Phenotypic Mutation 'rufus'

• Allele: rufus
• Mutation Type: missense
• Chromosome: 7
• Coordinate: 87,141,914 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Tyr
• Gene Name: tyrosinase
• Synonym(s): skc35, Oca1
• Chromosomal Location: 87,073,979-87,142,637 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene catalyzes the first 2 steps, and at least 1 subsequent step, in the conversion of tyrosine to melanin. The enzyme has both tyrosine hydroxylase and dopa oxidase catalytic activities, and requires copper for function. Mutations in this gene result in oculocutaneous albinism, and nonpathologic polymorphisms result in skin pigmentation variation. The human genome contains a pseudogene similar to the 3' half of this gene. [provided by RefSeq, Oct 2008] ; PHENOTYPE: Numerous mutations at this locus result in albinism or hypopigmentation. Albinism is associated with reduced number of optic nerve fibers and mutants can have impaired vision. Some alleles are lethal. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Phenylalanine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000004770] [ENSMUSP00000146757]
• AlphaFold: P11344
• SMART Domains: Protein: ENSMUSP00000004770; Gene: ENSMUSG00000004651; AA Change: L215F

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	91	112	N/A	INTRINSIC
Pfam:Tyrosinase	170	403	4.8e-45	PFAM
transmembrane domain	474	496	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000004770)
• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000207834)
• Meta Mutation Damage Score: 0.9481
• Is this an essential gene?: Probably nonessential (E-score: 0.148)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• MMRRC Submission: 038255-MU
• Last Updated: 2019-09-04 9:47 PM by Anne Murray
• Record Created: 2014-12-03 6:59 AM by Chad Daniel
• Record Posted: 2015-01-13
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Chad Daniel, Jamie Russell

Accession Number

NCBI RefSeq: NM_011661; MGI:98880

Alleles Listed at MGI

All mutations/alleles(126) : Chemically and radiation induced(4) Chemically induced (ENU)(8) Chemically induced (other)(5) Endonuclease-mediated(3) Radiation induced(74) Spontaneous(29) Targeted(3)

Phenotypic Description

Figure 1. The rufus mice (bottom) exhibit hypopigmentation. A C57BL/6J mouse (top) is shown for comparison.

The rufus phenotype was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R1544, some of which had a dark grey coat (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 117 mutations. The mutation in Tyr is presumed to be causative because the rufus hypopigmentation phenotype mimics other known alleles of Tyr (see MGI for a list of Tyr alleles). The Tyr mutation is a G to T transversion at base pair 87,492,706 (v38) on chromosome 7, or base pair 737 in the GenBank genomic region NC_000073 corresponding to residue 706 in the mRNA sequence NM_011661 within exon 5 of 5 total exons.

689 TGGCACAGACTTTTCTTGTTATTGTGGGAACAA 210 -W--H--R--L--F--L--L--L--W--E--Q-

The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to phenylalanine (F) substitution at position 215 (L215F) in the tyrosinase (Tyr) protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00).

Protein Prediction

Figure 2. Domain structure of Tyr. The rufus mutation causes a leucine to phenylalanine substitution at residue 215 of tyrosinase. SP, signal peptide; EGF-like, epidermal growth factor-like laminin domain; TM, transmembrane; CT, cytoplasmic tail. Glycosylation and copper binding sites are indicated in light and dark pink, respectively. Click on the image to view other mutations found in TYR. Click on each mututation for more specific information.

Tyr is a member of the tyrosinase-related protein (TRP) family that also includes Tyrp1 (see the record for chi) and Tyrp2 [alternatively, DOPAchrome tautomerase (DCT)]. The TRP proteins share homologous domains including a signal sequence, an EGF-like/cysteine (Cys)-rich domain, a catalytic domain that has two copper binding regions and a Cys-rich region, a transmembrane domain, and six putative glycosylation sites (Figure 2). The amino acid altered in rufus (L215F) occurs within the catalytic domain of Tyr and is within the proximity of one of the copper-binding sites (H211).

Please see the record ghost for information about Tyr.

Putative Mechanism

Tyr, Tyrp1, and Tyrp2 are Cu⁺⁺/Zn⁺⁺ metalloenzymes that function in melanogenesis leading to the formation of two types of pigments, eumelanins (brown or black) and pheomelanins (yellow or red). The melanogenic pathway starts with the tyrosinase-catalyzed conversion of L-tyrosine into L-dopaquinine (L-DQ).  The reaction involves two steps:  the rate-limiting hydroxylation of L-tyrosine to L-dopa (monophenolase activity of tyrosinase), and the oxidation of this intermediate o-diphenol to L-DQ (o-diphenoloxidase activity of tyrosinase).  Tyrosinase catalyzes the direct transformation of L-tyrosine into L-DQ without releasing L-dopa (1;2). Oculocutaneous albinism (OCA) in humans is a recessive genetically heterogeneous congenital disorder characterized by decreased or absent pigmentation in the hair, skin, and eyes.  OCA is caused by mutations in several genes including tyrosinase (OCA1A, OMIM #203100 and OCA1B, OMIM #606952). OCA1A is characterized by a complete lack of tyrosinase activity (and pigment), while individuals with OCA1B usually have some residual pigment due to reduced activity of the enzyme. Mice with Tyr mutations display a variety of pigmentation phenotypes that deviate from the wild-type black fur and eyes due to a reduction or a lack of melanin (3-6). Similar to the other Tyr mutant mouse models, the Tyr mutation in rufus results in hypopigmentation indicating loss of Tyr function.

Primers

PCR Primer
rufus_pcr_F: GGCTGCTGAAGTACCAGTCTTTGC
rufus_pcr_R: GGCCAAATGAACAATGGGTCAACAC

Sequencing Primer
rufus_seq_F: GAAGTACCAGTCTTTGCAACTC
rufus_seq_R: GGGTCAACACCCATGTTTAATG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 401 nucleotides is amplified (chromosome 7, - strand):

1   ggccaaatga acaatgggtc aacacccatg tttaatgata tcaacatcta cgacctcttt
61  gtatggatgc attactatgt gtcaagggac acactgcttg ggggctctga aatatggagg
121 gacattgatt ttgcccatga agcaccaggg tttctgcctt ggcacagact tttcttgtta
181 ttgtgggaac aagaaattcg agaactaact ggggatgaga acttcactgt tccatactgg
241 gattggagag atgcagaaaa ctgtgacatt tgcacagatg agtacttggg aggtcgtcac
301 cctgaaaatc ctaacttact cagcccagca tccttcttct cctcctggca ggtaagatgc
361 actatataga gagagttgca aagactggta cttcagcagc c

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Cooksey, C. J., Garratt, P. J., Land, E. J., Pavel, S., Ramsden, C. A., Riley, P. A., and Smit, N. P. (1997) Evidence of the Indirect Formation of the Catecholic Intermediate Substrate Responsible for the Autoactivation Kinetics of Tyrosinase. J Biol Chem. 272, 26226-26235.

  2. Naish-Byfield, S., and Riley, P. A. (1998) Tyrosinase Kinetics: Failure of Acceleration in Oxidation of Ring-Blocked Monohydric Phenol Substrate. Pigment Cell Res. 11, 94-97.

  3. Kwon, B. S., Haq, A. K., Wakulchik, M., Kestler, D., Barton, D. E., Francke, U., Lamoreux, M. L., Whitney, J. B., and Halaban, R. (1989) Isolation, Chromosomal Mapping, and Expression of the Mouse Tyrosinase Gene. J Invest Dermatol. 93, 589-594.

  4. Beermann, F., Orlow, S. J., and Lamoreux, M. L. (2004) The Tyr (Albino) Locus of the Laboratory Mouse 1. Mamm Genome. 15, 749-758.

  5. Shibahara, S., Okinaga, S., Tomita, Y., Takeda, A., Yamamoto, H., Sato, M., and Takeuchi, T. (1990) A Point Mutation in the Tyrosinase Gene of BALB/c Albino Mouse Causing the Cysteine----Serine Substitution at Position 85. European Journal of Biochemistry. 189, 455-461.

  6. Yokoyama, T., Silversides, D. W., Waymire, K. G., Kwon, B. S., Takeuchi, T., and Overbeek, P. A. (1990) Conserved Cysteine to Serine Mutation in Tyrosinase is responsible for the Classical Albino Mutation in Laboratory Mice. Nucleic Acids Res. 18, 7293-8.