Phenotypic Mutation 'gobble'

• Allele: gobble
• Mutation Type: critical splice donor site (2 bp from exon)
• Chromosome: 1
• Coordinate: 34,204,236 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Dst
• Gene Name: dystonin
• Synonym(s): bullous pemphigoid antigen 1, BPAG1-n, Macf2, bullous pemphigoid antigen 1, Bpag1, A830042E19Rik, 2310001O04Rik, athetoid, Bpag, BPAG1, nmf203, nmf339, ah
• Chromosomal Location: 33,947,306-34,347,742 bp (+) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mutations in this gene produce peripheral nervous system demyelination resulting in impaired muscle function and shorter lifespan. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000095392 ^†] [ENSMUSP00000095393 ^†] [ENSMUSP00000110756 ^†] [ENSMUSP00000138308 ^†] [ENSMUSP00000138376 ^†] [ENSMUSP00000141127 ^†] [ENSMUSP00000139888 ^†] [ENSMUSP00000140560 ^†] † probably from a misspliced transcript
• AlphaFold: no structure available at present
• PDB Structure: Crystal Structure of a protease resistant fragment of the plakin domain of Bullous Pemphigoid Antigen1 (BPAG1) [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000095392; Gene: ENSMUSG00000026131

Domain	Start	End	E-Value	Type
CH	37	136	1.62e-28	SMART
CH	153	250	3.72e-19	SMART
PDB:2ODU|A	261	479	1e-42	PDB
low complexity region	520	545	N/A	INTRINSIC
SPEC	602	699	8.64e-9	SMART
SPEC	702	802	2.94e-11	SMART
Blast:SPEC	809	973	4e-73	BLAST
coiled coil region	1095	1132	N/A	INTRINSIC
Blast:SPEC	1176	1285	6e-63	BLAST
SPEC	1292	1421	4.11e0	SMART
SPEC	1439	1538	4.66e0	SMART
PLEC	1537	1581	9.05e-3	SMART
PLEC	1582	1619	2.7e0	SMART
PLEC	1657	1694	2.23e0	SMART
PLEC	1695	1732	4.25e1	SMART
PLEC	1735	1770	1.39e2	SMART
PLEC	1771	1808	7.4e-8	SMART
PLEC	1811	1846	5.8e-1	SMART
PLEC	1847	1884	2.71e1	SMART
PLEC	1886	1922	4.66e0	SMART
low complexity region	2294	2307	N/A	INTRINSIC
low complexity region	2366	2381	N/A	INTRINSIC
low complexity region	2477	2491	N/A	INTRINSIC
low complexity region	2566	2593	N/A	INTRINSIC
low complexity region	2661	2675	N/A	INTRINSIC
low complexity region	2793	2799	N/A	INTRINSIC
low complexity region	2839	2847	N/A	INTRINSIC
low complexity region	3046	3057	N/A	INTRINSIC
low complexity region	3294	3314	N/A	INTRINSIC
SPEC	3321	3427	5.36e-1	SMART
low complexity region	3515	3527	N/A	INTRINSIC
low complexity region	3548	3558	N/A	INTRINSIC
SPEC	3569	3678	2.19e-1	SMART
internal_repeat_7	3771	3811	5.09e-5	PROSPERO
SPEC	3852	3971	1.75e-9	SMART
SPEC	3978	4084	3.7e-8	SMART
SPEC	4091	4190	4.56e-8	SMART
SPEC	4200	4299	3.78e0	SMART
low complexity region	4372	4388	N/A	INTRINSIC
SPEC	4447	4552	1.98e-8	SMART
SPEC	4559	4663	3.62e-11	SMART
SPEC	4673	4773	1.65e-5	SMART
SPEC	4780	4882	7.75e-11	SMART
SPEC	4889	4989	2.3e-4	SMART
SPEC	4999	5098	3.01e0	SMART
SPEC	5105	5208	2.74e-2	SMART
SPEC	5215	5319	2.46e-4	SMART
SPEC	5326	5428	1.27e-15	SMART
SPEC	5435	5537	1.54e-14	SMART
SPEC	5544	5646	8.07e-2	SMART
SPEC	5653	5755	3.67e-12	SMART
SPEC	5762	5863	1.97e-12	SMART
SPEC	5870	5976	4.19e-7	SMART
SPEC	5983	6085	2.06e-15	SMART
SPEC	6092	6195	2.89e-10	SMART
SPEC	6202	6304	2.61e-26	SMART
SPEC	6311	6413	5.31e-18	SMART
SPEC	6420	6522	1.25e-14	SMART
SPEC	6529	6632	9.1e-17	SMART
SPEC	6639	6740	9.3e-23	SMART
SPEC	6747	6849	5.43e-15	SMART
SPEC	6859	6989	1.5e-8	SMART
EFh	7023	7051	4.12e-3	SMART
EFh	7059	7087	1.25e-2	SMART
GAS2	7098	7176	3.08e-51	SMART
low complexity region	7224	7242	N/A	INTRINSIC
low complexity region	7252	7264	N/A	INTRINSIC
low complexity region	7313	7336	N/A	INTRINSIC
PDB:3GJO|H	7364	7393	9e-10	PDB

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000095393; Gene: ENSMUSG00000026131

Domain	Start	End	E-Value	Type
CH	37	136	1.62e-28	SMART
CH	153	250	3.72e-19	SMART
PDB:2ODU|A	261	479	6e-43	PDB
low complexity region	520	545	N/A	INTRINSIC
SPEC	602	699	8.64e-9	SMART
SPEC	702	802	2.94e-11	SMART
Blast:SPEC	809	973	2e-73	BLAST
coiled coil region	1095	1132	N/A	INTRINSIC
Blast:SPEC	1176	1285	2e-62	BLAST
SPEC	1292	1421	4.11e0	SMART
SPEC	1439	1538	4.66e0	SMART
SPEC	1555	1664	2.19e-1	SMART
internal_repeat_6	1757	1797	1.18e-5	PROSPERO
SPEC	1838	1957	1.75e-9	SMART
SPEC	1964	2070	3.7e-8	SMART
SPEC	2077	2176	4.56e-8	SMART
SPEC	2186	2285	3.78e0	SMART
low complexity region	2358	2374	N/A	INTRINSIC
SPEC	2433	2538	1.98e-8	SMART
SPEC	2545	2649	3.62e-11	SMART
SPEC	2659	2759	1.65e-5	SMART
SPEC	2766	2868	7.75e-11	SMART
SPEC	2875	2975	2.3e-4	SMART
SPEC	2985	3084	3.01e0	SMART
SPEC	3091	3194	2.74e-2	SMART
SPEC	3201	3305	2.46e-4	SMART
SPEC	3312	3414	1.27e-15	SMART
SPEC	3421	3523	1.54e-14	SMART
SPEC	3530	3632	8.07e-2	SMART
SPEC	3639	3741	3.67e-12	SMART
SPEC	3748	3849	1.97e-12	SMART
SPEC	3856	3962	4.19e-7	SMART
SPEC	3969	4071	2.06e-15	SMART
SPEC	4078	4181	2.89e-10	SMART
SPEC	4188	4290	2.61e-26	SMART
SPEC	4297	4399	5.31e-18	SMART
SPEC	4406	4508	1.25e-14	SMART
SPEC	4515	4618	9.1e-17	SMART
SPEC	4625	4726	9.3e-23	SMART
SPEC	4733	4835	5.43e-15	SMART
SPEC	4845	4975	1.5e-8	SMART
EFh	5009	5037	4.12e-3	SMART
EFh	5045	5073	1.25e-2	SMART
GAS2	5084	5162	3.08e-51	SMART
low complexity region	5210	5228	N/A	INTRINSIC
low complexity region	5238	5250	N/A	INTRINSIC
low complexity region	5299	5322	N/A	INTRINSIC
PDB:3GJO|H	5350	5379	1e-9	PDB

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000110756; Gene: ENSMUSG00000026131

Domain	Start	End	E-Value	Type
CH	37	136	1.62e-28	SMART
CH	153	250	3.72e-19	SMART
PDB:2ODU|A	261	479	1e-42	PDB
low complexity region	520	545	N/A	INTRINSIC
SPEC	602	699	8.64e-9	SMART
SPEC	702	802	2.94e-11	SMART
Blast:SPEC	809	973	4e-73	BLAST
coiled coil region	1095	1132	N/A	INTRINSIC
Blast:SPEC	1176	1285	6e-63	BLAST
SPEC	1292	1421	4.11e0	SMART
SPEC	1439	1538	4.66e0	SMART
PLEC	1537	1581	9.05e-3	SMART
PLEC	1582	1619	2.7e0	SMART
PLEC	1657	1694	2.23e0	SMART
PLEC	1695	1732	4.25e1	SMART
PLEC	1735	1770	1.39e2	SMART
PLEC	1771	1808	7.4e-8	SMART
PLEC	1811	1846	5.8e-1	SMART
PLEC	1847	1884	2.71e1	SMART
PLEC	1886	1922	4.66e0	SMART
low complexity region	2294	2307	N/A	INTRINSIC
low complexity region	2366	2381	N/A	INTRINSIC
low complexity region	2477	2491	N/A	INTRINSIC
low complexity region	2566	2593	N/A	INTRINSIC
low complexity region	2661	2675	N/A	INTRINSIC
low complexity region	2793	2799	N/A	INTRINSIC
low complexity region	2839	2847	N/A	INTRINSIC
low complexity region	3046	3057	N/A	INTRINSIC
low complexity region	3294	3314	N/A	INTRINSIC
SPEC	3321	3427	5.36e-1	SMART
low complexity region	3515	3527	N/A	INTRINSIC
low complexity region	3548	3558	N/A	INTRINSIC
SPEC	3569	3678	2.19e-1	SMART
internal_repeat_7	3771	3811	5.08e-5	PROSPERO
SPEC	3852	3971	1.75e-9	SMART
SPEC	3978	4084	3.7e-8	SMART
SPEC	4091	4190	4.56e-8	SMART
SPEC	4200	4299	3.78e0	SMART
low complexity region	4372	4388	N/A	INTRINSIC
SPEC	4447	4552	1.98e-8	SMART
SPEC	4559	4663	3.62e-11	SMART
SPEC	4673	4773	1.65e-5	SMART
SPEC	4780	4882	7.75e-11	SMART
SPEC	4889	4989	2.3e-4	SMART
SPEC	4999	5098	3.01e0	SMART
SPEC	5105	5208	2.74e-2	SMART
SPEC	5215	5319	2.46e-4	SMART
SPEC	5326	5428	1.27e-15	SMART
SPEC	5435	5537	1.54e-14	SMART
SPEC	5544	5646	8.07e-2	SMART
SPEC	5653	5755	3.67e-12	SMART
SPEC	5762	5863	1.97e-12	SMART
SPEC	5870	5976	4.19e-7	SMART
SPEC	5983	6085	2.06e-15	SMART
SPEC	6092	6195	2.89e-10	SMART
SPEC	6202	6304	2.61e-26	SMART
SPEC	6311	6413	5.31e-18	SMART
SPEC	6420	6522	1.25e-14	SMART
SPEC	6529	6632	9.1e-17	SMART
SPEC	6639	6740	9.3e-23	SMART
SPEC	6747	6849	5.43e-15	SMART
SPEC	6859	6989	1.5e-8	SMART
EFh	7023	7051	4.12e-3	SMART
EFh	7059	7087	1.25e-2	SMART
GAS2	7098	7176	3.85e-52	SMART
low complexity region	7200	7218	N/A	INTRINSIC
low complexity region	7228	7240	N/A	INTRINSIC
low complexity region	7326	7349	N/A	INTRINSIC
PDB:3GJO|H	7377	7406	9e-10	PDB

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000138308; Gene: ENSMUSG00000026131

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	82	92	N/A	INTRINSIC
low complexity region	149	163	N/A	INTRINSIC
CH	215	314	1.62e-28	SMART
CH	331	428	3.72e-19	SMART
PDB:2ODU|A	439	657	1e-42	PDB
low complexity region	698	723	N/A	INTRINSIC
SPEC	780	877	8.64e-9	SMART
SPEC	880	980	2.94e-11	SMART
Blast:SPEC	987	1151	5e-73	BLAST
coiled coil region	1273	1310	N/A	INTRINSIC
Blast:SPEC	1354	1463	8e-63	BLAST
SPEC	1470	1599	4.11e0	SMART
SPEC	1617	1716	4.66e0	SMART
PLEC	1715	1759	9.05e-3	SMART
PLEC	1760	1797	2.7e0	SMART
PLEC	1835	1872	2.23e0	SMART
PLEC	1873	1910	4.25e1	SMART
PLEC	1913	1948	1.39e2	SMART
PLEC	1949	1986	7.4e-8	SMART
PLEC	1989	2024	5.8e-1	SMART
PLEC	2025	2062	2.71e1	SMART
PLEC	2064	2100	4.66e0	SMART
low complexity region	2472	2485	N/A	INTRINSIC
low complexity region	2544	2559	N/A	INTRINSIC
low complexity region	2655	2669	N/A	INTRINSIC
low complexity region	2744	2771	N/A	INTRINSIC
low complexity region	2839	2853	N/A	INTRINSIC
low complexity region	2971	2977	N/A	INTRINSIC
low complexity region	3017	3025	N/A	INTRINSIC
low complexity region	3224	3235	N/A	INTRINSIC
low complexity region	3472	3492	N/A	INTRINSIC
SPEC	3499	3605	5.36e-1	SMART
low complexity region	3693	3705	N/A	INTRINSIC
low complexity region	3726	3736	N/A	INTRINSIC
SPEC	3747	3856	2.19e-1	SMART
internal_repeat_12	3949	3989	5.99e-5	PROSPERO
SPEC	4030	4149	1.75e-9	SMART
SPEC	4156	4262	3.7e-8	SMART
SPEC	4269	4368	4.56e-8	SMART
SPEC	4378	4477	3.78e0	SMART
low complexity region	4550	4566	N/A	INTRINSIC
SPEC	4625	4730	1.98e-8	SMART
SPEC	4737	4841	3.62e-11	SMART
SPEC	4851	4951	1.65e-5	SMART
SPEC	4958	5060	7.75e-11	SMART
SPEC	5067	5167	2.3e-4	SMART
SPEC	5177	5276	3.01e0	SMART
SPEC	5283	5386	2.74e-2	SMART
SPEC	5393	5497	2.46e-4	SMART
SPEC	5504	5606	1.27e-15	SMART
SPEC	5613	5715	1.69e-11	SMART
SPEC	5722	5824	9.33e-5	SMART
SPEC	5831	5933	8.07e-2	SMART
SPEC	5940	6042	3.67e-12	SMART
SPEC	6049	6150	1.97e-12	SMART
SPEC	6157	6263	4.19e-7	SMART
SPEC	6270	6372	2.06e-15	SMART
SPEC	6379	6482	2.89e-10	SMART
SPEC	6489	6591	2.61e-26	SMART
SPEC	6598	6700	5.31e-18	SMART
SPEC	6707	6809	1.25e-14	SMART
SPEC	6816	6919	9.1e-17	SMART
SPEC	6926	7027	9.3e-23	SMART
SPEC	7034	7136	5.43e-15	SMART
SPEC	7146	7276	1.5e-8	SMART
EFh	7310	7338	4.12e-3	SMART
EFh	7346	7374	1.25e-2	SMART
GAS2	7385	7463	3.08e-51	SMART
low complexity region	7511	7529	N/A	INTRINSIC
low complexity region	7539	7551	N/A	INTRINSIC
low complexity region	7637	7660	N/A	INTRINSIC
PDB:3GJO|H	7688	7717	9e-10	PDB

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000138376; Gene: ENSMUSG00000026131

Domain	Start	End	E-Value	Type
PDB:2ODU|A	2	95	4e-7	PDB
low complexity region	136	161	N/A	INTRINSIC
SPEC	218	315	5.4e-11	SMART
SPEC	318	418	1.8e-13	SMART
Blast:SPEC	425	589	1e-73	BLAST
coiled coil region	711	748	N/A	INTRINSIC
Blast:SPEC	792	901	4e-63	BLAST
SPEC	908	1037	2.6e-2	SMART
coiled coil region	1071	1805	N/A	INTRINSIC
PLEC	2061	2098	1.6e-6	SMART
PLEC	2099	2136	4.4e-10	SMART
PLEC	2137	2172	7.8e-5	SMART
PLEC	2173	2210	6.8e-8	SMART
PLEC	2252	2297	2.7e-3	SMART
PLEC	2298	2348	3.7e-1	SMART
PLEC	2368	2407	5.5e-6	SMART
PLEC	2408	2445	1.5e-14	SMART
PLEC	2446	2483	1.1e-10	SMART
PLEC	2484	2521	1.3e-7	SMART
PLEC	2522	2559	5e-1	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000141127; Gene: ENSMUSG00000026131

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
PDB:2ODU|A	56	153	6e-8	PDB
low complexity region	194	219	N/A	INTRINSIC
SPEC	276	373	5.4e-11	SMART
SPEC	376	476	1.8e-13	SMART
Blast:SPEC	483	647	1e-73	BLAST
coiled coil region	769	806	N/A	INTRINSIC
Blast:SPEC	850	959	1e-62	BLAST
SPEC	966	1095	2.6e-2	SMART
SPEC	1113	1212	2.9e-2	SMART
SPEC	1229	1338	1.4e-3	SMART
internal_repeat_10	1431	1471	9.93e-6	PROSPERO
SPEC	1512	1631	1.1e-11	SMART
SPEC	1638	1744	2.3e-10	SMART
SPEC	1751	1850	2.9e-10	SMART
SPEC	1860	1959	2.4e-2	SMART
low complexity region	2032	2048	N/A	INTRINSIC
SPEC	2107	2212	1.2e-10	SMART
SPEC	2219	2323	2.3e-13	SMART
SPEC	2333	2433	1.1e-7	SMART
SPEC	2440	2542	5e-13	SMART
SPEC	2549	2649	1.4e-6	SMART
SPEC	2659	2758	1.9e-2	SMART
SPEC	2765	2868	1.8e-4	SMART
SPEC	2875	2979	1.5e-6	SMART
SPEC	2986	3088	8.2e-18	SMART
SPEC	3095	3197	1.1e-13	SMART
SPEC	3204	3306	6e-7	SMART
SPEC	3313	3415	5.1e-4	SMART
SPEC	3422	3524	2.3e-14	SMART
SPEC	3531	3632	1.3e-14	SMART
SPEC	3639	3745	2.6e-9	SMART
SPEC	3752	3854	1.3e-17	SMART
SPEC	3861	3964	1.8e-12	SMART
SPEC	3971	4073	1.6e-28	SMART
SPEC	4080	4182	3.3e-20	SMART
SPEC	4189	4291	7.6e-17	SMART
SPEC	4298	4401	5.6e-19	SMART
SPEC	4408	4509	5.9e-25	SMART
SPEC	4516	4618	3.4e-17	SMART
SPEC	4628	4758	9.7e-11	SMART
EFh	4792	4820	2e-5	SMART
EFh	4828	4856	6e-5	SMART
GAS2	4867	4945	9.8e-56	SMART
low complexity region	4969	4987	N/A	INTRINSIC
low complexity region	4997	5009	N/A	INTRINSIC
low complexity region	5095	5118	N/A	INTRINSIC
PDB:3GJO|H	5146	5175	3e-9	PDB

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000139888; Gene: ENSMUSG00000026131

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
PDB:2ODU|A	56	161	6e-8	PDB
low complexity region	194	219	N/A	INTRINSIC
SPEC	276	373	5.4e-11	SMART
SPEC	376	476	1.8e-13	SMART
Blast:SPEC	483	648	3e-75	BLAST
coiled coil region	770	807	N/A	INTRINSIC
Blast:SPEC	849	960	2e-58	BLAST
SPEC	967	1096	2.6e-2	SMART
SPEC	1114	1213	2.9e-2	SMART
PLEC	1212	1256	5.5e-5	SMART
PLEC	1257	1294	1.7e-2	SMART
PLEC	1332	1369	1.4e-2	SMART
PLEC	1370	1407	2.7e-1	SMART
PLEC	1410	1445	8.7e-1	SMART
PLEC	1446	1483	4.8e-10	SMART
PLEC	1486	1521	3.6e-3	SMART
PLEC	1522	1559	1.7e-1	SMART
PLEC	1561	1597	3e-2	SMART
low complexity region	1969	1982	N/A	INTRINSIC
low complexity region	2041	2056	N/A	INTRINSIC
low complexity region	2152	2166	N/A	INTRINSIC
low complexity region	2241	2268	N/A	INTRINSIC
low complexity region	2336	2350	N/A	INTRINSIC
low complexity region	2468	2474	N/A	INTRINSIC
low complexity region	2514	2522	N/A	INTRINSIC
low complexity region	2721	2732	N/A	INTRINSIC
low complexity region	2969	2987	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000140560; Gene: ENSMUSG00000026131

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
CH	77	176	8.1e-31	SMART
CH	193	290	1.8e-21	SMART
PDB:2ODU|A	301	519	1e-43	PDB
SCOP:d1hcia1	308	423	4e-39	SMART
low complexity region	560	585	N/A	INTRINSIC
SPEC	642	739	5.4e-11	SMART
SPEC	742	842	1.8e-13	SMART
Blast:SPEC	849	1013	3e-73	BLAST
coiled coil region	1135	1172	N/A	INTRINSIC
Blast:SPEC	1216	1325	2e-62	BLAST
SPEC	1332	1461	2.6e-2	SMART

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9474
• Is this an essential gene?: Possibly nonessential (E-score: 0.338)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, gDNA
• MMRRC Submission: 038167-MU
• Last Updated: 2019-09-04 9:47 PM by Anne Murray
• Record Created: 2014-11-21 4:37 PM by Jeff SoRelle
• Record Posted: 2015-03-03
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Jeff SoRelle, William McAlpine, Zhe Chen, Noelle Hutchins

Accession Number

NCBI RefSeq: NM_001276764, NM_134448, NM_133833, NM_010081; MGI:104627

Alleles Listed at MGI

All mutations/alleles(297) : Chemically induced (ENU)(3) Chemically induced (other)(1) Gene trapped(274) Spontaneous(15) Targeted(3) Transgenic(1)

Phenotypic Description

Figure 1. Gobble mice have an abnormal gait.

Figure 2. Gobble mice exhibit reduced body weights. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The gobble phenotype was identified among N-Nitroso-N-ethylurea (ENU)-induced G3 mutants of pedigree R1395, some of which had an ataxic gait (Figure 1). The mice had reduced body weights compared to wild-type mice (Figure 2) and one was noted to make a constant clucking sound.

Nature of Mutation

Figure 3. Linkage mapping of the reduced body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 66 mutations (X-axis) identified in the G1 male of pedigree R1395. Scaled weight phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 66 mutations. The neurological and body weight phenotypes were linked to a mutation in Dst: a T to C transition at base pair 34,165,155 (v38) on chromosome 1, or base pair 256,949 in the GenBank genomic region NC_000067 within the donor splice site of intron 19 in the longest isoform (i.e., DST-b1; NM_134448). The strongest association was found with a recessive model of linkage to the body weight, wherein two variant homozygotes departed phenotypically from 15 homozygous reference mice and 21 heterozygous mice with a P value of 5.369 x 10^-5 (Figure 3). The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in an in-frame skipping of the 96-base pair exon 19 (out of 98 total exons). Exon 19 encodes amino acids 778-809 in the DST-b1 protein.

<--exon 18        <--exon 19 intron 19-->           exon 20-->                 <--exon 98 256211 ……CGCTTGACCATCGAG ……TCTGCCTATTTCGAG gtacgtcggtagagtcaca…… TTTTTCAATGATGCC…… ……AAGTCTTCGAAGAGATAG 773    ……-R--L--T--I--E- ……-S--A--Y--F--E-                       -F--F--N--D--A-…… ……-K--S--S--K--R--*-             correct           deleted                                          correct

Genomic numbering corresponds to NC_000067. The donor splice site of intron 19, which is destroyed by the gobble mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Alternatively, a cryptic splice site in exon 19 may be used that would result in a 43-nucleotide deletion in exon 19. Use of a cryptic site would lead to a frame-shift beginning after amino acid 794 of the coded protein and premature termination after the inclusion of 12 aberrant amino acids.

<--exon 18          <--exon 19-->           intron 19-->          exon 20--> 256211 ……CGCTTGACCATCGAG GCGTACAGAGCGGCC……TCTGCCTATTTCGAG gtacgtcggtagagtcaca…… TTTTTCAATGATGCCAAAGAAGCCACTGATTACCTAA 773    ……-R--L--T--I--E- -A--Y--R--A--A-……-S--A--Y--F--E-                       --F--S--M--M--P--K--K--P--L--N--T--*              correct         correct          deleted                                          aberrant

Genomic numbering corresponds to NC_000067. The donor splice site of intron 19, which is destroyed by the gobble mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 4. Dst encodes several DST isoforms. The DST-b1, -a1, and e isoforms are shown. Alternative splicing of the first 5' exons yields three dystonin-a/b isoforms (e.g., DST-a1, DST-a2, and DST-a3 and DST-b1, DST-b2, and DST-b3, respectively). Dystonin-a/b1 contain a unique N-terminal region followed by CH1 and CH2 domains in tandem. Dystonin-a/b2 (not shown) contain a highly conserved N-terminal transmembrane (TM) domain followed by a CH1 and CH2 domain in tandem. Dystonin-a/b3 (not shown) harbor a conserved myristoylation motif (myr) followed by a single CH2 domain. The spectrin domain contains several plectin and spectrin repeats. See the text for more details. The gobble mutation is within intron 19 and is predicted to affect the DST-a and DST-b isoforms only; mutation is shown in the DST-b1 isoform only. Image is interactive; click to view other Dst mutations. Abbreviations: SPEC, spectrin repeat domain; EF, EF hands; CH1/2, calponin homology domains; IFBD, intermediate filament-binding domain, PRD, plakin-repeat domain.

Dst encodes dystonin (DST) [alternatively, bullous pemphigoid antigen 1 (Bpag1)] (1). DST is a member of the plakin family that also includes envoplakin, periplakin, desmoplakin, plectin, epiplakin and microtubule–actin cross-linking factor (MACF) [(1); reviewed in (2)]. Each of the plakin family of proteins, with the exception of epiplakin, has an N-terminal plakin domain as well as different combinations of structural domains including an actin-binding domain (ABD), a spectrin-repeat (SR)-containing rod domain, and a microtubule-binding domain (MTBD) (3). The plakin domain in DST is comprised of two pairs of SRs separated by a putative Src-homology-3 (SH3) domain; the plakin domain also contains a nuclear localization signal (4;5). The epithelial isoform of DST (DST-e) has the plakin domain, rod domain, and a C-terminal intermediate filament-binding domain/plakin-repeat domain (IFBD/PRD2) only (6). The SRs within the rod domain are three-helix bundles that comprise a coiled-coil. SRs often serve a structural role by functioning as a spacer domain between the termini of proteins (7). In the costamere of muscle fibers, the SRs of DST confer flexibility to the protein (8). Several structural and signaling proteins interact with DST through the SR domain (9). For example, the SR domain of the neuronal isoform of DST (DST-a1) binds dynactin p150^Glued to mediate proper retrograde axonal transport (10). The MTBD domain in DST-a1 mediates the ability of DST to coalign with microtubules throughout the cytoplasm (11). The GAR/GAS2 domain binds to and stabilizes microtubules, while the GSR region bundles microtubules (12). An SxIP motif at the C-terminus of DST-a/b forms a complex with end-binding protein 1 (EB1), a component of the microtubule plus end complex (13). DST-b1 differs from DST-a1 in that DST-b1 has a putative IFBD/PRD2 following the plakin domain

Dst encodes tissue-specific DST isoforms, including neuronal DST-a, muscle isoforms (DST-b), and the epithelial DST-e [Figure 4; (1;14-16); reviewed in (2)]. Alternative splicing of 5’ exons in Dst results in three tissue-specific isoforms in muscle (i.e., DST-b1/2/3) and neurons (i.e., DST-a1/2/3) [(11;14;17); reviewed in (2)]. The DST-a1 and DST-b1 isoforms share similar domains including the ABD, plakin, and rod domains as well as the EF hand calcium-binding motifs (8) and a growth arrest specific protein 2 (GAS2) related (GAR) domain that contains a MTBD and a Gly-Ser-Arg (GSR) repeat region (6;14). Each DST isoform has different domains upstream of the ABD (1;18). The unique N-terminal domains found in the DST-a isoforms facilitates cell-specific localization and function (17;19-21).  DST-a2/b2 have an N-terminal transmembrane domain upstream of tandem calponin-homology (CH)1/CH2 domains (11). The transmembrane domain of the DST-a2 isoform directs the isoform to the membranes of the perinuclear region [reviewed in (2)]. CH domains fold into four linked α-helices (22). The CH1 domain alone can colocalize with stress fibers, but not as efficiently as the CH1 and CH2 domains together; however, the CH2 domain alone does not associate with actin stress fibers [reviewed in (2)]. The DST-a1/b1 isoforms lack N-terminal transmembrane domains, but have CH1 and CH2 domains [reviewed in (2)]. The DST-a3/b3 isoforms do not have a transmembrane domain or a CH1 domain, but have a myristoylation motif followed by one CH2 domain [reviewed in (2)]. DST-3a can also be palmitoylated at its N-terminus. The myristoylation and/or palmitoylation promotes membrane binding (17).

The gobble mutation is predicted to affect all of the DST isoforms. The affect of the mutation on DST^gobble expression is unknown.

Expression/Localization

The expression of the DST isoforms is tissue-specific, although lower levels of each isoform can be amplified from nondominant tissues (14).

In the adult brain, DST-a1 and DST-a2 transcripts can be detected, but only small amounts of DST-a3 transcripts. DST-3a is the major isoform in the lung, while DST-a2 and DST-a3 are the major isoforms in the kidney and testis. All of the DST-a isoforms were expressed in the liver, spleen, and ovary (17). DST-a1 localizes to the cytoplasm and at the plasma membrane, while DST-a2 localized with actin stress fibers and actin filaments at the nuclear and perinuclear membranes [(5;11;17); reviewed in (2)]. The localization of DST-a3 is unknown.DST-a is expressed as early as embryonic day (E) 9.5 in the developing spinal cord and brain (14;23). During embryogenesis, DST-a is highly expressed in the ventral horn. At E17.5, the levels of DST-a are reduced in the embryonic motor neurons compared to levels in the dorsal root ganglion, but DST-a levels persist in postnatal motor neurons (24). At postnatal day (P)10, DST-a is expressed in the cortex, dentate gyrus, and hippocampal regions (CA1-CA3), in the thalamic nuclei, and in the granular and Purkinje cell layers of the cerebellum (23;25). In the adult, DST-a is expressed in the soma, axons, and preterminal branches of the peripheral and central nervous system (25;26).  Dst-a is expressed in various cranial nerves including I (optic), II (olfactory), V (trigeminal), VII (facial), VIII (vestibulocochlear), IX (glossopharyngeal), and X (Vagus) [reviewed in (2)].

DST-b is expressed in heart and skeletal muscle (14). DST-b localizes to Z-discs, intercalated discs, and sarcolemma (27).

DST-e is expressed in the epidermis and mucosal epithelia of the digestive tract (14;25;26). DST-e has slight expression in the testis, ovary, and lung (17). Within epithelial cells, DST-e localizes to hemidesmosomes (5).

Background

Figure 5. Putative Dystonin-a functions in the cell. Dystonin-a1 interacts wtih actin microfilaments, microtubules, dynactin p150 Glued . Dystonin-a2 localizes to the intranuclear space and nuclear envelope where it associates with the outer nuclear envelope protein nesprin-3α. Dystonin-a1 maintains ER membrane organization through interactions with cytoskeletal filaments, with the Golgi, and actin microfilaments. Dystonin-a3 localizes to the cell membrane and interacts with cytoskeletal filaments. Figure adapted from Ferrier, A., et al. 2014 .

Interactions within the cytoskeletal network are essential for cell motility, growth cone guidance, cellular division, chromosomal separation, and wound healing [reviewed in (2)]. Proteins in the plakin family are scaffold proteins that link intermediate filaments to desmosomes and hemidesmosomes to regulate cytoskeletal dynamics, cell migration, differentiation, and stress responses (17;28;29). The individual functions of the DST isoforms are discussed, below.

DST-a

The DST-a isoforms bind actin filaments, intermediate filaments, and microtubules to maintain cytoskeletal integrity [Figure 5; (26;30;31)]. DST-a is essential for the development and survival of neurons in mice and humans (23;32;33). DST-a1 and DST-a3, which localize to the plasma membrane are proposed to function in the invagination process of immature vesicles and the subsequent trafficking and fusion of the vesicles with endosomes [reviewed in (2)]. The localization of DST-a2 to the perinuclear region of the cell as well as its association with the actin cytoskeleton indicates that DST-a2 may regulate nucleus, endoplasmic reticulum (ER), and/or Golgi integrity (11). In addition, DST-a2 may regulate the development and transport of membrane compartments in the secretory pathway through an interaction with clathrin and microtubule-association protein 1B (MAP1B) (19). Silencing of DST-a2 in immortalized neuronal cells disrupts ER homeostasis (20). In Dst mutant mice (Dst²⁷ and Dst^Tg4), organelle integrity is lost leading to ER-mediated apoptosis of sensory neurons (20). In addition, the ER was dilated and ER stress proteins were activated (20). DST-a2 is required to maintain the structural integrity of the Golgi through an association with microtubules near the centrosome and the dynamics of the secretory pathway (19). Loss of DST-a2 expression resulted in defective anterograde transport and secretion along with dilation of the Golgi (19). DST-a2 and MAP1B also maintain the perinuclear acetylation of α-tubulin, a modification that is required for Golgi organization (19). Homozygous mutations in DST that cause loss of DST-a1/2/3 expression have been documented to cause hereditary sensory and autonomic neuropathy type 6 (HSAN6) (32;34). Patients with HSAN6 exhibit limb contractures and dysautonomia and the condition is ultimately fatal (34). A mutation within the MTBD of the DST-a/b isoforms leads to sensory autonomic neuropathy with dysautonomia, severe psychomotor retardation, and early death (32). A translocation disrupting the DST-a and DST-b isoforms can also cause encephalopathy, motor and mental retardation, and visual impairment (35).
 

DST-B

DST-b associates with microfilaments, intermediate filaments and microtubules in the muscle (14). DST-b is proposed to function in the maintenance of muscle cell architecture by crosslinking actin with desmin filaments (36). DST-b is not required for myogenic differentiation (37).The cytoarchitecture of the skeletal muscle in Dst knockout (Dst^-/-) mice is disorganized; terminally differentiated myotubes contained myofibrils that were imcompletely assembled (36). In addition, there was an abnormal distribution of mitochondria in the skeletal muscle of the Dst^-/- mice (36). Loss of DST-b function may contribute to the muscle weakness observed in Dst^-/- mice (36).

DST-e
DST-e localizes to hemidesmosomes and binds keratin intermediate filaments in keratinocytes in the epidermis, functioning as an intracellular bridge and maintaining cellular integrity (14;38;39). DST-e also functions in hemidesmosome maturation and the suppression of focal adhesion dynamics (40). DST-e loss-of-function mutations result in defects in keratinocyte morphology, adhesion, and migration (40). The observed change in keratinocyte migration was found to be due to alterations in surface β4 integrin and active β1 integrin stability at adhesion sites. DST-e is as an autoantigen in bullous pemphigoid, an autoimmune subepidermal blistering disease (38;41;42). Mutations affecting the DST-e isoform lead to epidermolysis bullosa simplex with fragility of basal keratinocytes and skin blistering (41;43). Dst^-/- mice with a targeted mutation in the 5’ end of the coding region have more fragile skin than wild-type mice and exhibit microscopic skin lesions (18).

Putative Mechanism

Several Dst mouse models have been characterized and all exhibit variability in phentoypic severity and survival. It is unclear whether phenotypic differences were due to the genetic backgrounds of the mutant mice or due to the impact of the mutation on the expression pattern of the DST-a isoforms. Collectively, the phenotype of mice with mutations in Dst is referred to as dystonia musculorum (dt) and is characterized by sensory neuron degeneration, ataxia, tremor, muscle weakness, low body weights, and reduced numbers of motor neurons at approximately 2 weeks after birth (44-48). The neuronal phenotype in the Dst^dt mice progresses quickly with mice exhibiting uncoordinated limb movement, and writhing and twisting of the trunk as well as hyperflexion and pronation of foot paws (44;45). Dt affects the function of cranial nerves V, VII, IX, and X; the function of cranial nerves I, II, and VIII are maintained leading to intact hearing and vision (23;24). Skeletal muscle in the dt  mice were weak and the cytoarchitecture disorganized (36). Dt mutant mice exhibit lethality at approximately P14-21. Increased expression of DST-a2 in the neural tissues of the Dst^Tg4/Tg4 mouse model reduced the severity of the disease including a progressive weight gain between P16 and P52 and increased the life span of the mice to a mean of P55 due to improved microtubule and organelle integrity within proprioceptive sensory neurons and subsequent delayed apoptosis of the sensory neurons (34).

The dt phenotype is due to degeneration in large and medium-sized proprioceptive primary sensory afferents of the dorsal root ganglion and cranial nerves (31;46). The microtubule network is disorganized and the cytoplasmic organelles accumulate within axonal swellings; axonal swelling were observed in sensory nerve fibers as early as E15.5 (49). In the Dst^J/Dst^J model, γ-aminobutyric acid (GABA) synthesis was diminished in striatum and substantia nigra with a concomitant decrease of glutamate, aspartate, and GABA in the cerebellar vermis (50). In the Dst^27J mouse model, orthograde and retrograde axonal transport of acetylcholinesterase was affected in the sciatic nerves and the number of alpha motor neurons and motor axons of the L1 spinal cord are reduced (51).

The phenotype observed in the gobble mice indicates a loss-of-function for DST-a/b^gobble. Skin lesions were not observed in gobble, indicating that expression of DST-e may be functional.

Primers

PCR Primer
gobble_pcr_F: TCCTTAATGCACACAGAGCGCC
gobble_pcr_R: TTTCCCCTCTAGGATGAGACAGCAG

Sequencing Primer
gobble_seq_F: AGGCCAGGAATTGCACCTTC
gobble_seq_R: TAGGATGAGACAGCAGCACTTAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 486 nucleotides is amplified (chromosome 1, + strand):

1   tccttaatgc acacagagcg ccccctcctg ggaggccagg aattgcacct tctacataaa
61  caggtttcac aattcatgaa ttagatgtgc tttctacagt attttttctt tatgaaagat
121 aaatacgctg cattaaataa gaagccctca aatagatgag tgttttaaat attattatat
181 attaaatgta ataattccaa tgatctgccc agctttcact gtgtctcctc cctcaggcgt
241 acagagcggc catgcagaca cagtggagct ggatcctaca gctgtgccag tgcgtggagc
301 agcacattca ggagaactct gcctatttcg aggtacgtcg gtagagtcac agcgtgaaca
361 cacagcattg ctgtttgggc cgaggtgcag aactaccaca aagaaacaat gtgcagagca
421 cacggggagt aagccagtac gttcttttca ggacctaagt gctgctgtct catcctagag
481 gggaaa

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Brown, A., Dalpe, G., Mathieu, M., and Kothary, R. (1995) Cloning and Characterization of the Neural Isoforms of Human Dystonin. Genomics. 29, 777-780.

  2. Ferrier, A., Boyer, J. G., and Kothary, R. (2013) Cellular and Molecular Biology of Neuronal Dystonin. Int Rev Cell Mol Biol. 300, 85-120.

  3. Sonnenberg, A., and Liem, R. K. (2007) Plakins in Development and Disease. Exp Cell Res. 313, 2189-2203.

  4. Jefferson, J. J., Ciatto, C., Shapiro, L., and Liem, R. K. (2007) Structural Analysis of the Plakin Domain of Bullous Pemphigoid antigen1 (BPAG1) Suggests that Plakins are Members of the Spectrin Superfamily. J Mol Biol. 366, 244-257.

  5. Young, K. G., Pool, M., and Kothary, R. (2003) Bpag1 Localization to Actin Filaments and to the Nucleus is Regulated by its N-Terminus. J Cell Sci. 116, 4543-4555.

  6. Pool, M., Boudreau Lariviere, C., Bernier, G., Young, K. G., and Kothary, R. (2005) Genetic Alterations at the Bpag1 Locus in Dt Mice and their Impact on Transcript Expression. Mamm Genome. 16, 909-917.

  7. Djinovic-Carugo, K., Gautel, M., Ylanne, J., and Young, P. (2002) The Spectrin Repeat: A Structural Platform for Cytoskeletal Protein Assemblies. FEBS Lett. 513, 119-123.

  8. Broderick, M. J., and Winder, S. J. (2005) Spectrin, Alpha-Actinin, and Dystrophin. Adv Protein Chem. 70, 203-246.

  9. Le Rumeur, E., Hubert, J. F., and Winder, S. J. (2012) A New Twist to Coiled Coil. FEBS Lett. 586, 2717-2722.

  10. Liu, J. J., Ding, J., Kowal, A. S., Nardine, T., Allen, E., Delcroix, J. D., Wu, C., Mobley, W., Fuchs, E., and Yang, Y. (2003) BPAG1n4 is Essential for Retrograde Axonal Transport in Sensory Neurons. J Cell Biol. 163, 223-229.

  11. Young, K. G., Pinheiro, B., and Kothary, R. (2006) A Bpag1 Isoform Involved in Cytoskeletal Organization Surrounding the Nucleus. Exp Cell Res. 312, 121-134.

  12. Sun, D., Leung, C. L., and Liem, R. K. (2001) Characterization of the Microtubule Binding Domain of Microtubule Actin Crosslinking Factor (MACF): Identification of a Novel Group of Microtubule Associated Proteins. J Cell Sci. 114, 161-172.

  13. Slep, K. C., Rogers, S. L., Elliott, S. L., Ohkura, H., Kolodziej, P. A., and Vale, R. D. (2005) Structural Determinants for EB1-Mediated Recruitment of APC and Spectraplakins to the Microtubule Plus End. J Cell Biol. 168, 587-598.

  14. Leung, C. L., Zheng, M., Prater, S. M., and Liem, R. K. (2001) The BPAG1 Locus: Alternative Splicing Produces Multiple Isoforms with Distinct Cytoskeletal Linker Domains, Including Predominant Isoforms in Neurons and Muscles. J Cell Biol. 154, 691-697.

  15. Okumura, M., Yamakawa, H., Ohara, O., and Owaribe, K. (2002) Novel Alternative Splicings of BPAG1 (Bullous Pemphigoid Antigen 1) Including the Domain Structure Closely Related to MACF (Microtubule Actin Cross-Linking Factor). J Biol Chem. 277, 6682-6687.

  16. Sawamura, D., Li, K., Chu, M. L., and Uitto, J. (1991) Human Bullous Pemphigoid Antigen (BPAG1). Amino Acid Sequences Deduced from Cloned cDNAs Predict Biologically Important Peptide Segments and Protein Domains. J Biol Chem. 266, 17784-17790.

  17. Jefferson, J. J., Leung, C. L., and Liem, R. K. (2006) Dissecting the Sequence Specific Functions of Alternative N-Terminal Isoforms of Mouse Bullous Pemphigoid Antigen 1. Exp Cell Res. 312, 2712-2725.

  18. Guo, L., Degenstein, L., Dowling, J., Yu, Q. C., Wollmann, R., Perman, B., and Fuchs, E. (1995) Gene Targeting of BPAG1: Abnormalities in Mechanical Strength and Cell Migration in Stratified Epithelia and Neurologic Degeneration. Cell. 81, 233-243.

  19. Ryan, S. D., Ferrier, A., and Kothary, R. (2012) A Novel Role for the Cytoskeletal Linker Protein Dystonin in the Maintenance of Microtubule Stability and the Regulation of ER-Golgi Transport. Bioarchitecture. 2, 2-5.

  20. Ryan, S. D., Ferrier, A., Sato, T., O'Meara, R. W., De Repentigny, Y., Jiang, S. X., Hou, S. T., and Kothary, R. (2012) Neuronal Dystonin Isoform 2 is a Mediator of Endoplasmic Reticulum Structure and Function. Mol Biol Cell. 23, 553-566.

  21. Young, K. G., and Kothary, R. (2008) Dystonin/Bpag1 is a Necessary Endoplasmic reticulum/nuclear Envelope Protein in Sensory Neurons. Exp Cell Res. 314, 2750-2761.

  22. Korenbaum, E., and Rivero, F. (2002) Calponin Homology Domains at a Glance. J Cell Sci. 115, 3543-3545.

  23. Bernier, G., Brown, A., Dalpe, G., De Repentigny, Y., Mathieu, M., and Kothary, R. (1995) Dystonin Expression in the Developing Nervous System Predominates in the Neurons that Degenerate in Dystonia Musculorum Mutant Mice. Mol Cell Neurosci. 6, 509-520.

  24. Dowling, J., Yang, Y., Wollmann, R., Reichardt, L. F., and Fuchs, E. (1997) Developmental Expression of BPAG1-n: Insights into the Spastic Ataxia and Gross Neurologic Degeneration in Dystonia Musculorum Mice. Dev Biol. 187, 131-142.

  25. Dalpe, G., Leclerc, N., Vallee, A., Messer, A., Mathieu, M., De Repentigny, Y., and Kothary, R. (1998) Dystonin is Essential for Maintaining Neuronal Cytoskeleton Organization. Mol Cell Neurosci. 10, 243-257.

  26. Yang, Y., Dowling, J., Yu, Q. C., Kouklis, P., Cleveland, D. W., and Fuchs, E. (1996) An Essential Cytoskeletal Linker Protein Connecting Actin Microfilaments to Intermediate Filaments. Cell. 86, 655-665.

  27. Steiner-Champliaud, M. F., Schneider, Y., Favre, B., Paulhe, F., Praetzel-Wunder, S., Faulkner, G., Konieczny, P., Raith, M., Wiche, G., Adebola, A., Liem, R. K., Langbein, L., Sonnenberg, A., Fontao, L., and Borradori, L. (2010) BPAG1 Isoform-b: Complex Distribution Pattern in Striated and Heart Muscle and Association with Plectin and Alpha-Actinin. Exp Cell Res. 316, 297-313.

  28. Bouameur, J. E., Favre, B., and Borradori, L. (2014) Plakins, a Versatile Family of Cytolinkers: Roles in Skin Integrity and in Human Diseases. J Invest Dermatol. 134, 885-894.

  29. Jefferson, J. J., Leung, C. L., and Liem, R. K. (2004) Plakins: Goliaths that Link Cell Junctions and the Cytoskeleton. Nat Rev Mol Cell Biol. 5, 542-553.

  30. Saulnier, R., De Repentigny, Y., Yong, V. W., and Kothary, R. (2002) Alterations in Myelination in the Central Nervous System of Dystonia Musculorum Mice. J Neurosci Res. 69, 233-242.

  31. Carlsten, J. A., Kothary, R., and Wright, D. E. (2001) Glial Cell Line-Derived Neurotrophic Factor-Responsive and Neurotrophin-3-Responsive Neurons Require the Cytoskeletal Linker Protein Dystonin for Postnatal Survival. J Comp Neurol. 432, 155-168.

  32. Edvardson, S., Cinnamon, Y., Jalas, C., Shaag, A., Maayan, C., Axelrod, F. B., and Elpeleg, O. (2012) Hereditary Sensory Autonomic Neuropathy Caused by a Mutation in Dystonin. Ann Neurol. 71, 569-572.

  33. Goryunov, D., He, C. Z., Lin, C. S., Leung, C. L., and Liem, R. K. (2010) Nervous-Tissue-Specific Elimination of Microtubule-Actin Crosslinking Factor 1a Results in Multiple Developmental Defects in the Mouse Brain. Mol Cell Neurosci. 44, 1-14.

  34. Ferrier, A., Sato, T., De Repentigny, Y., Gibeault, S., Bhanot, K., O'Meara, R. W., Lynch-Godrei, A., Kornfeld, S. F., Young, K. G., and Kothary, R. (2014) Transgenic Expression of Neuronal Dystonin Isoform 2 Partially Rescues the Disease Phenotype of the Dystonia Musculorum Mouse Model of Hereditary Sensory Autonomic Neuropathy VI. Hum Mol Genet. 23, 2694-2710.

  35. Giorda, R., Cerritello, A., Bonaglia, M. C., Bova, S., Lanzi, G., Repetti, E., Giglio, S., Baschirotto, C., Pramparo, T., Avolio, L., Bragheri, R., Maraschio, P., and Zuffardi, O. (2004) Selective Disruption of Muscle and Brain-Specific BPAG1 Isoforms in a Girl with a 6;15 Translocation, Cognitive and Motor Delay, and Tracheo-Oesophageal Atresia. J Med Genet. 41, e71.

  36. Dalpe, G., Mathieu, M., Comtois, A., Zhu, E., Wasiak, S., De Repentigny, Y., Leclerc, N., and Kothary, R. (1999) Dystonin-Deficient Mice Exhibit an Intrinsic Muscle Weakness and an Instability of Skeletal Muscle Cytoarchitecture. Dev Biol. 210, 367-380.

  37. Boudreau-Lariviere, C., and Kothary, R. (2002) Differentiation Potential of Primary Myogenic Cells Derived from Skeletal Muscle of Dystonia Musculorum Mice. Differentiation. 70, 247-256.

  38. Stanley, J. R. (1993) Cell Adhesion Molecules as Targets of Autoantibodies in Pemphigus and Pemphigoid, Bullous Diseases due to Defective Epidermal Cell Adhesion. Adv Immunol. 53, 291-325.

  39. Mutasim, D. F., Takahashi, Y., Labib, R. S., Anhalt, G. J., Patel, H. P., and Diaz, L. A. (1985) A Pool of Bullous Pemphigoid Antigen(s) is Intracellular and Associated with the Basal Cell Cytoskeleton-Hemidesmosome Complex. J Invest Dermatol. 84, 47-53.

  40. Michael, M., Begum, R., Fong, K., Pourreyron, C., South, A. P., McGrath, J. A., and Parsons, M. (2014) BPAG1-e Restricts Keratinocyte Migration through Control of Adhesion Stability. J Invest Dermatol. 134, 773-782.

  41. Liu, L., Dopping-Hepenstal, P. J., Lovell, P. A., Michael, M., Horn, H., Fong, K., Lai-Cheong, J. E., Mellerio, J. E., Parsons, M., and McGrath, J. A. (2012) Autosomal Recessive Epidermolysis Bullosa Simplex due to Loss of BPAG1-e Expression. J Invest Dermatol. 132, 742-744.

  42. Di Zenzo, G., Della Torre, R., Zambruno, G., and Borradori, L. (2012) Bullous Pemphigoid: From the Clinic to the Bench. Clin Dermatol. 30, 3-16.

  43. Groves, R. W., Liu, L., Dopping-Hepenstal, P. J., Markus, H. S., Lovell, P. A., Ozoemena, L., Lai-Cheong, J. E., Gawler, J., Owaribe, K., Hashimoto, T., Mellerio, J. E., Mee, J. B., and McGrath, J. A. (2010) A Homozygous Nonsense Mutation within the Dystonin Gene Coding for the Coiled-Coil Domain of the Epithelial Isoform of BPAG1 Underlies a New Subtype of Autosomal Recessive Epidermolysis Bullosa Simplex. J Invest Dermatol. 130, 1551-1557.

  44. Duchen, L. W. (1976) Dystonia Musculorum--an Inherited Disease of the Nervous System in the Mouse. Adv Neurol. 14, 353-365.

  45. DUCHEN, L. W., STRICH, S. J., and FALCONER, D. S. (1964) Clinical and Pathological Studies of an Hereditary Neuropathy in Mice (Dystonia Musculorum). Brain. 87, 367-378.

  46. Sotelo, C., and Guenet, J. L. (1988) Pathologic Changes in the CNS of Dystonia Musculorum Mutant Mouse: An Animal Model for Human Spinocerebellar Ataxia. Neuroscience. 27, 403-424.

  47. Messer, A., and Strominger, N. L. (1980) An Allele of the Mouse Mutant Dystonia Musculorum Exhibits Lesions in Red Nucleus and Striatum. Neuroscience. 5, 543-549.

  48. Lalonde, R., Marchetti, N., and Strazielle, C. (2005) Primary Neurologic Screening and Motor Coordination of Dstdt-J Mutant Mice (Dystonia Musculorum) with Spinocerebellar Atrophy. Physiol Behav. 86, 46-51.

  49. Bernier, G., and Kothary, R. (1998) Prenatal Onset of Axonopathy in Dystonia Musculorum Mice. Dev Genet. 22, 160-168.

  50. Messer, A., and Gordon, D. (1979) Changes in Whole Tissue Biosynthesis of Gamma-Amino Butyric Acid (GABA) in Basal Ganglia of the Dystonia (dtAlb) Mouse. Life Sci. 25, 2217-2221.

  51. De Repentigny, Y., Ferrier, A., Ryan, S. D., Sato, T., and Kothary, R. (2011) Motor Unit Abnormalities in Dystonia Musculorum Mice. PLoS One. 6, e21093.