Phenotypic Mutation 'crullers'

• Allele: crullers
• Mutation Type: missense
• Chromosome: 7
• Coordinate: 30,569,308 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Cd22
• Gene Name: CD22 antigen
• Synonym(s): Lyb8, Lyb-8
• Chromosomal Location: 30,564,829-30,579,767 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Serine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000019248] [ENSMUSP00000103760] [ENSMUSP00000139685] [ENSMUSP00000141178] [ENSMUSP00000140521] [ENSMUSP00000139871] [ENSMUSP00000150025] [ENSMUSP00000140528]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000019248; Gene: ENSMUSG00000030577; AA Change: S603P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000019248)
• SMART Domains: Protein: ENSMUSP00000103760; Gene: ENSMUSG00000030577; AA Change: S603P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000108125)
• SMART Domains: Protein: ENSMUSP00000139685; Gene: ENSMUSG00000030577; AA Change: S603P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000186154)
• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000140521; Gene: ENSMUSG00000030577; AA Change: S603P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000189718)
• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000139871; Gene: ENSMUSG00000030577; AA Change: S603P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000190617)
• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
  (Using ENSMUST00000214289)
• SMART Domains: Protein: ENSMUSP00000140528; Gene: ENSMUSG00000030577

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	1.1e-3	SMART
IG_like	166	245	1.6e-2	SMART
IGc2	269	337	1.1e-6	SMART

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9391
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: gDNA
• Last Updated: 2019-07-29 12:24 PM by Diantha La Vine
• Record Created: 2014-11-01 10:35 PM by Ming Zeng
• Record Posted: 2014-12-12
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Ming Zeng, Bruce Beutler

Accession Number

NCBI RefSeq: NM_001043317.2, NM_009845.3; MGI: 88322

Alleles Listed at MGI

All mutations/alleles(15) : Chemically induced (ENU)(2) Targeted(13)

Repository

MMRRC:37597

Phenotypic Description

Figure 1. Crullers mice exhibit increased frequencies of peripheral B1a cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Crullers mice exhibit increased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Crullers mice exhibit decreased frequencies of peripheral B2 cells. Flow cytometric analysis of peripheral blood was utilized to determine B2 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Crullers mice exhibit decreased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Crullers mice exhibit increased frequencies of central memory CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Crullers mice exhibit decreased IgD mean fluorescence intensity. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The crullers phenotype was identified among G3 mice of the pedigree R1245, some of which showed an increase in the frequency of B1a (Figure 1) and B1b cells (Figure 2), a decreased frequency of B2 cells (Figure 3), a decreased frequency of effector memory CD4⁺ T cells in CD4⁺ T cells (Figure 4), an increased frequency of central memory CD4⁺ T cells (Figure 5), and a decrease in IgD mean fluorescence intensity (Figure 6), all in the peripheral blood. 

Nature of Mutation

Figure 7. Linkage mapping of the reduced frequency of peripheral B2 cells using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 39 mutations (X-axis) identified in the G1 male of pedigree R1245. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 39 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Cd22:  a T to C transition at base pair 30,869,883 (v38) on chromosome 7, or base pair 10,460 in the GenBank genomic region NC_000073.  The strongest association was found with an additive model of linkage to the normalized frequency of peripheral B2 cells, wherein 8 variant homozygotes and 9 heterozygous mice  departed phenotypically from 5 homozygous reference mice with a P value of 1.727 x 10^-8 (Figure 7).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive; in the B1b assay, a purely dominant effect observed.  The mutation corresponds to residue 2,045 in the mRNA sequence NM_009845 within exon 8 of 14 total exons or residue 2,170 in the mRNA sequence NM_001043317 in exon 10 of 16 total exons.

10445 ATCGGAGAGACCTTGTCACAGGCCTGGAACCTC

598   -I--G--E--T--L--S--Q--A--W--N--L-

Genomic numbering corresponds to NC_000073. The mutated nucleotide is indicated in red.  The mutation results in a serine (S) to proline (P) substitution at position 603 (S603P) in both CD22 isoforms, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00).

Protein Prediction

Figure 8. Domain structure of CD22. The crullers mutation results in a proline to serine subsitution at position 603. Abbreviations: SP, signaling peptide; TM, transmembrane domain; ITIM, immunoreceptor tyrosine-based inhibitory motif.

CD22 belongs to the Siglec (sialic acid-binding) family of adhesion molecules (1;2) (Figure 8). Siglecs are members of the immunoglobulin (Ig) superfamily, which specifically recognize sialic acids attached to the terminal regions of cell-surface glycoconjugates. CD22 is one of two Siglecs expressed by B cells (the other being Siglec-G), and was originally identified as a B cell-associated adhesion protein that functions in the regulation of B cell activation [reviewed in (3;4)].  CD22 associates with a number of BCR signaling molecules including the BCR complex itself.  Upon cross-linking of the BCR by antigen, associated CD22 is rapidly phosphorylated by Lyn (5-7).  The subsequent association of SHP1 with CD22 leads to the dephosphorylation of a number of BCR signaling components that dampens the BCR signal and Ca²⁺ mobilization such as Vav-1, CD19 and BLNK (8-10).

Siglec proteins are type 1 transmembrane proteins with a sialic acid-binding N-terminal Ig-like V-type domain, variable numbers of Ig-like C2-type domains, a transmembrane region, and a cytoplasmic tail.  CD22 contains seven immunoglobulin domains in its extracellular region at amino acids 31-147, 156-254, 269-337, 365-424,448-523, 541-599, and 628-687 (1).  The crullers mutation resides in the region between the sixth and seventh immunoglobulin domains.

See the record well for more information about Cd22.

Putative Mechanism

In response to BCR stimulation, CD22-deficient B cells predominantly undergo apoptosis (11).  Although CD22 appears to be dispensable for the differentiation of B cells to mature follicular cells, CD22-deficient B cells express less surface IgM, which may be a consequence of a faster and more complete maturation process.  In addition, CD22-deficient mice have severely reduced numbers of marginal zone (MZ) B cells, and increased numbers of B-1 peritoneal cells was observed in two of the four knockout strains (12-15). The loss of MZ B cells and increased B-1 cell numbers in these mice may be due to altered BCR signaling during development as maturation into the three mature B cell subsets is driven in part by differences in BCR signal strength, and a strong BCR signal disrupts MZ B development and promotes B-1 differentiation [reviewed by (16;17)]. Due to the lack of MZ B cells, these animals display impaired immune responses to T-independent antigens (12;15;18), while T-dependent immune responses remain intact and subsequent germinal center formation occurs normally (11).

Mice carrying the crullers allele share several phenotypes with the CD22 knockout mice including defects in peripheral B cell maturation that are likely caused by reduced MZ B cell numbers.  A defect in immune responses to T-dependent or T-independent antigens was not observed in the crullers mice indicating that some residual CD22 function may be found in the crullers mice.

Primers

PCR Primer
crullers_pcr_F: GGATTGGCATCACTCTCACAGGAC
crullers_pcr_R: CGTGAAGGTACTGAAGGTAAGCCC

Sequencing Primer
crullers_seq_F: AGGACAAGGTGGCCTTCTTC
crullers_seq_R: TGAAGGTAAGCCCCGCATC

Genotyping

Crullers genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.

 

PCR Primers

Crullers (F): 5’- GGATTGGCATCACTCTCACAGGAC-3’

Crullers (R): 5’- CGTGAAGGTACTGAAGGTAAGCCC-3’

 

 

Sequencing Primer

Crullers (F): 5’- AGGACAAGGTGGCCTTCTTC-3’


Crullers (R): 5’- TGAAGGTAAGCCCCGCATC-3’


 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

 

The following sequence of 427 nucleotides is amplified (Chr.7: 30869680-30870106, GRCm38; NC_000073):

 

ggattggcat cactctcaca ggacaaggtg gccttcttcc cctccatcac atggtcccca

gggctgatgg acacacgcag cctccgagga gcatctgtaa aggagacccc gagtcaggcc

ggggcagcgg gtcacctcat catcttctca tttaggcccc agctccagcc actcacacag

cacttggagg ttccaggcct gtgacaaggt ctctccgatg gagttgttga ccatgcagtt

ataatttcca gaatcttctg gggagacgga gccgaagctc aggtacctcc cttcctgcac

gagactccca ttcttcttcc agaagaagcg gacctctgcc gggttgctct ctgcgaagtc

gcattggagg aggacacgct gcccagcgcg gatctctgat gcggggctta ccttcagtac

cttcacg   

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide (A) is shown in red text (Chr. + strand, T>C; sense strand, A>G).

References

  1. Torres, R. M., Law, C. L., Santos-Argumedo, L., Kirkham, P. A., Grabstein, K., Parkhouse, R. M., and Clark, E. A. (1992) Identification and Characterization of the Murine Homologue of CD22, a B Lymphocyte-Restricted Adhesion Molecule. J Immunol. 149, 2641-2649.

  2. Wilson, G. L., Fox, C. H., Fauci, A. S., and Kehrl, J. H. (1991) CDNA Cloning of the B Cell Membrane Protein CD22: A Mediator of B-B Cell Interactions. J Exp Med. 173, 137-146.

  3. Walker, J. A., and Smith, K. G. (2008) CD22: An Inhibitory Enigma. Immunology. 123, 314-325.

  4. Nitschke, L. (2009) CD22 and Siglec-G: B-Cell Inhibitory Receptors with Distinct Functions. Immunol Rev. 230, 128-143.

  5. Leprince, C., Draves, K. E., Geahlen, R. L., Ledbetter, J. A., and Clark, E. A. (1993) CD22 Associates with the Human Surface IgM-B-Cell Antigen Receptor Complex. Proc Natl Acad Sci U S A. 90, 3236-3240.

  6. Smith, K. G., Tarlinton, D. M., Doody, G. M., Hibbs, M. L., and Fearon, D. T. (1998) Inhibition of the B Cell by CD22: A Requirement for Lyn. J Exp Med. 187, 807-811.

  7. Schulte, R. J., Campbell, M. A., Fischer, W. H., and Sefton, B. M. (1992) Tyrosine Phosphorylation of CD22 during B Cell Activation. Science. 258, 1001-1004.

  8. Gerlach, J., Ghosh, S., Jumaa, H., Reth, M., Wienands, J., Chan, A. C., and Nitschke, L. (2003) B Cell Defects in SLP65/BLNK-Deficient Mice can be Partially Corrected by the Absence of CD22, an Inhibitory Coreceptor for BCR Signaling. Eur J Immunol. 33, 3418-3426.

  9. Sato, S., Jansen, P. J., and Tedder, T. F. (1997) CD19 and CD22 Expression Reciprocally Regulates Tyrosine Phosphorylation of Vav Protein during B Lymphocyte Signaling. Proc Natl Acad Sci U S A. 94, 13158-13162.

  10. Fujimoto, M., Bradney, A. P., Poe, J. C., Steeber, D. A., and Tedder, T. F. (1999) Modulation of B Lymphocyte Antigen Receptor Signal Transduction by a CD19/CD22 Regulatory Loop. Immunity. 11, 191-200.

  11. Poe, J. C., Fujimoto, Y., Hasegawa, M., Haas, K. M., Miller, A. S., Sanford, I. G., Bock, C. B., Fujimoto, M., and Tedder, T. F. (2004) CD22 Regulates B Lymphocyte Function in Vivo through both Ligand-Dependent and Ligand-Independent Mechanisms. Nat Immunol. 5, 1078-1087.

  12. Otipoby, K. L., Andersson, K. B., Draves, K. E., Klaus, S. J., Farr, A. G., Kerner, J. D., Perlmutter, R. M., Law, C. L., and Clark, E. A. (1996) CD22 Regulates Thymus-Independent Responses and the Lifespan of B Cells. Nature. 384, 634-637.

  13. Sato, S., Miller, A. S., Inaoki, M., Bock, C. B., Jansen, P. J., Tang, M. L., and Tedder, T. F. (1996) CD22 is both a Positive and Negative Regulator of B Lymphocyte Antigen Receptor Signal Transduction: Altered Signaling in CD22-Deficient Mice. Immunity. 5, 551-562.

  14. O'Keefe, T. L., Williams, G. T., Davies, S. L., and Neuberger, M. S. (1996) Hyperresponsive B Cells in CD22-Deficient Mice. Science. 274, 798-801.

  15. Nitschke, L., Carsetti, R., Ocker, B., Kohler, G., and Lamers, M. C. (1997) CD22 is a Negative Regulator of B-Cell Receptor Signalling. Curr Biol. 7, 133-143.

  16. Niiro, H., and Clark, E. A. (2002) Regulation of B-Cell Fate by Antigen-Receptor Signals. Nat Rev Immunol. 2, 945-956.

  17. Pillai, S., Cariappa, A., and Moran, S. T. (2005) Marginal Zone B Cells. Annu Rev Immunol. 23, 161-196.

  18. Samardzic, T., Marinkovic, D., Danzer, C. P., Gerlach, J., Nitschke, L., and Wirth, T. (2002) Reduction of Marginal Zone B Cells in CD22-Deficient Mice. Eur J Immunol. 32, 561-567.