Phenotypic Mutation 'Tigrou-like' (pdf version)
List |< first << previous [record 518 of 584] next >> last >|
AlleleTigrou-like
Mutation Type missense
ChromosomeX
Coordinate106,105,250 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Atp7a
Gene Name ATPase, Cu++ transporting, alpha polypeptide
Synonym(s) MNK, br, Menkes protein
Chromosomal Location 106,027,276-106,124,926 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions in copper transport across membranes. This protein is localized to the trans Golgi network, where it is predicted to supply copper to copper-dependent enzymes in the secretory pathway. It relocalizes to the plasma membrane under conditions of elevated extracellular copper, and functions in the efflux of copper from cells. Mutations in this gene are associated with Menkes disease, X-linked distal spinal muscular atrophy, and occipital horn syndrome. Alternatively-spliced transcript variants have been observed. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mutations in this gene affect copper metabolism and, depending on the allele, result in abnormal pigmentation, vibrissae, hair, and skeleton. Behavior may be abnormal and defects of collagen and elastin fibers are reported. Some alleles are hemizygous lethal. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009726; MGI: 99400

Mapped Yes 
Amino Acid Change Alanine changed to Valine
Institutional SourceBeutler Lab
Ref Sequences
A998V in Ensembl: ENSMUSP00000109186 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:HMA 11 72 1.5e-9 PFAM
Pfam:HMA 174 235 2.2e-8 PFAM
Pfam:HMA 280 344 1.9e-9 PFAM
low complexity region 348 362 N/A INTRINSIC
Pfam:HMA 380 441 6.4e-11 PFAM
Pfam:HMA 482 543 2.5e-7 PFAM
Pfam:HMA 558 619 9.3e-10 PFAM
transmembrane domain 643 665 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
Pfam:E1-E2_ATPase 777 1025 6.5e-47 PFAM
Pfam:Hydrolase 1029 1304 1.3e-40 PFAM
Pfam:Hydrolase_3 1272 1336 5.4e-2 PFAM
transmembrane domain 1350 1372 N/A INTRINSIC
transmembrane domain 1376 1398 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using Ensembl: ENSMUSP00000109186)
Phenotypic Category
Phenotypequestion? Literature verified References
lethality-embryonic/perinatal
pigmentation
skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI
All alleles(88) : Targeted, other(2) Gene trapped(48) Spontaneous(23) Chemically induced(9) Radiation induced(8)
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Atp7a APN X 106109830 unclassified probably damaging 0.97
IGL02023:Atp7a APN X 106094982 unclassified probably damaging 0.99
IGL02597:Atp7a APN X 106069888 unclassified probably benign 0.44
IGL03285:Atp7a APN X 106109775 unclassified probably benign
brown UTSW X 106088491 missense possibly damaging 0.48
Golden UTSW X unclassified
Silver UTSW X unclassified
Tigrou UTSW X 106088407 nonsense
Ups UTSW X 106088491 missense possibly damaging 0.48
R0240:Atp7a UTSW X 106109841 missense probably damaging 1.00
R0240:Atp7a UTSW X 106109841 missense probably damaging 1.00
R3434:Atp7a UTSW X 106094857 missense probably benign 0.00
R3435:Atp7a UTSW X 106094857 missense probably benign 0.00
R3756:Atp7a UTSW X 106101843 intron probably null
R4911:Atp7a UTSW X 106120374 missense probably damaging 0.99
R5072:Atp7a UTSW X 106109768 missense probably benign
R5073:Atp7a UTSW X 106109768 missense probably benign
R5074:Atp7a UTSW X 106109768 missense probably benign
Mode of Inheritance X-linked Dominant
Local Stock Embryos, gDNA
Repository

none

Last Updated 2016-05-13 3:09 PM by Anne Murray
Record Created unknown
Record Posted 2008-04-04
Phenotypic Description
Heterozygous Tigrou-like females are black with brown stripes on the back, belly and face (Figure 1) (1).  These stripes do not appear to cross the midline. The strength of the phenotype increases with age, the brown coat color becoming lighter with time.  Closer examination of newborn mutant females shows that the skin itself is lighter in color at the sites destined to become covered with brown hair.

 

The Tigrou-like mutation appears to be lethal in utero; hemizygous males were not observed postpartum (1).  

Nature of Mutation

The Tigrou-like mutation corresponds to a C to T transition at position 3073 of the Atp7a transcript, in exon 15 of 23 total exons.

 

3057 TGTTCACTGGGACTAGCCACTCCAACTGCTGTG
993  -C--S--L--G--L--A--T--P--T--A--V-
 
The mutated nucleotide is indicated in red lettering and results in an alanine to valine change at amino acid 998 in the ATP7A protein.
Protein Prediction
Figure 2. Domain organization and function of ATP7A. A, Topography. B, Domain structure. MBD1-MBD6 represent the N-terminal metal binding domains with the Cu-binding cysteines indicated. Critical residues thought to bind Cu in transmembrane domains 6, 7, and 8 are shown. The canonical A-domain and P-domain residues are also indicated. The LL and PBM motifs in the C-terminal tail are necessary for subcellular localization of ATP7A. Conversion of ATP to ADP by the N-domain leads to phosphorylation of the P-domain and copper transport. The A-domain dephosphorylates the P-domain. Numbers 1, 2, and 3 indicate the order of copper binding and transport (see text). The Tigrou-like mutation results in an alanine to valine change at amino acid 998 in the ATP7A protein. This image is interactive. Click on the image to view other mutations found in ATP7A (red). Click on the mutations for more specific information.
Figure 3. ATP7A copper transport cycle. (1) In its basal state, ATP7A is localized in the trans-Golgi network (TGN). In response to raised copper concentration within the cell, ATP7A relocalizes to vesicles. (2) Copper then binds to the MB domain of ATP7A, followed by (3) ATP binding to the N domain. (4) Copper is transferred and binds to the 7th transmembrane domain followed by (5) ATP hydrolysis and P domain phosphorylation. (6) Copper is released  across the vesicle membrane to be exocytosed from the cell, stimulating (7) the dephosphorylation of the P domain. (8) ATP7A is recycled back to the TGN.

The mouse copper-transporting ATPase, ATP7A, contains 1492 residues and is 89% identical to human ATP7A located at Xq13.2-q13.3 (2;3). ATP7a is a large eight transmembrane-spanning protein belonging to the large family of P-type ATPases, along with the closely-related copper-transportase ATP7B (4;5) (Figure 2). ATP7A and ATP7B (also known as Cu-ATPases) and related proteins, form the P1b-ATPases subgroup within this family based on distinct structural and mechanistic characteristics (5). Cu-ATPases transport copper from the cytosol across cellular membranes using the energy of ATP hydrolysis. In this catalytic cycle, binding of copper to the N-terminal metal binding domains (MBD) occurs first, followed by binding of ATP to the nucleotide-binding (N)-domain (Figure 3). ATP hydrolysis and phosphorylation of the phosphorylation (P)-domain then occurs.  Finally copper is translocated and the P-domain is dephosphorylated by the actuator (A)-domain (6).  The central step in the catalytic cycle is the formation of a transient phosphorylated intermediate by transfer of γ-phosphate from ATP to the invariant aspartic acid residue in the DKTG motif located in the P-domain.  This reaction is dependent upon the binding of copper to sites within the transmembrane portion of the enzyme, while the release of copper from these sites stimulates dephosphorylation (4;6;7)

 

Both ATP7A and ATP7B contain six N-terminal metal binding domains (MBD).  Each domain contains a sequence motif with two copper-coordinating cysteines.  Copper binds as a reduced Cu(I) ion to each of these domains, although some studies suggest that the entire N-terminal region of ATP7A binds a total of four copper ions and that the metal binding sites can be functionally redundant (8-10).  Studies of ATP7B suggest that copper binding to this area of both Cu-ATPases is needed for the ATPase catalytic cycle.  In the absence of copper, the N-terminal region of these proteins interacts with the N-domain and prevents ATP from binding.  Copper binding to the MBDs disrupts this inhibition (11).  It is thought that the the two MBDs closest to the membrane (MBD5 and MBD6) are most important for the functional activity of these proteins, while the other MBDs play an autoinhibitory role.  At least one of these two sites needs to bind copper in order for copper transport to occur (4;6).  Structural information on individual MBDs of ATP7A has been obtained using nuclear magnetic resonance (NMR) studies that revealed that these domains form compactly folded structures with a βαββαβ-fold, similar to ferredoxin (see PDB ID 1Y3J as an example).  The copper-binding cysteines are located in the βα-loop and the N-terminal portion of the first α-helix and are exposed at the protein surface.  Conserved hydrophobic residues in the MBDs are located adjacent to the copper-binding motifs and form a hydrophobic core, which is likely to stabilize the metal-protein complex (4;12;13).

 

The other domains present in ATP7A are the M domain consisting of the eight transmembrane segments, the A-domain, the P-domain, and the N-domain.  All of the domains for the Cu-ATPases are located in the cytosol except for the transmembrane domains that form a channel in the cell membrane through which copper can be transported.  The sixth TM contains a highly conserved CPC sequence that characterizes P1b-ATPases.  This motif, as well as the conserved YNMS motif present in TM7 and 8, are thought to bind copper during transport through the channel (4).  The P-domain of the Cu-ATPases is relatively conserved with other P-type ATPases and contains sequences critical for ATP hydrolysis (4;6). By contrast, the N-domain contains little homology to other P-type ATPases at the amino acid level, but retains a similar three-dimensional structure (14).  The A-domain of all P-type ATPases, including ATP7A and ATP7B, contains a TGE sequence motif that is essential for dephosphorylating the P-domain.  Mutation of this motif in ATP7A results in hyperphosphorylation of the protein (15).  

 

The C-terminal tail of ATP7A contains additional functional motifs.  Mutational analysis combined with immunofluorescence microscopy demonstrated that a C-terminal di-leucine (L1487L1488 in humans and L1479L1480 in mouse ATP7A), is essential for localization of ATP7A within the trans-golgi network (TGN) (see Expression/Localization) (16;17).  A PDZ domain binding motif (PBM) also present in the C-terminal tail is necessary for the targeting of ATP7A to vesicles associated with basolateral membranes (see Expression/Localization) (17;18)

 

Figure 4.  Crystal structure of a P-type ATPase (class IB; PIB), CopA (alternatively, Lpg1024), from Legionella pneumonphila (PDB: 3RFU). CopA has significant sequence identity to human ATP7A and has copper-dependent ATPase activity in vitro.

The crystal structure of a P-type ATPase (class IB; PIB), CopA (alternatively, Lpg1024), from Legionella pneumonphila has been solved at a 3.2 Å resolution [PDB: 3RFU; (19); Figure 4].  CopA has significant sequence identity to human ATP7A and has copper-dependent ATPase activity in vitro (19). The crystal structure is residues Val74 to the carboxy-terminal Leu736; the N-terminal 73 amino acids not crystallized are part of a single MBD and are not involved in CopA ATPase activity.  The cytosolic portion of CopA has all of the characteristic domains of P-type ATPases including the A-domain, P-domain, and N-domain; the core structures are conserved between CopA and other P-type ATPases (19).  The M-domain of CopA has eight transmembrane (TM) segments comprised of six core helices that are organized similar to other P-type ATPases (20-22); the TM segments are preceded by two PIB-specific helices.  The A-domain is the cytosolic loop between the second and third TM segment (19).  The two PIB-specific helices interact with TM2 and TM6 or with TM1 and TM2, respectively (19). Examination of the membrane copper-binding sites determined that with the exception of one residue (Pro383 in CopA, Pro308 in the type II ATPase SERCA1a) within the fourth transmembrane segment, the other residues involved in ion binding in class II ATPases are not conserved in the PIB ATPases (19).

 

The Tigrou-like mutation is in the sixth transmembrane domain, which is highly conserved in mice and humans and helps form the membrane cation channel region necessary for copper transport.  It is unknown whether normal levels of the altered ATP7A protein exist in Tigrou-like mice.

Expression/Localization

In adult humans, ATP7A and ATP7B mRNA expression is somewhat complementary, with ATP7A expressed in the majority of tissues except for the liver, and ATP7B expressed primarily in the liver, but also in the kidney and placenta, and at lower levels in brain, heart and lungs (23-26).  These differences suggest tissue-specific functions for each Cu-ATPase.  In mice, Northern blot analysis of adult tissue found a similar expression pattern for Atp7a as that observed in humans with expression in the heart, brain, kidney, spleen, lung, pancreas and placenta.  Liver has a very low level of expression (2;3;23;24)In situ hybridization in mouse embryos shows that Atp7a is ubiquitously expressed throughout embryogenesis, from stage E9.5 through E18.5, and is particularly strong in the choroid plexuses of the brain.  Embryonic Atp7a expression in the liver is downregulated by adulthood (2;3;27).  

 

Antibody staining in mouse brain revealed that ATP7A expression is most abundant in the early postnatal period, reaching peak levels at P4 in neocortex and cerebellum.  In the developing and adult brain, ATP7A levels are greatest in the choroid plexus/ependymal cells of the lateral and third ventricles.  ATP7A expression decreases in most neuronal subpopulations by adulthood, but increases in CA2 hippocampal pyramidal and cerebellar Purkinje neurons.  ATP7A is also expressed in a subset of astrocytes, microglia, oligodendrocytes, tanycytes and endothelial cells in the brain (28).  In developing neurons, ATP7A is initially present in cell bodies but then found in extending axons and plays a role in synapse formation and plasticity (29).  ATP7A is abundantly expressed in vascular smooth muscle cells, vascular endothelial cells, aorta, and cerebrovascular endothelial cells (4;30).  ATP7A is also expressed in the human mammary gland as well as the placenta.  Expression in these areas changes dynamically in response to hormones and is consistent with the transport of copper across the placenta into the developing embryo and into milk for ingestion by infants (31;32).  ATP7A is expressed in the trans-Golgi of human macrophages (33).

 

The subcellular location of Cu-ATPases changes dynamically in many tissues depending on the needs of the body or tissue for copper transport.  Under basal conditions, ATP7A and ATP7B are localized to the final compartment of the Golgi apparatus, the TGN (4;16;18;28).  At this location, ATP7A is predicted to transport copper from the cytosol into the lumen of the TGN to copper-dependent enzymes as they migrate through the secretory pathway.  However, under conditions of elevated extracellular copper, the ATP7A protein undergoes a rapid relocalization to the plasma membrane where it functions in the efflux of copper from cells (16;18).  In polarized cell types including intestinal cells, ATP7A localizes to vesicles associated with the basolateral membrane in response to copper exposure, consistent with its function in transferring copper across the intestinal barrier (17;18;34-36).  In melanocytes, some of the ATP7A protein present in these cells is localized to the melanosome. This subcellular localization of ATP7A is dependent on the BLOC1 complex, a protein complex involved in intracellular trafficking in melanocytes and other cell types (please see records for minnie and salt and pepper) (37).    

Background

Copper is an essential micronutrient for all organisms because it functions as a cofactor for enzymes that catalyze redox reactions used in fundamental metabolic processes.  It is required for numerous cellular processes, including mitochondrial respiration, antioxidant defense, neurotransmitter synthesis, connective tissue formation, pigmentation, peptide amidation, macrophage responses to dermal wounds (33), PDGF-induced vascular smooth muscle cell migration during neointimal formation (38), and iron metabolism [reviewed in (6)].  However, because of its redox properties copper can generate damaging free radicals and all organisms are faced with the challenge of acquiring sufficient copper for cellular requirements, while avoiding accumulation to levels that could lead to cellular toxicity.  Copper homeostatic mechanisms involve an intricate balance between uptake, distribution and utilization, storage and detoxification, and efflux pathways (4;18).

 

Mutations in both ATP7A and ATP7B in humans result in diseases associated with alterations in copper homeostasis (4;6;18).  Mutations in ATP7A are associated with copper deficiency in diseases including Menkes disease (MD; OMIM #309400) and the milder occipital horn syndrome (OHS; OMIM #304150), while mutations in ATP7B result in Wilson disease (WD; OMIM #277900), characterized by copper excess.  Menkes disease is an X-linked syndrome typically fatal in early childhood, and observed almost exclusively in males.  Female carriers generally do not manifest symptoms.  Two forms of MD have been described: classic MD, and the less severe mild MD.  The clinical features of classic MD typically include neurological defects (severe mental retardation, neurodegeneration, seizures), growth retardation, hypothermia, connective tissue defects (hyperelastic skin, lax joints, vascular defects), hypopigmentation, and kinky hair (6;39-41).  Male patients show symptoms at 2-3 months of age with death usually occurring by 3 years.  Patients with mild MD have a longer lifespan and less profound neurological defects mainly characterized by moderate developmental delay and cerebellar ataxia (6;39;40;42;43).  OHS, also known as Ehlers-Danlos type IX or X-linked cutis laxa, is also caused by ATP7A mutations and has milder overlapping symptoms with MD.  Neurological symptoms are far less severe or even absent, and include very mild mental retardation and autonomic dysfunction (6;40;42).  Patients with OHS are characterized by connective tissue abnormalities including calcification at the attachments of muscles to the occipital bone to make occipital “horns” (40)

 

MD can be treated by administration of copper-histidine at an early age.  Copper-histidine is normally found in serum, and is probably the form in which copper crosses the blood-brain barrier (44).  However, treatment efficacy is highly variable, and is strongly dependent on the severity of the disease and the age at which treatment is started.  Since most patients do not show symptoms until 2-3 months after birth, copper treatment is generally given at an advanced stage of disease unless diagnostic tests are given at birth.  Copper is necessary during early stages of postnatal development, and may be able to more easily cross the blood-brain barrier earlier in development.  If treatment is not given early, many MD defects cannot be corrected (40).  Over 200 MD-causing mutations in humans have been identified and include small deletions/insertions, nonsense mutations, missense mutations, and splice site mutations.  Very few missense mutations occur in the N-terminal region, suggesting that the N-terminal metal-binding sites may be functionally redundant (43).  Splice site mutations that produce variable levels of functional and partially functional protein, are common in patients with OHS (42;43;45).  

 

ATP7A and ATP7B have a dual role in cells, to provide copper to essential cuproenzymes and to mediate the excretion of excess intracellular copper.  The clinical features of MD are a direct consequence of dysfunction of several copper-dependent enzymes that fail to be loaded with copper, as well as the expression pattern of ATP7A during development and in the adult (see Expression/Localization).  Among these copper-dependent proteins is the ferroxidase ceruloplasmin, which functions in iron and copper transport throughout the body (4;6).  Other ubiquitously expressed copper-dependent enzymes include cytochrome c oxidase, necessary for mitochondrial respiration, and superoxide dismutase, which contributes to antioxidant defense and modulates levels of extracellular superoxide ions in the vasculature (4;30).  Tissue-specific enzymes include dopamine β-hydroxylase (necessary for catecholamine production in the adrenals), lysl oxidase (important for connective tissue formation), peptidylglycine α-amidating mono-oxygenase (important in peptide amidation in the pituitary), and tyrosinase [critical for pigment formation in skin, hair and eyes (mutated in ghost)] [reviewed in (4;6;18)].  The expression pattern of ATP7A is consistent with the key role for ATP7A in the delivery of dietary copper from the intestine to the body, and then the brain (4).

 

Mouse models of MD and OHS are collectively known as mottled mice, after the variegated pigmentation pattern present in heterozygous females.  Mottled mice have mutations in Atp7a or defects in ATP7A protein expression, and display a wide range of phenotypes, from prenatal death of males to viable males with OHS-like symptoms [reviewed in (39)].  Blotchy (Atp7ablo) mutant mice are considered to be models for OHS, and males are viable with connective tissue defectsBrindled (Atp7abr) hemizygous male mice have phenotypes that most closely resemble classic MD in humans, exhibiting decreased coat pigmentation, tremor, general inactivity, increased intestinal copper levels and decreased copper levels in the liver and brain, decreased copper enzyme activities, and death by 14 days of age.  Healthy viability can be restored in these mutants if a single copper injection is provided during the first week of life, while later treatment is ineffective.  This is similar to the effect of copper-histidine treatment in human MD patients (40).  Transgenic overexpression of human ATP7A in brindled mice partially restores the copper balance in these animals, and rescues the phenotype (46).  A complete lack of ATP7A expression in male mice invariably results in prenatal lethality, while human males with complete ATP7A deficiency generally survive birth.  This suggests that placental copper transport is more critical during mouse fetal development relative to human fetal development (2;39).

Putative Mechanism

The Tigrou-like mutation results in an alanine to valine change at amino acid 998 of ATP7A.  As both residues are hydrophobic, this change is not predicted to affect the formation of the sixth transmembrane domain.  However, in contrast to other TM domains where conservative amino acid changes occur, this region is highly conserved between mouse and human proteins.  A number of human ATP7A missense mutations have been identified in the highly conserved sixth TD domain that cause a range of phenotypes from mild MD to classic MD (43;47).  Included in this group of mutations is the amino acid change that occurs in Tigrou-like mutant mice.  In humans, the corresponding amino acid change is A1007V.  When transfected in fibroblasts, the human ATP7A A1007V protein is expressed and localizes normally to the TGN, suggesting that the protein encoded by Atp7aTigrou-like may also be properly localized (40).  In humans, the A1007V mutation causes a mild form of MD resulting in surviving adult males with milder neurological defects (39;43).  The milder phenotype in humans compared to Tigrou-like mice may be explained by the fact that in general, mouse Atp7a mutant phenotypes tend to be more severe than human phenotypes caused by similar mutations.  For instance, mutations that cause a complete absence of ATP7A protein result in neonatal lethality in humans rather than embryonic lethality that occurs in mice (2;24;39)

 

The sixth TM domain of ATP7A is involved in cation transport and contains the CPC sequence known to bind copper during transport through the channel.  It is possible even slight changes to amino acids adjacent to this motif will seriously impair copper transport by ATP7A. Two other Atp7a mouse mutants with missense mutations in the transmembrane domains have been described.  The Atp7amo11H allele contains a mutation in the seventh transmembrane domain, and mutants expressing this allele display a small reduction in Atp7a mRNA levels, but presumably lose ATP7A function due to the substitution of a charged amino acid for a hydrophobic amino acid (A1364D), causing problems with membrane insertion.  Males with this mutation die in utero similar to Tigrou-like males (48).  The Macular mouse (Atp7aMa) has a missense mutation in the eighth transmembrane domain (S1382P) resulting in a milder phenotype reminiscent of mild MD (49;50).

 

The striped pattern in heterozygous females caused by the Tigrou-like mutation is a result of random X-inactivation early during embryonic development and use of wild-type or mutant ATP7A in various cells and their clonal populations (51).  As functional ATP7A is critical for tyrosinase activity, loss of tyrosinase activity in melanocytes will result in pigmentation defects (please see the record for ghost). 

Primers Primers cannot be located by automatic search.
Genotyping
Tigrou-like genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
Tigl(F): 5’- GTCCAATCAATGACTTCAGCATCAGAGA -3’
Tigl(R): 5’- GCTATGTACTTTGTATCCTCCATGCACC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Tigl_seq(F): 5’- TGACTTCAGCATCAGAGAATCAG -3’
Tigl_seq(R): 5’- GCAACTTTTCCCAGGCAAGTG -3’
 
The following sequence of 1068 nucleotides (from Genbank genomic region NC_000086 for linear DNA sequence of Atp7a) is amplified:
 
77448                                                    gtc caatcaatga
77461 cttcagcatc agagaatcag aatgtgttca ggaacaaact tattgaaaat aatgtcttat
77521 gttattcttg aaagttgcta aaagttcttc tagatatgga gaaattatgg aattctgtgt
77581 tctttatttt tcttcatagt tagtaactcc aaaatcataa ataggactta ttagccaatt
77641 ctgctcccaa ttttttatgt ttataagtga aaaaatgttt atcattagta actaaagtgt
77701 atgtaagtag ccaggtaggc tacgtgactt caacacaggt tttatttaaa cagggttgac
77761 cagtgttgct tttgttctga acaactctac ctgtaaatga ataaccgaag tccatgtctt
77821 tcttctaaag ggctataata gaagcatctc ccgaacagaa accataatac gctttgcttt
77881 ccaagcctct atcacggttc tgtgtatcgc atgtccctgt tcactgggac tagccactcc
77941 aactgctgtg atggtgggca caggagtagg tgctcagaat ggcatactta tcaaaggtgg
78001 ggagccactg gaaatggctc ataaggtaag agtcctcagg actaaaaatt gcactatcaa
78061 acatgcagtc acaccctatt gagaaatggg gttcgtagtt ttttttggct gtggttctta
78121 ggctgagtct gttctggggc taccctgagg attgaggtag gaaagctgta atgttgggtc
78181 ttcttcagat ttgccttgat tacttaagca ctccgagtag tccctgaatg gagagccact
78241 gtagttccaa gccatctctg attacccaca tctccagcac ttgcctggga aaagttgcca
78301 gggcctcccg tgcttctgac atgtttgtgt ctgactccac attgtgggag ttgcacctgc
78361 catggcagtg cctttgctgc caccagctgg cagtttgcac tgtgacttca gcctcaatta
78421 aggctacttc aattaaagct gtgctcccaa taatacaatc tcattataag gatttaaaat
78481 atatacaggt gcatggagga tacaaagtac atagc
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is shown in red text.
References
Science Writers Nora G. Smart, Anne Murray
Illustrators Diantha La Vine
AuthorsXin Du, Xiao-hong Li, Bruce Beutler
List |< first << previous [record 518 of 584] next >> last >|
Edit History
2011-08-31 7:43 PM (current)
2011-08-31 7:23 PM
2011-08-29 10:29 AM
2011-08-03 3:30 PM
2011-01-07 9:54 AM
2010-09-09 3:00 PM
2010-09-09 3:00 PM
2010-05-10 2:47 PM
2010-02-25 2:43 PM