Phenotypic Mutation 'Rough-fur'

• Allele: Rough-fur
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 99,279,644 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Krt10
• Gene Name: keratin 10
• Synonym(s): K10, cytokeratin 10, keratin 10, K1C1, Krt-1.10, suprabasal cytokeratin 10, D130054E02Rik, Krt1-10
• Chromosomal Location: 99,276,080-99,280,190 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mutations may result in hyperkeratosis and blistering of the skin. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamic Acid changed to Valine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000099420; Gene: ENSMUSG00000019761; AA Change: E172V

Domain	Start	End	E-Value	Type
low complexity region	2	133	N/A	INTRINSIC
Filament	134	448	6e-166	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
  (Using ENSMUST00000103131)
• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Possibly nonessential (E-score: 0.304)
• Phenotypic Category: Autosomal Dominant
• Penetrance: 100%
• Mode of Inheritance: Autosomal Dominant
• Local Stock: Embryos
• MMRRC Submission: 031074-MU
• Last Updated: 2016-05-13 3:09 PM by Stephen Lyon
• Record Created: unknown
• Record Posted: 2009-03-04
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Xin Du, Xiao-hong Li, Bruce Beutler

Accession Number

NCBI RefSeq: NM­_010660; MGI: 96685

Alleles Listed at MGI

All alleles(16) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(12) Chemically induced(1)

Phenotypic Description

The Rough-fur mutation was identified in G3 mice derived from N-ethyl-N-nitrosourea (ENU)-mutagenized C57BL/6J stock. The fur of this mutant is "rough" but of normal length and color (Figure 1).  There is no greasy or polished appearance as seen in mice carrying mutations in the Krt33a gene (see Polished, Polished2 and Spikey).  It is also visibly distinct from mutations in the Krt25 gene (see Plush and Sinuous) and Egfr (see Velvet).

Nature of Mutation

The Rough-fur mutation corresponds to an A to T transversion at position 547 of the Krt10 transcript, in exon 1 of 8 total exons.

 

531 ATCAAGGAGTGGTACGAGAAGCATGGCAACTCA

167 -I--K--E--W--Y--E--K--H--G--N--S-

 

The mutated nucleotide is indicated in red lettering, and causes a glutamic acid to valine change at residue 172 of the Keratin 10 (K10) protein.

Protein Prediction

The mouse K10 protein has 561 residues, and is 92% identical to the 554 amino acid human protein.  K10 is an epithelial keratin that belongs to the type I (acidic) keratin family (1). 

 

Figure 2. Keratin domain structure showing the α-helical domain, linker regions and head/tail domains. The red asterisk shows the location of the residue altered by the Rough-fur mutation (A). Assembly of keratin molecules into intermediate filaments (B).

Keratins are intermediate filament (IF) proteins that are primarily involved in the mechanical and structural functions of epithelial tissue.  Keratin proteins are composed of an α-helical rod domain divided into four subdomains: 1A (residues 136-170 for mouse K10), 1B (residues 185-285 for mouse K10), 2A (residues 302-320 for mouse K10), and 2B (residues 329-450 for mouse K10).  These domains are interrupted by non-helical linkers and flanked by non-helical head and tail domains (2).  The N- and C-termini of the α-helical rod domain are highly conserved and known as the helix initiation motif (HIM) and the helix termination motif (HTM), respectively.  The HTM motif of most keratins contains the consensus sequence of EIATYRXLLEGEE (3).  The α-helical rod domains, particularly the HIM and HTM motifs, are necessary for interactions with other keratin molecules in order to assemble into IFs (4).  The head and tail domains are sometimes classified into subdomains known as the high homology or H subdomains, regions with sequence variation or V subdomains, and highly charged ends or E subdomains (5) (Figure 2A).  In comparison to many other keratins, the E and V subdomains of K10 and its partner K1, are unusually glycine-rich and form loops (1;6) (see further discussion of quaternary structural relationships between keratin subunits in Background, below).  In mouse, bovine and humans, polymorphic variations of K10 exist in the V2 subdomain and result in variations in the sizes of the glycine loops (5).  

 

In order to form intermediate filaments, the α-helical chains of two keratin molecules dimerize to form a coiled-coil structure. Keratin dimers then associate via their HIM and HTM motifs in a head-to-tail fashion to form linear arrays, four of which associate in an antiparallel, half-staggered manner to produce protofibrils.  Three to four protofibrils intertwine to produce an apolar intermediate filament 10 nm in diameter (Figure 2B).  The assembly equilibrium is heavily in favor of polymer formation (7).  Keratins contain a high proportion of the small amino acids glycine and alanine, which facilitates the assembly of individual keratin molecules into IFs and allows sterically unhindered hydrogen bonding between the amino and carboxyl groups of peptide bonds on adjacent protein chains, facilitating their close alignment and strong cohesion (4;8).

 

The Rough-fur mutation results in the substitution of a glutamic acid for a valine at amino acid 172 of Keratin 10.  This residue is located in the first linker (L1) domain.

Expression/Localization

Along with the type II keratin K1, K10 is expressed in terminally differentiating suprabasal cells of the epidermis and other cornifying epithelia and is the main type I keratin gene expressed in these tissues (9-12).  In the sweat gland, K10 is expressed throughout the duct region, but not in the deeper secretory portion of the gland (13).  K10 is also expressed in the infundibulum of the hair follicle (14), and is detected in suprabasal areas of the eponychium and hyponichium of the nail (15).  Some K10 expression is seen in the apical matrix of the nail.

 

Mice, unlike humans, have stratified squamous epithelia present in the esophagus and forestomach.  Like the epidermis, this tissue also expresses K1/K10 cytokeratins (16). 

 

K10 is a component of cytoplasmic keratin intermediate filaments, which extend from the periphery of the nucleus to the plasma membrane where they attach to desmosomes and hemidesmosomes (7).

Background

Keratins are cytoplasmic proteins that form the intermediate filaments (IFs) of epithelia including cells of the skin, lung, esophagus, gut and hair.  IFs are intermediate in diameter between actin (microfilaments) and microtubules.  Keratins are expressed in a cell type and differentiation specific manner, and are subdivided into the type I (acidic) and type II (basic) keratins.  The genes of the type I and type II keratin subfamilies are clustered in the genomes of mice and humans with the type I keratins localized to mouse Chromosome 11 and Chromosome 17q21.2 in humans, and the type II keratins localized to mouse Chromosome 15 and Chromosome 12q13.13 in humans.  In humans, there are 54 keratin proteins, 28 type I and 26 type II (17).  Keratins form obligate heterodimers between one type I and one type II keratin (4).  Although all type I keratins can pair with all type II keratins in vitro, in vivo this pairing is much more selective, even when multiple keratins are expressed in the same tissue.   

 

The skin serves an important function as a barrier to the environment, and maintains its integrity by continuously renewing the epidermis, while also maintaining associated structures such as hair (18).  The epidermis is a stratified epithelium, composed of an inner layer of dividing cells and outer layers of terminally differentiating cells.  All of these layers display extensive keratin filament networks.  The dividing cells produce 20 to 25% of their protein as K5 (type II) and K14 (type I); the differentiating cells shut off expression of these keratins and switch to expressing K1 and K10 (and later the type II keratin K2), which ultimately will constitute up to 85% of the protein of the fully differentiated cell that is sloughed from the skin surface (7).  The type II keratin K6 and the type I keratins K16 and K17 are characteristic of epithelial cells induced to hyperproliferate by disease or injury.  These keratins are also expressed in the epithelium of several epidermal appendages such as the hair follicle and nail as well as oral epithelium.  Portions of the epidermis typically undergoing heavy stress, such as the palms and soles of the feet, express multiple type I keratins including K9, K10 and K16 (19).

 

Figure 3. Structure of the hair follicle and the location and anatomy of the epidermis.

Hair is produced and maintained by the pilosebaceous unit consisting of a hair-producing follicle and a sebaceous gland composed of many different cell types (Figure 3).  The hair follicle can be divided into 3 regions: the lower segment (bulb and suprabulb), the middle segment (isthmus), and the upper segment (infundibulum).  Eight epithelial layers are present in the hair follicle including the outer root sheath (ORS) that is continuous with the epidermis, the companion layer (CL), the inner root sheath (IRS) consisting of three layers (Henle’s, Huxley’s and cuticle) and the hair shaft, which also consists of three layers (cuticle, cortex and medulla) (20).  Numerous keratins are expressed in the hair follicle and hair shaft itself. For a review of these expression patterns please see the records for Plush and Polished (17).  A number of signaling pathways are implicated in skin and hair follicle morphogenesis and regeneration including Sonic hedgehog (Shh), Wnts, and TGF-β family members [reviewed in (18)] (please see the record for prune). 

 

The primary function of keratins is to form a resilient yet adaptable scaffold allowing epithelial cells to sustain mechanical stresses.  However, increasing evidence suggests they may be involved in nonmechanical roles such as apoptosis and protein targeting.  In order to achieve both mechanical and nonmechanical functions, keratins associate with keratin-associated proteins (KAPs) that result in keratin phosphorylation, glycosylation, transglutamination, proteolytic cleavage, ubiquitination, or association with other cytoplasmic or cytoskeletal elements.  KAPs have many functions and include the linker proteins plectin, plakophilin 1 and  desmoplakin that connect keratin IFs to cytoskeletal elements, the bundling proteins filaggrin and tichohyalin, adaptor/signaling molecules including 14-3-3 proteins and TNF (tumor necrosis factor) receptor type 2, as well as various chaperones, kinases, and other enzymes (21). 

 

Mutations in the genes encoding keratins or the many keratin-associated proteins result in a spectrum of keratinizing skin and tissue disorders, which depends upon the specific expression pattern of the keratin protein and results in abnormal fragility of the affected tissue (7;19;22).  In response to cell cytolysis, tissue hyperproliferation occurs in a process known as hyperkeratosis.  The majority of keratinizing disorders affects the epidermis and associated appendages, but can also affect mucosal or corneal epithelia depending on the keratin involved.  Mutations in the KRT10 and KRT1 genes typically cause epidermolytic hyperkeratosis (EHK; OMIM #113800), also known as bullous erthroderma icthyosiformis congenita of Brocq (23-27).  This disorder is characterized by redness (erythroderma), blistering (bullous) and hypertrophy (ichthyosis-like) of the skin.  Blistering lesions are seen at birth or soon after and are due to cytolysis of the suprabasal keratinocytes.  Lesions can be fatal in infants because of secondary infection.  Blistering subsides with age but patients develop progressively thickened hyperkeratotic skin due to basal cell hyperproliferation.  Mutant K10 protein in patients interferes with proper filament network formation, leading to intermediate filament clumping and cell degeneration (28).  Related skin disorders caused by KRT10 and KRT1 mutations include epidermolytic epidermal nevus (OMIM #600648) and annular epidermolytic ichthyosis (OMIM #607602) (29-31).  A mutation in KRT1 has been found to cause Curth-Macklin type ichthyosis hystrix (IHCM; OMIM #146590) in which localized thickening or keratoderma can give the appearance of ridges or spikes on the skin surface.  This disorder is caused by cell fragility, and it is likely that some KRT10 mutations will cause an equivalent disease phenotype.  Mutations in KRT1 also cause a number of palmoplantar skin disorders, but it is likely that in these regions, K1 is associating with K9 or K16 as mutations in the genes encoding these keratins also cause epidermolytic palmoplantar keratoderma (EPPK; OMIM #144200) (19).  However, a variant form of EPPK has been linked to a rare KRT10 polymorphism that causes changes in the glycine loops (32)

 

In mice, transgenic expression of a mutant K10 protein mimicked EHK showing the typical subrabasal cytolysis, abnormal keratin filament formation and hyperkeratosis due to proliferation of basal cells (33).  A targeted deletion of the Krt10 gene expressing a truncated K10 protein, resulted in similar phenotypes.  Homozygous animals developed severe skin fragility and died shortly after birth, while heterozygous animals developed hyperkeratosis on exposed skin surfaces (34).  By contrast, complete absence of K10 in mice resulted in a very mild phenotype (35).  These animals displayed an intact epidermis without signs of increased fragility or cytolysis, which may be explained by the persistence of the basal keratins K5, K14 and K15 suprabasally.  Ultrastructurally, keratin aggregates were found and shown to consist of residual K1, which formed atypical heterodimers with K14.  However, loss of K10 leads to increased proliferation of basal cells (36), and increases the differentiation of epidermal stem cells towards the sebocyte lineage (37).  Interestingly, K10 null mice exhibit decreased tumor formation in a tumor induction assay (38), although mice expressing transgenic expression of K10 in the basal epidermis showed a delay in tumor onset (39).

Putative Mechanism

Figure 3. Keratin domain structure showing the location of known keratin mutations (arrows). The larger the arrow, the greater the number of mutations in the region. Keratin mutations found in the Beutler lab are indicated by the red asterisks.

A large number of dominantly transmitted autosomal diseases of the skin, hair, and various internal epithelia have been found to be caused by mutations in keratin genes (22).  The resulting autosomal dominant pathologies are primarily due to the inability of the mutated keratin protein to form stable IFs with its intact endogenous partner.  This leads to an accumulation of disorganized IF bundles that eventually result in failure of tissue integrity, in particular on exposure to mechanical stress.  In the majority of cases, the mutations result in inappropriate amino acid substitutions at the beginning of subdomain 1A or at the end of subdomain 2B of the α-helical rod of either type I or type II keratins (17), which have been recognized as zones of overlap during keratin alignment and assembly into intermediate filaments (Figure 3).  Amino acid changes in these regions are also often associated with more severe disorders, while mutations that result in changes in other regions result in milder disease due to milder disruptions of the filament network (40).

 

Although the vast majority of keratin disorders are dominant, autosomal recessive versions of EHK have been reported (41;42).  A complete absence of K10 protein is noted in all of these patients, but disease presentations vary from mild to severe.  In patients with severe disease, the disorder resembles severe autosomal dominant EHK.  However, the keratin aggregates present in the keratinocytes of these patients differ in form and distribution presumably due to the lack of K10.  Induction of K6, K16 and K17 in the suprabasal epidermis occurs, and probably contributes to the formation of the abnormal keratin aggregates (41).  The severe phenotype of some of these patients contrasts to the mild phenotype exhibited by K10 null mice (35), which may be explained by additional stability against mechanical stress provided by pelage hair.  Additionally, K10 null mice do not induce expression of K6 and K16 in their epidermis.  Thus, these keratins do not contribute to the formation of abnormal keratin aggregates.  As in K10 null mice, persistence of K14 expression in suprabasal layers is seen in the K10 deficient humans with severe disease, but basal keratins are not able to compensate for the loss of K10 (41).  The mechanisms underlying the phenotypic differences in K10 null humans are unknown. 

 

The Rough-fur mutation alters a highly conserved amino acid in the first linker domain of the K10 protein.  Unlike the α-helical domain, the linker domains of keratin proteins are not typically important for heterodimerization of keratin molecules.  Disease-causing mutations in the L1 domain of keratins are very rare, and all of the disease-associated variations in the human K10 protein occur in the α-helical domains (please see the intermediate filament database at www.interfil.org).  However, the amino acid changed in the Rough-fur mutation is located at the beginning of the linker domain, and may change the structure of the adjacent α-helical domain and interfere with the coiled-coil formation of keratin dimers.

 

Hair abnormalities have not been noted in humans or mice expressing mutant K10 proteins.  However, skin and hair abnormalities are common in patients carrying mutations in genes encoding other epithelial keratins such as K6, K16 and K17 (pachyonichia congenita; OMIM #167200, #167210) or mutations in the genes encoding the hair keratins, which cause monilethrix (OMIM #158000) or ectodermal dysplasia of hair and nail type (OMIM #602032) (17;22).  As the phenotype in Rough-fur mice is mild (rough fur, no skin defects), it is possible alterations in K10 in humans may also cause similar phenotypes that have gone unnoticed.  Most alterations in hair morphology occurring due to keratin abnormalities occur in keratins that are expressed in the deep part of the hair follicle that plays an important role during hair morphogenesis or in the hair shaft itself.  K10 is expressed only in the upper part of the hair follicle.  However, it remains possible that aberrations in this portion of the hair follicle may cause the hair abnormalities observed in Rough-fur mice.

Primers

Primers cannot be located by automatic search.

Genotyping

Rough-fur genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  

 

Primers for PCR amplification

Rfur(F): 5’- CAGCACACTTGCTACTTACTGCAATTC -3’

Rfur(R): 5’- GCAGCCGACCCTTTCCTTTATAGTATG -3’

 

PCR program (use SIGMA JumpStart REDTaq)

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Rfur_seq(F): 5’- TGGCCTCCTACATGGACAAAG -3’

Rfur_seq(R): 5’- GTAGTCTGTCATCCTGGACGAC -3’

 

The following sequence of 1489 nucleotides (from Genbank genomic region NC_000077 for linear DNA sequence of Krt10 plus 419 additional nucleotides taken from NCBI m37 mouse assembly Chromosome 11: 99246568:99251097) is amplified:

 

-419  cagcacact tgctacttac tgcaattcgc aaagctatct aaaacaggaa tttgaaaaat 

-360 ccttatttca actacaattt ataagcaaag ttcttttact ttttgaacct agcaagtact

-300 aagtacaagc taaattaaca ttagaaaatt agatttttaa tagttactca atgatcttca

-240 aaaggtaaaa tgtactcatg tgaactccac ccattctcag tttcaacata gcaaatttcc

-180 catctgtact cagggcaaat tcaaaagcat tgaaaaggta ttggttatta ctgaagataa

-120 tttatgcaat cataagccaa agatgctatg ctggcaaaaa gaaaaccatg caagtaagca

 -60 aagcctagca cctgtgagac acgccctctc agtatataaa ggctcggcac tgtccttggt

   1 agcaggcact ccctgggcta cactacacca ccatgtctgt tctatacagc tccagcagca
  61 agcagttctc ttcctcccgc agtggaggag gaggcggtgg tggatccgtc agggtttcca
 121 gcaccagggg ctctcttggt ggagggtata gctcaggagg cttcagcggt ggctctttta
 181 gccgtgggag ctctggggga ggttgctttg ggggctcatc aggtggttac ggaggttttg
 241 gaggaggagg cagctttggg ggaggctatg gaggaagcag ctttggggga ggctatggag
 301 gtagcagttt tgggggtggc agcttcggtg gaggtggcag cttcggtgga ggcagctttg
 361 gtggcggtag ctatggagga ggctttggcg gtggtggatt cggaggagat ggtggcagcc
 421 ttctctccgg aaacgagaag gtgaccatgc agaacctgaa cgaccgcctg gcctcctaca
 481 tggacaaagt ccgggctctg gaagagtcaa actacgagct ggagggtaaa atcaaggagt
 541 ggtacgagaa gcatggcaac tcaagccagc gagagccccg ggactacagc aaatactaca
 601 aaaccatcga ggaccttaag gggcaggtaa ggcgcttcag actccggctt tccatcgttc
 661 ctaggcatgc aatgcagagg aagctatgcc aagtgtggca cagctgactg ctgtctcttc
 721 cctgttacct tttcatgtct agtgtaacca ggcctcatca aagatattta tggcaatgtg
 781 tcatctagca tgtgtgttgc ctgtcgtcca ggatgacaga ctactgagaa ccttataggt
 841 tttaacacac atatgcgagt tcacagttaa aataggctag gtcatacata agtgtgggag
 901 ctaagataat tttaaatgag tatgttacat atatgcatat atatgtatag atatgtataa
 961 attcacccct agaagtattt ataacaagtt aaacagatac aaacatgagt cactcaaaag
1021 ttagctgcaa cacaaacaaa tcacatacta taaaggaaag ggtcggctgc

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.

References

   1.  Zhou, X. M., Idler, W. W., Steven, A. C., Roop, D. R., and Steinert, P. M. (1988) The Complete Sequence of the Human Intermediate Filament Chain Keratin 10. Subdomainal Divisions and Model for Folding of End Domain Sequences. J. Biol. Chem. 263, 15584-15589.

   2.  Rogers, M. A., Winter, H., Langbein, L., Bleiler, R., and Schweizer, J. (2004) The human type I keratin gene family: characterization of new hair follicle specific members and evaluation of the chromosome 17q21.2 gene domain, Differentiation 72, 527-540.

   3.  Quinlan, R., Hutchison, C., and Lane, B. (1994) Intermediate filament proteins, Protein Profile. 1, 779-911.

   4.  Hatzfeld, M., and Franke, W. W. (1985) Pair Formation and Promiscuity of Cytokeratins: Formation in Vitro of Heterotypic Complexes and Intermediate-Sized Filaments by Homologous and Heterologous Recombinations of Purified Polypeptides. J. Cell Biol. 101, 1826-1841.

  5.   Korge, B. P., Gan, S. Q., McBride, O. W., Mischke, D., and Steinert, P. M. (1992) Extensive Size Polymorphism of the Human Keratin 10 Chain Resides in the C-Terminal V2 Subdomain due to Variable Numbers and Sizes of Glycine Loops. Proc. Natl. Acad. Sci. U. S. A. 89, 910-914.

  6.   Steinert, P. M., Mack, J. W., Korge, B. P., Gan, S. Q., Haynes, S. R., and Steven, A. C. (1991) Glycine Loops in Proteins: Their Occurrence in Certain Intermediate Filament Chains, Loricrins and Single-Stranded RNA Binding Proteins. Int. J. Biol. Macromol. 13, 130-139.

  7.   Fuchs, E.,  and Cleveland, D. W. (1998) A Structural Scaffolding of Intermediate Filaments in Health and Disease, Science 279, 514-519.

  8.   Norlen, L., Masich, S., Goldie, K. N., and Hoenger, A. (2007) Structural analysis of vimentin and keratin intermediate filaments by cryo-electron tomography, Exp. Cell Res. 313, 2217-2227.

  9.   Moll, R., Franke, W. W., Schiller, D. L., Geiger, B., and Krepler, R. (1982) The Catalog of Human Cytokeratins: Patterns of Expression in Normal Epithelia, Tumors and Cultured Cells. Cell. 31, 11-24.

10.  Schweizer, J., Kinjo, M., Furstenberger, G., and Winter, H. (1984) Sequential Expression of mRNA-Encoded Keratin Sets in Neonatal Mouse Epidermis: Basal Cells with Properties of Terminally Differentiating Cells. Cell. 37, 159-170.

11.  Dale, B. A., Holbrook, K. A., Kimball, J. R., Hoff, M., and Sun, T. T. (1985) Expression of Epidermal Keratins and Filaggrin during Human Fetal Skin Development. J. Cell Biol. 101, 1257-1269.

12.  Lourenco, S. V., Kamibeppu, L., Fernandes, J. D., Sotto, M. N., and Nico, M. M. (2008) Relationship of Adhesion Molecules Expression with Epithelial Differentiation Markers during Fetal Skin Development. J. Cutan. Pathol. 35, 731-737.

13.  Langbein, L., Rogers, M. A., Praetzel, S., Cribier, B., Peltre, B., Gassler, N., and Schweizer, J. (2005) Characterization of a Novel Human Type II Epithelial Keratin K1b, Specifically Expressed in Eccrine Sweat Glands. J. Invest. Dermatol. 125, 428-444.

14.  Schirren, C. G., Burgdorf, W. H., Sander, C. A., and Plewig, G. (1997) Fetal and Adult Hair Follicle. an Immunohistochemical Study of Anticytokeratin Antibodies in Formalin-Fixed and Paraffin-Embedded Tissue. Am. J. Dermatopathol. 19, 335-340.

15.  Perrin, C., Langbein, L., and Schweizer, J. (2004) Expression of Hair Keratins in the Adult Nail Unit: An Immunohistochemical Analysis of the Onychogenesis in the Proximal Nail Fold, Matrix and Nail Bed. Br. J. Dermatol. 151, 362-371.

16.  Schweizer, J., Rentrop, M., Nischt, R., Kinjo, M., and Winter, H. (1988) The Intermediate Filament System of the Keratinizing Mouse Forestomach Epithelium: Coexpression of Keratins of Internal Squamous Epithelia and of Epidermal Keratins in Differentiating Cells. Cell Tissue Res. 253, 221-229.

17.  Schweizer, J., Langbein, L., Rogers, M. A., and Winter, H. (2007) Hair follicle-specific keratins and their diseases, Exp. Cell Res. 313, 2010-2020.

18.  Fuchs, E. (2007) Scratching the surface of skin development, Nature 445, 834-842.

19.  Lane, E. B., and McLean, W. H. (2004) Keratins and Skin Disorders. J. Pathol. 204, 355-366.

20.  Ito, M., Tazawa, T., Shimizu, N., Ito, K., Katsuumi, K., Sato, Y., and Hashimoto, K. (1986) Cell Differentiation in Human Anagen Hair and Hair Follicles Studied with Anti-Hair Keratin Monoclonal Antibodies. J. Invest. Dermatol. 86, 563-569.

21.  Coulombe, P. A., and Omary, M. B. (2002) 'Hard' and 'Soft' Principles Defining the Structure, Function and Regulation of Keratin Intermediate Filaments. Curr. Opin. Cell Biol. 14, 110-122.

22.  McLean, W. H., and Irvine, A. D. (2007) Disorders of Keratinisation: From Rare to Common Genetic Diseases of Skin and Other Epithelial Tissues. Ulster Med. J. 76, 72-82.

23.  Rothnagel, J. A., Dominey, A. M., Dempsey, L. D., Longley, M. A., Greenhalgh, D. A., Gagne, T. A., Huber, M., Frenk, E., Hohl, D., and Roop, D. R. (1992) Mutations in the Rod Domains of Keratins 1 and 10 in Epidermolytic Hyperkeratosis. Science. 257, 1128-1130.

24.  Cheng, J., Syder, A. J., Yu, Q. C., Letai, A., Paller, A. S., and Fuchs, E. (1992) The Genetic Basis of Epidermolytic Hyperkeratosis: A Disorder of Differentiation-Specific Epidermal Keratin Genes. Cell. 70, 811-819.

25.  Chipev, C. C., Yang, J. M., DiGiovanna, J. J., Steinert, P. M., Marekov, L., Compton, J. G., and Bale, S. J. (1994) Preferential Sites in Keratin 10 that are Mutated in Epidermolytic Hyperkeratosis. Am. J. Hum. Genet. 54, 179-190.

26.  Yang, J. M., Chipev, C. C., DiGiovanna, J. J., Bale, S. J., Marekov, L. N., Steinert, P. M., and Compton, J. G. (1994) Mutations in the H1 and 1A Domains in the Keratin 1 Gene in Epidermolytic Hyperkeratosis. J. Invest. Dermatol. 102, 17-23.

27.  Chipev, C. C., Korge, B. P., Markova, N., Bale, S. J., DiGiovanna, J. J., Compton, J. G., and Steinert, P. M. (1992) A Leucine----Proline Mutation in the H1 Subdomain of Keratin 1 Causes Epidermolytic Hyperkeratosis. Cell. 70, 821-828.

28.  Anton-Lamprecht, I. (1994) Ultrastructural Identification of Basic Abnormalities as Clues to Genetic Disorders of the Epidermis. J. Invest. Dermatol. 103, 6S-12S.

29.  Paller, A. S., Syder, A. J., Chan, Y. M., Yu, Q. C., Hutton, E., Tadini, G., and Fuchs, E. (1994) Genetic and Clinical Mosaicism in a Type of Epidermal Nevus. N. Engl. J. Med. 331, 1408-1415.

30.  Joh, G. Y., Traupe, H., Metze, D., Nashan, D., Huber, M., Hohl, D., Longley, M. A., Rothnagel, J. A., and Roop, D. R. (1997) A Novel Dinucleotide Mutation in Keratin 10 in the Annular Epidermolytic Ichthyosis Variant of Bullous Congenital Ichthyosiform Erythroderma. J. Invest. Dermatol. 108, 357-361.

31.  Sybert, V. P., Francis, J. S., Corden, L. D., Smith, L. T., Weaver, M., Stephens, K., and McLean, W. H. (1999) Cyclic Ichthyosis with Epidermolytic Hyperkeratosis: A Phenotype Conferred by Mutations in the 2B Domain of Keratin K1. Am. J. Hum. Genet. 64, 732-738.

32.  Rogaev, E. I., Rogaeva, E. A., Ginter, E. K., Korovaitseva, G. I., Farrer, L. A., Shlensky, A. B., Pritkov, A. N., Mordovtsev, V. N., and St George-Hyslop, P. H. (1993) Identification of the Genetic Locus for Keratosis Palmaris Et Plantaris on Chromosome 17 Near the RARA and Keratin Type I Genes. Nat. Genet. 5, 158-162.

33.  Fuchs, E., Esteves, R. A., and Coulombe, P. A. (1992) Transgenic Mice Expressing a Mutant Keratin 10 Gene Reveal the Likely Genetic Basis for Epidermolytic Hyperkeratosis. Proc. Natl. Acad. Sci. U. S. A. 89, 6906-6910.

34.  Porter, R. M., Leitgeb, S., Melton, D. W., Swensson, O., Eady, R. A., and Magin, T. M. (1996) Gene Targeting at the Mouse Cytokeratin 10 Locus: Severe Skin Fragility and Changes of Cytokeratin Expression in the Epidermis. J. Cell Biol. 132, 925-936.

35.  Reichelt, J., Bussow, H., Grund, C., and Magin, T. M. (2001) Formation of a Normal Epidermis Supported by Increased Stability of Keratins 5 and 14 in Keratin 10 Null Mice. Mol. Biol. Cell. 12, 1557-1568.

36.  Reichelt, J., and Magin, T. M. (2002) Hyperproliferation, Induction of c-Myc and 14-3-3sigma, but no Cell Fragility in Keratin-10-Null Mice. J. Cell. Sci. 115, 2639-2650.

37.  Reichelt, J., Breiden, B., Sandhoff, K., and Magin, T. M. (2004) Loss of Keratin 10 is Accompanied by Increased Sebocyte Proliferation and Differentiation. Eur. J. Cell Biol. 83, 747-759.

38.  Reichelt, J., Furstenberger, G., and Magin, T. M. (2004) Loss of Keratin 10 Leads to Mitogen-Activated Protein Kinase (MAPK) Activation, Increased Keratinocyte Turnover, and Decreased Tumor Formation in Mice. J. Invest. Dermatol. 123, 973-981.

39.  Santos, M., Ballestin, C., Garcia-Martin, R., and Jorcano, J. L. (1997) Delays in Malignant Tumor Development in Transgenic Mice by Forced Epidermal Keratin 10 Expression in Mouse Skin Carcinomas. Mol. Carcinog. 20, 3-9.

40.  Syder, A. J., Yu, Q. C., Paller, A. S., Giudice, G., Pearson, R., and Fuchs, E. (1994) Genetic Mutations in the K1 and K10 Genes of Patients with Epidermolytic Hyperkeratosis. Correlation between Location and Disease Severity. J. Clin. Invest. 93, 1533-1542.

41.  Muller, F. B., Huber, M., Kinaciyan, T., Hausser, I., Schaffrath, C., Krieg, T., Hohl, D., Korge, B. P., and Arin, M. J. (2006) A Human Keratin 10 Knockout Causes Recessive Epidermolytic Hyperkeratosis. Hum. Mol. Genet. 15, 1133-1141.

42.  Tsubota, A., Akiyama, M., Kanitakis, J., Sakai, K., Nomura, T., Claudy, A., and Shimizu, H. (2008) Mild Recessive Bullous Congenital Ichthyosiform Erythroderma due to a Previously Unidentified Homozygous Keratin 10 Nonsense Mutation. J. Invest. Dermatol. 128, 1648-1652.