Phenotypic Mutation 'crullers' (pdf version)
List |< first << previous [record 90 of 511] next >> last >|
Allelecrullers
Mutation Type missense
Chromosome7
Coordinate30,869,883 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Cd22
Gene Name CD22 antigen
Synonym(s) Lyb-8, Lyb8
Chromosomal Location 30,865,402-30,880,342 bp (-)
MGI Phenotype Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens.
Accession Number

NCBI RefSeq: NM_001043317.2, NM_009845.3; MGI: 88322

Mapped Yes 
Amino Acid Change Serine changed to Proline
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000019248] [ENSMUSP00000103760] [ENSMUSP00000139685] [ENSMUSP00000140521] [ENSMUSP00000139871]
SMART Domains Protein: ENSMUSP00000019248
Gene: ENSMUSG00000030577
AA Change: S603P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000019248)
SMART Domains Protein: ENSMUSP00000103760
Gene: ENSMUSG00000030577
AA Change: S603P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000108125)
SMART Domains Protein: ENSMUSP00000139685
Gene: ENSMUSG00000030577
AA Change: S603P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000186154)
SMART Domains Protein: ENSMUSP00000140521
Gene: ENSMUSG00000030577
AA Change: S603P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000189718)
SMART Domains Protein: ENSMUSP00000139871
Gene: ENSMUSG00000030577
AA Change: S603P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000190617)
Phenotypic Category decrease in B cells, decrease in B2 cells, decrease in IgD MFI in B cells, increase in B1a cells, increase in B1b cells, post-MCMV decrease in B cells, post-MCMV decrease in IgD+ B cells, post-MCMV decrease in IgM+ B cells
Penetrance  
Alleles Listed at MGI

All mutations/alleles(15) : Chemically induced (ENU)(2) Targeted(13)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Cd22 APN 7 30876147 missense probably benign 0.01
IGL02236:Cd22 APN 7 30867468 missense probably benign 0.00
IGL02321:Cd22 APN 7 30869883 missense probably damaging 1.00
IGL02335:Cd22 APN 7 30876134 missense probably damaging 1.00
IGL02397:Cd22 APN 7 30877625 missense probably benign
IGL02402:Cd22 APN 7 30877530 missense possibly damaging 0.86
IGL02538:Cd22 APN 7 30877560 missense probably benign 0.40
IGL02736:Cd22 APN 7 30878045 splice site 0.00
gansu UTSW 7 30870105 missense probably damaging 1.00
rain UTSW 7 30877534 missense probably damaging 1.00
well UTSW 7 30877787 nonsense
yosemite UTSW 7 30869509 critical splice donor site probably null
LCD18:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
PIT4142001:Cd22 UTSW 7 30877799 missense possibly damaging 0.92
R0123:Cd22 UTSW 7 30867108 splice acceptor site probably benign
R0130:Cd22 UTSW 7 30869964 missense possibly damaging 0.87
R1245:Cd22 UTSW 7 30869883 missense probably damaging 1.00
R1332:Cd22 UTSW 7 30870487 missense possibly damaging 0.48
R1457:Cd22 UTSW 7 30873170 missense probably benign 0.01
R1716:Cd22 UTSW 7 30877678 missense probably damaging 1.00
R1980:Cd22 UTSW 7 30873233 missense probably damaging 1.00
R2017:Cd22 UTSW 7 30872780 missense probably damaging 0.99
R2061:Cd22 UTSW 7 30870105 missense probably damaging 1.00
R2061:Cd22 UTSW 7 30876156 nonsense probably null
R2075:Cd22 UTSW 7 30869698 missense probably damaging 1.00
R2216:Cd22 UTSW 7 30867046 missense probably damaging 1.00
R3886:Cd22 UTSW 7 30870107 missense probably benign 0.03
R4599:Cd22 UTSW 7 30875900 missense probably damaging 0.98
R4701:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R5179:Cd22 UTSW 7 30875874 missense possibly damaging 0.81
R5233:Cd22 UTSW 7 30877534 missense probably damaging 1.00
R5456:Cd22 UTSW 7 30876039 missense probably benign 0.02
R5511:Cd22 UTSW 7 30870071 missense probably damaging 1.00
R5513:Cd22 UTSW 7 30867025 missense probably damaging 0.99
R5611:Cd22 UTSW 7 30878150 start gained unknown
R5966:Cd22 UTSW 7 30866658 missense probably damaging 1.00
X0025:Cd22 UTSW 7 30873419 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock gDNA
Repository

MMRRC:37597

Last Updated 08/03/2017 4:06 PM by Diantha La Vine
Record Created 11/01/2014 10:35 PM by Ming Zeng
Record Posted 12/12/2014
Phenotypic Description

Figure 1. Crullers mice exhibit increased frequencies of peripheral B1a cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Crullers mice exhibit increased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Crullers mice exhibit decreased frequencies of peripheral B2 cells. Flow cytometric analysis of peripheral blood was utilized to determine B2 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Crullers mice exhibit decreased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Crullers mice exhibit increased frequencies of central memory CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Crullers mice exhibit decreased IgD mean fluorescence intensity. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The crullers phenotype was identified among G3 mice of the pedigree R1245, some of which showed an increase in the frequency of B1a (Figure 1) and B1b cells (Figure 2), a decreased frequency of B2 cells (Figure 3), a decreased frequency of effector memory CD4+ T cells in CD4+ T cells (Figure 4), an increased frequency of central memory CD4+ T cells (Figure 5), and a decrease in IgD mean fluorescence intensity (Figure 6), all in the peripheral blood. 

Nature of Mutation

Figure 7. Linkage mapping of the reduced frequency of peripheral B2 cells using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 39 mutations (X-axis) identified in the G1 male of pedigree R1245.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 39 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Cd22:  a T to C transition at base pair 30,869,883 (v38) on chromosome 7, or base pair 10,460 in the GenBank genomic region NC_000073.  The strongest association was found with an additive model of linkage to the normalized frequency of peripheral B2 cells, wherein 8 variant homozygotes and 9 heterozygous mice  departed phenotypically from 5 homozygous reference mice with a P value of 1.727 x 10-8 (Figure 7).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive; in the B1b assay, a purely dominant effect observed.  The mutation corresponds to residue 2,045 in the mRNA sequence NM_009845 within exon 8 of 14 total exons or residue 2,170 in the mRNA sequence NM_001043317 in exon 10 of 16 total exons.

 

10445 ATCGGAGAGACCTTGTCACAGGCCTGGAACCTC

598   -I--G--E--T--L--S--Q--A--W--N--L-

 

Genomic numbering corresponds to NC_000073. The mutated nucleotide is indicated in red.  The mutation results in a serine (S) to proline (P) substitution at position 603 (S603P) in both CD22 isoforms, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00).

Protein Prediction
Figure 8. Domain structure of CD22. The crullers mutation converts a serine to a proline at amino acid 603 of the encoded protein.

CD22 belongs to the Siglec (sialic acid-binding) family of adhesion molecules (1;2) (Figure 8). Siglecs are members of the immunoglobulin (Ig) superfamily, which specifically recognize sialic acids attached to the terminal regions of cell-surface glycoconjugates. CD22 is one of two Siglecs expressed by B cells (the other being Siglec-G), and was originally identified as a B cell-associated adhesion protein that functions in the regulation of B cell activation [reviewed in (3;4)].  CD22 associates with a number of BCR signaling molecules including the BCR complex itself.  Upon cross-linking of the BCR by antigen, associated CD22 is rapidly phosphorylated by Lyn (5-7).  The subsequent association of SHP1 with CD22 leads to the dephosphorylation of a number of BCR signaling components that dampens the BCR signal and Ca2+ mobilization such as Vav-1, CD19 and BLNK (8-10).

 

Siglec proteins are type 1 transmembrane proteins with a sialic acid-binding N-terminal Ig-like V-type domain, variable numbers of Ig-like C2-type domains, a transmembrane region, and a cytoplasmic tail.  CD22 contains seven immunoglobulin domains in its extracellular region at amino acids 31-147, 156-254, 269-337, 365-424,448-523, 541-599, and 628-687 (1).  The crullers mutation resides in the region between the sixth and seventh immunoglobulin domains.

 

See the record well for more information about Cd22.

Putative Mechanism

In response to BCR stimulation, CD22-deficient B cells predominantly undergo apoptosis (11).  Although CD22 appears to be dispensable for the differentiation of B cells to mature follicular cells, CD22-deficient B cells express less surface IgM, which may be a consequence of a faster and more complete maturation process.  In addition, CD22-deficient mice have severely reduced numbers of marginal zone (MZ) B cells, and increased numbers of B-1 peritoneal cells was observed in two of the four knockout strains (12-15). The loss of MZ B cells and increased B-1 cell numbers in these mice may be due to altered BCR signaling during development as maturation into the three mature B cell subsets is driven in part by differences in BCR signal strength, and a strong BCR signal disrupts MZ B development and promotes B-1 differentiation [reviewed by (16;17)]. Due to the lack of MZ B cells, these animals display impaired immune responses to T-independent antigens (12;15;18), while T-dependent immune responses remain intact and subsequent germinal center formation occurs normally (11).

 

Mice carrying the crullers allele share several phenotypes with the CD22 knockout mice including defects in peripheral B cell maturation that are likely caused by reduced MZ B cell numbers.  A defect in immune responses to T-dependent or T-independent antigens was not observed in the crullers mice indicating that some residual CD22 function may be found in the crullers mice.

Primers PCR Primer
crullers(F):5'- GGATTGGCATCACTCTCACAGGAC -3'
crullers(R):5'- CGTGAAGGTACTGAAGGTAAGCCC -3'

Sequencing Primer
crullers_seq(F):5'- AGGACAAGGTGGCCTTCTTC -3'
crullers_seq(R):5'- TGAAGGTAAGCCCCGCATC -3'
Genotyping
Crullers genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 
PCR Primers
Crullers (F): 5’- GGATTGGCATCACTCTCACAGGAC-3’
Crullers (R): 5’- CGTGAAGGTACTGAAGGTAAGCCC-3’
 
 
Sequencing Primer
Crullers (F): 5’- AGGACAAGGTGGCCTTCTTC-3’

Crullers (R): 5’- TGAAGGTAAGCCCCGCATC-3’

 
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 55°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 40X
6) 72°C             10:00
7) 4°C               ∞
 
 
The following sequence of 427 nucleotides is amplified (Chr.7: 30869680-30870106, GRCm38; NC_000073):

 

ggattggcat cactctcaca ggacaaggtg gccttcttcc cctccatcac atggtcccca

gggctgatgg acacacgcag cctccgagga gcatctgtaa aggagacccc gagtcaggcc

ggggcagcgg gtcacctcat catcttctca tttaggcccc agctccagcc actcacacag

cacttggagg ttccaggcct gtgacaaggt ctctccgatg gagttgttga ccatgcagtt

ataatttcca gaatcttctg gggagacgga gccgaagctc aggtacctcc cttcctgcac

gagactccca ttcttcttcc agaagaagcg gacctctgcc gggttgctct ctgcgaagtc

gcattggagg aggacacgct gcccagcgcg gatctctgat gcggggctta ccttcagtac

cttcacg   

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide (A) is shown in red text (Chr. + strand, T>C; sense strand, A>G).

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsMing Zeng, Bruce Beutler
List |< first << previous [record 90 of 511] next >> last >|