 7 56423352 missense probably benign 0.00
faded UTSW 7 56324661 missense
hardy UTSW 7 56295460 missense probably damaging 1.00
narwhal UTSW 7 56295498 nonsense probably null
quicksilver UTSW 7 56324661 missense probably damaging 0.98
renesmee UTSW 7 56535968 missense probably benign 0.00
snowflake UTSW 7 56324680 missense probably damaging 1.00
whitemouse UTSW 7 56414431 missense probably damaging 1.00
R0440:Oca2 UTSW 7 56423352 missense probably benign 0.00
R1067:Oca2 UTSW 7 56316393 missense probably damaging 1.00
R1349:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1372:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1457:Oca2 UTSW 7 56321521 missense probably damaging 1.00
R1737:Oca2 UTSW 7 56328785 missense probably damaging 1.00
R1802:Oca2 UTSW 7 56254980 missense probably benign 0.00
R1957:Oca2 UTSW 7 56321498 missense possibly damaging 0.82
R1966:Oca2 UTSW 7 56414467 missense probably damaging 0.99
R2082:Oca2 UTSW 7 56297137 missense probably benign 0.01
R2229:Oca2 UTSW 7 56357155 missense probably benign 0.11
R4120:Oca2 UTSW 7 56254882 missense probably damaging 1.00
R4192:Oca2 UTSW 7 56297249 missense probably damaging 1.00
R4405:Oca2 UTSW 7 56414434 missense possibly damaging 0.63
R4654:Oca2 UTSW 7 56328812 missense probably benign 0.44
R4701:Oca2 UTSW 7 56255002 missense probably benign 0.00
R4782:Oca2 UTSW 7 56279521 nonsense probably null
R4887:Oca2 UTSW 7 56330358 nonsense probably null
R4983:Oca2 UTSW 7 56321505 missense noncoding transcript
R5053:Oca2 UTSW 7 56323580 nonsense probably null
R5215:Oca2 UTSW 7 56295498 nonsense probably null
R5430:Oca2 UTSW 7 56295460 missense probably damaging 1.00
R5677:Oca2 UTSW 7 56414462 missense probably damaging 1.00
X0026:Oca2 UTSW 7 56332080 splice donor site probably benign
Z1088:Oca2 UTSW 7 56330375 unclassified probably null 0.83
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 038239-MU
Last Updated 01/05/2017 2:14 PM by Katherine Timer
Record Created 10/31/2014 2:56 PM by Lauren Prince
Record Posted 12/12/2014
Phenotypic Description
Figure 1. Cotton is a hypopigmentation mutant. The cotton mice have gray coats and red eyes.

The cotton phenotype was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R1349, some of which exhibited a light gray coat and red eyes (Figure 1). Other phenotypes associated with Oca2 mutations such as slight susceptibility to L. monocytogenes (see the records for charbon and quicksilver) have not been examined in cotton mice.

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 46 mutations.  Among these, only one affected a gene with known effects on pigmentation, Oca2. The mutation in Oca2 was presumed to be causative because the cotton hypopigmentation phenotype mimics other known alleles of Oca2 (see MGI for a list of Oca2 alleles as well as the Beutler Oca2 alleles: quicksilver, faded, charbon, draco1, snowflake, and whitemouse). The Oca2 mutation is a T to A transversion at base pair 56,535,968 (v38) on chromosome 7, or base pair 296,376 in the GenBank genomic region NC_000073.  The mutation corresponds to residue 2,571 in the mRNA sequence NM_021879 within exon 4 of 24 total exons.

 

2555 TTCCCTGTGATGCTCATGTCCTGCACCATTGGG

809  -F--P--V--M--L--M--S--C--T--I--G-

 

The mutated nucleotide is indicated in red.  The mutation results in a methionine (M) to lysine (K) substitution at position 814 (M814K) in the OCA2 protein, and is strongly predicted by Polyphen-2 to be benign (score = 0.005).

Protein Prediction

 

Figure 2. Domain organization of the OCA2 protein. (A) Topography. (B) Domain structure. The cotton mutation results in a methionine to lysine substitution at amino acid 814 in the OCA2 protein. This image is interactive. Click on the image to view other mutations found in OCA2 (red). Click on the mutations for more specific information.

OCA2 is a 110-kDa twelve transmembrane-spanning protein (Figure 2) that exhibits homology to a number of bacterial transporters (1). The exact function of OCA2 in melanocytes is unknown. The cotton mutation occurs within the twelfth (of 12 total) transmembrane domain.

 

Please see the record quicksilver for information about Oca2.

Putative Mechanism

Mutations in Oca2 are known to cause a variable reduction of eumelanin (black-brown) pigment and altered morphology of black pigment granules (eumelanosomes), but have little effect on pheomelanin (yellow-red) pigment (2;3). For example, mice with null alleles of Oca2 have very little to no eumelanin in their coat and eyes, resulting in a hypopigmentation phenotype: light grey fur with pink eyes on a nonagouti background (e.g., C57BL/6J), and cream-colored mice on an agouti background (4;5). The null mice have a reduced number of very small eumelanosomes in pigmented tissue with a concomitant decrease in the expression levels of melanosomal proteins (e.g., tyrosinase; see the record for ghost). The light coat color of cotton mice suggests a reduced function of the OCA2 protein in these animals.

Primers PCR Primer
cotton(F):5'- AACTCTGGGCAATGGGTGTAAACC -3'
cotton(R):5'- CCTGATGCTGATGCTGATGCTGATG -3'

Sequencing Primer
cotton_seq(F):5'- cctgtcctttcttcattccctc -3'
cotton_seq(R):5'- GCTGGCTGTTAATTCCATCC -3'
References
  4. Silvers, W. K. (1979) The Coat Colors of Mice. .
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsLauren Prince, Jamie Russell
List |< first << previous [record 76 of 511] next >> last >|