Phenotypic Mutation 'rufus' (pdf version)
List |< first << previous [record 25 of 30] next >> last >|
Allelerufus
Mutation Type missense
Chromosome7
Coordinate87,492,706 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Tyr
Gene Name tyrosinase
Synonym(s) Oca1, skc35
Chromosomal Location 87,424,771-87,493,512 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene catalyzes the first 2 steps, and at least 1 subsequent step, in the conversion of tyrosine to melanin. The enzyme has both tyrosine hydroxylase and dopa oxidase catalytic activities, and requires copper for function. Mutations in this gene result in oculocutaneous albinism, and nonpathologic polymorphisms result in skin pigmentation variation. The human genome contains a pseudogene similar to the 3' half of this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Numerous mutations at this locus result in albinism or hypopigmentation. Albinism is associated with reduced number of optic nerve fibers and mutants can have impaired vision. Some alleles are lethal. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011661; MGI:98880

Mapped Yes 
Amino Acid Change Leucine changed to Phenylalanine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000004770] [ENSMUSP00000146757]
SMART Domains Protein: ENSMUSP00000004770
Gene: ENSMUSG00000004651
AA Change: L215F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
Pfam:Tyrosinase 170 403 4.8e-45 PFAM
transmembrane domain 474 496 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000004770)
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000207834)
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation 1352884 24879364
skin/coat/nails 1352884 24879364
Penetrance  
Alleles Listed at MGI

All mutations/alleles(126) : Chemically and radiation induced(4) Chemically induced (ENU)(8) Chemically induced (other)(5) Endonuclease-mediated(3) Radiation induced(74) Spontaneous(29) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Tyr APN 7 87437948 missense probably damaging 1.00
IGL01594:Tyr APN 7 87483814 splice site probably benign
IGL02963:Tyr APN 7 87483997 missense probably benign
IGL03356:Tyr APN 7 87492714 missense possibly damaging 0.71
ghost UTSW 7 87472495 missense probably damaging 1.00
pale_rider UTSW 7 87438023 missense probably damaging 1.00
siamese UTSW 7 87438044 missense probably damaging 1.00
Venusaur UTSW 7 87492706 missense
waffle UTSW 7 87493221 missense possibly damaging 0.94
R0322:Tyr UTSW 7 87492917 missense probably benign 0.35
R0479:Tyr UTSW 7 87493221 missense possibly damaging 0.94
R1544:Tyr UTSW 7 87492706 missense probably damaging 1.00
R1546:Tyr UTSW 7 87437992 missense probably benign 0.02
R1606:Tyr UTSW 7 87437971 missense probably benign 0.01
R1666:Tyr UTSW 7 87492941 missense probably damaging 1.00
R2064:Tyr UTSW 7 87492843 missense probably benign 0.13
R2213:Tyr UTSW 7 87492878 missense probably damaging 1.00
R2420:Tyr UTSW 7 87429189 missense probably benign 0.17
R4013:Tyr UTSW 7 87437940 missense probably benign 0.00
R4014:Tyr UTSW 7 87437940 missense probably benign 0.00
R4015:Tyr UTSW 7 87437940 missense probably benign 0.00
R4016:Tyr UTSW 7 87437940 missense probably benign 0.00
R4202:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4205:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4206:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4361:Tyr UTSW 7 87429076 missense probably benign 0.01
R4738:Tyr UTSW 7 87492647 missense probably null 1.00
R5306:Tyr UTSW 7 87438014 missense probably damaging 1.00
R5378:Tyr UTSW 7 87472495 missense probably damaging 1.00
R5395:Tyr UTSW 7 87472490 missense probably damaging 0.98
R5782:Tyr UTSW 7 87493016 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 038255-MU
Last Updated 2016-12-08 1:26 PM by Anne Murray
Record Created 2014-12-03 6:59 AM by Chad Daniel
Record Posted 2015-01-13
Phenotypic Description
Figure 1. The rufus mice (bottom) exhibit hypopigmentation. A C57BL/6J mouse (top) is shown for comparison.

The rufus phenotype was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R1544, some of which had a dark grey coat (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 117 mutations. The mutation in Tyr is presumed to be causative because the rufus hypopigmentation phenotype mimics other known alleles of Tyr (see MGI for a list of Tyr alleles). The Tyr mutation is a G to T transversion at base pair 87,492,706 (v38) on chromosome 7, or base pair 737 in the GenBank genomic region NC_000073 corresponding to residue 706 in the mRNA sequence NM_011661 within exon 5 of 5 total exons.

 

689 TGGCACAGACTTTTCTTGTTATTGTGGGAACAA

210 -W--H--R--L--F--L--L--L--W--E--Q-

 

The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to phenylalanine (F) substitution at position 215 (L215F) in the tyrosinase (Tyr) protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00).

Protein Prediction

Figure 2. Domain structure of Tyr. The rufus mutation causes a leucine to phenylalanine substitution at residue 215 of tyrosinase. SP, signal peptide; EGF-like, epidermal growth factor-like laminin domain; TM, transmembrane; CT, cytoplasmic tail. Glycosylation and copper binding sites are indicated in light and dark pink, respectively. Click on the image to view other mutations found in TYR. Click on each mututation for more specific information.

Tyr is a member of the tyrosinase-related protein (TRP) family that also includes Tyrp1 (see the record for chi) and Tyrp2 [alternatively, DOPAchrome tautomerase (DCT)]. The TRP proteins share homologous domains including a signal sequence, an EGF-like/cysteine (Cys)-rich domain, a catalytic domain that has two copper binding regions and a Cys-rich region, a transmembrane domain, and six putative glycosylation sites (Figure 2). The amino acid altered in rufus (L215F) occurs within the catalytic domain of Tyr and is within the proximity of one of the copper-binding sites (H211).

 

Please see the record ghost for information about Tyr.

Putative Mechanism

Tyr, Tyrp1, and Tyrp2 are Cu++/Zn++ metalloenzymes that function in melanogenesis leading to the formation of two types of pigments, eumelanins (brown or black) and pheomelanins (yellow or red). The melanogenic pathway starts with the tyrosinase-catalyzed conversion of L-tyrosine into L-dopaquinine (L-DQ).  The reaction involves two steps:  the rate-limiting hydroxylation of L-tyrosine to L-dopa (monophenolase activity of tyrosinase), and the oxidation of this intermediate o-diphenol to L-DQ (o-diphenoloxidase activity of tyrosinase).  Tyrosinase catalyzes the direct transformation of L-tyrosine into L-DQ without releasing L-dopa (1;2). Oculocutaneous albinism (OCA) in humans is a recessive genetically heterogeneous congenital disorder characterized by decreased or absent pigmentation in the hair, skin, and eyes.  OCA is caused by mutations in several genes including tyrosinase (OCA1A, OMIM #203100 and OCA1B, OMIM #606952). OCA1A is characterized by a complete lack of tyrosinase activity (and pigment), while individuals with OCA1B usually have some residual pigment due to reduced activity of the enzyme. Mice with Tyr mutations display a variety of pigmentation phenotypes that deviate from the wild-type black fur and eyes due to a reduction or a lack of melanin (3-6). Similar to the other Tyr mutant mouse models, the Tyr mutation in rufus results in hypopigmentation indicating loss of Tyr function.

Primers PCR Primer
rufus(F):5'- GGCTGCTGAAGTACCAGTCTTTGC -3'
rufus(R):5'- GGCCAAATGAACAATGGGTCAACAC -3'

Sequencing Primer
rufus_seq(F):5'- GAAGTACCAGTCTTTGCAACTC -3'
rufus_seq(R):5'- GGGTCAACACCCATGTTTAATG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsChad Daniel, Jamie Russell
List |< first << previous [record 25 of 30] next >> last >|