Phenotypic Mutation 'abra' (pdf version)
List |< first << previous [record 5 of 511] next >> last >|
Alleleabra
Mutation Type missense
Chromosome2
Coordinate126,923,594 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Sppl2a
Gene Name signal peptide peptidase like 2A
Synonym(s) C130089K23Rik, 2010106G01Rik
Chromosomal Location 126,890,391-126,933,235 bp (-)
MGI Phenotype Mice homozygous for a knock-out allele exhibit decreased immunoglobulin prior to and after immunization and decreased splenic B cells, myeloid dendritic cells, T2 B cells and follicular B cells. Mice homozygous for a hypomorphic allele exhibit similar albeit less severe phenotypes.
Accession Number

NCBI RefSeq: NM_023220; MGI:1913802

Mapped Yes 
Amino Acid Change Serine changed to Proline
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000028844]
SMART Domains Protein: ENSMUSP00000028844
Gene: ENSMUSG00000027366
AA Change: S203P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:PA 58 153 1.7e-12 PFAM
transmembrane domain 173 195 N/A INTRINSIC
PSN 218 486 3.65e-102 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
(Using ENSMUST00000028844)
Phenotypic Category T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(14) : Chemically induced (ENU)(2) Chemically induced (other)(1) Gene trapped(6) Radiation induced(1) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Sppl2a APN 2 126919720 missense probably benign 0.34
IGL01471:Sppl2a APN 2 126917867 nonsense probably null 0.00
IGL01572:Sppl2a APN 2 126920312 splice donor site probably benign 0.00
IGL01712:Sppl2a APN 2 126904903 splice donor site probably benign 0.00
IGL02203:Sppl2a APN 2 126904941 missense possibly damaging 0.66
IGL02572:Sppl2a APN 2 126926296 missense probably benign 0.04
abra2 UTSW 2 126920313 splice donor site
R0023:Sppl2a UTSW 2 126913293 splice donor site probably null
R0240:Sppl2a UTSW 2 126920336 missense probably benign 0.14
R0240:Sppl2a UTSW 2 126920336 missense probably benign 0.14
R0458:Sppl2a UTSW 2 126904959 missense probably damaging 1.00
R0627:Sppl2a UTSW 2 126920417 splice acceptor site probably benign
R0732:Sppl2a UTSW 2 126917299 splice acceptor site probably benign
R0799:Sppl2a UTSW 2 126920307 splice donor site probably benign
R1029:Sppl2a UTSW 2 126923594 missense probably benign 0.00
R1245:Sppl2a UTSW 2 126913521 splice donor site probably benign
R1579:Sppl2a UTSW 2 126917204 splice donor site probably benign
R1669:Sppl2a UTSW 2 126917794 splice donor site probably benign
R2047:Sppl2a UTSW 2 126926852 missense probably damaging 1.00
R2215:Sppl2a UTSW 2 126927834 missense probably benign 0.00
R2428:Sppl2a UTSW 2 126912695 missense possibly damaging 0.93
R3522:Sppl2a UTSW 2 126920322 missense possibly damaging 0.66
R4653:Sppl2a UTSW 2 126920313 missense probably null
R4747:Sppl2a UTSW 2 126923538 missense noncoding transcript
R5398:Sppl2a UTSW 2 126919718 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 12/08/2016 9:55 AM by Katherine Timer
Record Created 11/10/2014 3:12 PM by Jin Huk Choi
Record Posted 10/28/2016
Phenotypic Description

Figure 1. Homozygous abra mice exhibit diminished T-independent IgM responses to NP-Ficoll. IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The abra phenotype was identified among G3 mice of the pedigree R1029, some of which showed a diminished T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) (Figure 1). 

Nature of Mutation
Figure 2. Linkage mapping of the reduced antibody response to NP-Ficoll using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 37 mutations (X-axis) identified in the G1 male of pedigree R1029.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. The diminished T-independent antibody response to NP-Ficoll phenotype was linked by continuous variable mapping to three genes on chromosome 2: Lrp4, Sppl2a, and Zfp335. The Sppl2a mutation is presumed causative, because the immune phenotypes observed in abra mimic those listed on MGI and another Sppl2a mutant identified in a second pedigree (see abra2). The Sppl2a mutation is a T to C transition at base pair 126,923,594 (v38) on chromosome 2, or base pair 9,669 in the GenBank genomic region NC_000068 encoding the Sppl2a gene. Linkage was found with a recessive model of inheritance (P = 1.195 x 10-5), wherein one variant homozygote departed phenotypically from 23 homozygous reference mice and 13 heterozygous mice (Figure 2).  

 

The mutation corresponds to residue 830 in the mRNA sequence NM_023220 within exon 6 of 15 total exons.


 
815 TTGGAAAACATGAAGTCAGTGGAAGACGCAGAA
198 -L--E--N--M--K--S--V--E--D--A--E-

 

The mutated nucleotide is indicated in red.  The mutation results in a serine (S) to proline (P) substitution at position 203 (S203P) in the SPPL2A protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.002).

Protein Prediction
Figure 3. Domain organization of mouse SPPL2A. The location of the abra mutation (S203P) and the YD, GXGD, and PAL motifs are indicated. Abbreviations: SP, signal peptide; PA, protease-associated domain; TM, transmembrane domains. The orientation of the N- (lumenal) and C- (cytoplasmic) termini are indicated. The image is interactive; click to view other mutations in SPPL2A.

Sppl2a encodes SPPL2a, a signal peptide peptidase-like (SPPL) protease, and member of the GxGD intramembrane-cleaving protease family of aspartyl intramembrane-cleaving proteases (I-CLiPs) (Figure 3). SPPL proteins share several motifs, including a Tyr-Asp (YD) motif (amino acids 354-355), a GxGD motif (amino acids 413-416), and a PAL sequence (amino acids 466-468) (1-4). All three motifs contribute to SPPL proteolytic activity; the aspartate residues in the YD and GxGD motifs are required for SPPL protease activity (1;5). It is unknown how the PAL motif affects SPPL activity, but it is thought to promote the activity of the YD and GxGD motifs.

 

SPPL2A has nine transmembrane domains. Within the N-terminal tail is a protease-associated (PA) domain, an insert domain found in several proteases (SMART). SPPL2A has six putative N-glycosylation sites (Asn51, 61, 69, 119, 129, and 135) at the luminal N-terminus and two putative lysosomal targeting motifs at the cytoplasmic C-terminus (amino acids 498-501 [YQVM] and 506-509 [YSTN]) (6). SPPL proteins are predicted to form homodimers, which promotes their proteolytic activity.

 

The abra mutation results in a serine (S) to proline (P) substitution at position 203. Ser203 is within the cytoplasmic loop between transmembrane domains 1 and 2.

Expression/Localization

SPPL2A is ubiquitously expressed and localizes to lysosomes and late endosomes (5;7). SPPL2A is expressed in enamel epithelium during the secretory and maturation stage amelogenesis (8).

Background
Figure 4. SPPL2A mediates the cleavage of several type II transmembrane proteins, including FasL. After posttranslational processing by ADAM10 and SPPL2A, the FasL intracellular domain binds Lef-1 to negatively regulate Lef-1-dependent pro-proliferative Wnt signaling, subsequently impeding proliferation.

GxGD proteases are essential for the regulated intramembrane proteolysis (RIP) of single span type II transmembrane proteins. RIP is a sequential processing of transmembrane substrates in which there is a proteolytic cleavage of a protein’s ectodomain and then subsequent cleavage of the remaining membrane-bound fragment by an I-CLiP (Figure 4). I-CLiP-mediated cleavage promotes reverse signaling through the liberated intracellular domain (see the record for PanR1 for information about reverse signaling), and the degradation of the membrane-retained stubs.

 

SPPL2A cleaves TNF-α (see the record for PanR1; (7)), ITM2B (Bri2) (9), Fas ligand (FasL; see the record for riogrande) (10), CD74 (11-16), TMEM106B (14;17), and neuregulin 1 type III (18) (Table 1). TNF-α, Bri2, and FasL undergo ectodomain shedding by a protease of the ADAM (a disintegrin and metalloprotease) family (see the record for wavedx for information about ADAM17) before cleavage by SPPL2A (7;9;10).

 

Table 1. SPPL2A substrates.

SPPL2A target

Brief Description

References

TNF-α

Proinflammatory cytokine; see PanR1

(7)

ITM2B

Precise function is unknown; binding of ITM2B to APP is proposed to interfere with APP cleavage by α- and β-secretases; mutations in ITM2B are associated with forms of dementia, the familial British and Danish dementia (FBD and FDD)

(9)

FasL

Induces cell death by binding to the Fas receptor on target cells; see riogrande

(10;19)

CD74 (mouse)

Mediates antigen presentation by acting as a chaperone of MHCII

(11-16)

TMEM106B

Risk factor for fronto-temporal lobar dementia (FTLD); knockdown of TMEM106B was found to induce perinuclear clustering of lysosomes and reduced dendritic branching in neuronal cells; regulates lysosome number, size and mobility in neurons

(14;17;20;21)

Neuregulin 1 type III

Substrate of β-secretase BACE1 (β-site amyloid precursor protein-cleaving enzyme 1)

(18)

 

SPPL2A-mediated processing of CD74 is essential for B cell development (11) and B cell receptor signaling in transitional B cells (14). CD74 binds to MHCII dimers in the ER of antigen-presenting cells and prevents premature peptide binding. Upon the proteolytic processing of CD74, MHCII is released. Impaired processing of CD74 leads to impaired Ag presentation by MHCII (22). CD74 also functions in the endocytic trafficking and endosomal maturation of antigen presenting cells (23;24). Dendritic cell migration (25) and the function of the proinflammatory cytokine macrophage migration inhibitory factor (26) are also CD74-dependent.

 

Sppl2a knockout (Sppl2a-/-) mice have a B cell developmental block during the splenic phase of B cell maturation. As a result, the frequency of mature and functionally competent B cells is reduced and the mice exhibit impaired humoral immune responses (11). In Sppl2a-deficient B cells, accumulation of the CD74 N-terminal fragment results in B cell maturation arrest at the transitional stage 1 (T1) (11). However, in Sppl2a-/- mice, B cell maturation and function improved, indicating that the B cell phenotype observed in the Sppl2a-deficient mice was due to incomplete turnover of the CD74 N-terminal fragment (11). In the Sppl2a-/- B cells, Akt activation was impaired and aberrant BCR trafficking led to reduced surface IgM and impaired BCR-associated signal transduction (14). The B cell defects in the Sppl2a-/- mice is due to an accumulation of the CD74 N-terminal fragment and subsequent aberrant endocytic membrane traffic (12;14). Bergmann and colleagues also attributed surface B cell receptor and BAFFR expression to SPPL2A expression (12). SPPL2A is required for maintaining the cellular homeostasis of ameloblasts and subsequent dental enamel formation (8). In Sppl2a-/- mice, the enamel of erupted incisors was chalky white and rapidly eroded after eruption. The mineral content in the incisors from the Sppl2a-/- mice was not homogeneous and was reduced compared to that in wild-type incisors.

 

An ENU-induced Sppl2a allele (named chompB) also exhibited blockade in early B cell development after the T1 stage (13). As a result of the aberrant B cell development, the chompB mice exhibited a reduced frequency of mature B cell subsets and defects in T cell-dependent antibody responses. The chompB mice also exhibited reduced frequencies of myeloid dendritic cells.

Putative Mechanism

Abra mice exhibited defects in the T-independent B cell response to NP-Ficoll. The abra mice did not exhibit overt reduction in the frequency of B cells in the peripheral blood or defects in antibody responses to the T-dependent B cell antigens recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) or ovalbumin administered with aluminum hydroxide. Taken together, the abra mutation in Sppl2a may not confer as severe effects as those observed in other Sppl2a models, but some function was lost.

Primers PCR Primer
abra(F):5'- CCAGTTTCTTACCAAGCCACCTGT -3'
abra(R):5'- AGGTGACTCTTGCTGGGAGAATTCATA -3'

Sequencing Primer
abra_seq(F):5'- TTCTTACCAAGCCACCTGTAGAAG -3'
abra_seq(R):5'- tgggaggcagaggcagg -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek, Katherine Timer
AuthorsKuan-Wen Wang, Jin Huk Choi, Apiruck Watthanasurorot, Bruce Beutler
List |< first << previous [record 5 of 511] next >> last >|