Phenotypic Mutation 'donald'

• Allele: donald
• Mutation Type: nonsense
• Chromosome: 10
• Coordinate: 10,617,252 bp (GRCm39)
• Base Change: G ⇒ T (forward strand)
• Gene: Grm1
• Gene Name: glutamate receptor, metabotropic 1
• Synonym(s): 4930455H15Rik, Grm1, mGluR1, rcw, nmf373, Gprc1a
• Chromosomal Location: 10,561,803-10,958,100 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metabotropic glutamate receptor that functions by activating phospholipase C. L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The canonical alpha isoform of the encoded protein is a disulfide-linked homodimer whose activity is mediated by a G-protein-coupled phosphatidylinositol-calcium second messenger system. This gene may be associated with many disease states, including schizophrenia, bipolar disorder, depression, and breast cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013] ; PHENOTYPE: Mice homozygous for null mutations show impairements in motor coordination, spatial learning, hippocampal mossy fiber long-term potentiation, and cerebellar long-term depression. Homozygotes for a spontaneous mutation are small and exhibit ataxia, kyphoscoliosis, albuminuria and glomerular damage. [provided by MGI curators]
• Mapped: No
• Amino Acid Change: Tyrosine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000037255] [ENSMUSP00000101189] [ENSMUSP00000101190]
• AlphaFold: P97772
• SMART Domains: Protein: ENSMUSP00000037255; Gene: ENSMUSG00000019828; AA Change: Y510*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	77	485	1.1e-94	PFAM
Pfam:Peripla_BP_6	151	340	1.4e-10	PFAM
Pfam:NCD3G	521	571	5.5e-16	PFAM
Pfam:7tm_3	604	837	2.4e-55	PFAM
low complexity region	969	975	N/A	INTRINSIC
low complexity region	983	993	N/A	INTRINSIC
low complexity region	1013	1033	N/A	INTRINSIC
low complexity region	1071	1088	N/A	INTRINSIC
low complexity region	1093	1109	N/A	INTRINSIC
low complexity region	1126	1136	N/A	INTRINSIC
GluR_Homer-bdg	1149	1199	6.85e-27	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000101189; Gene: ENSMUSG00000019828; AA Change: Y510*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	77	485	2e-92	PFAM
Pfam:Peripla_BP_6	152	347	2.7e-12	PFAM
Pfam:NCD3G	520	571	2.7e-19	PFAM
Pfam:7tm_3	602	838	3.2e-73	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000101190; Gene: ENSMUSG00000019828; AA Change: Y510*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	77	485	2e-92	PFAM
Pfam:Peripla_BP_6	152	347	2.7e-12	PFAM
Pfam:NCD3G	520	571	2.7e-19	PFAM
Pfam:7tm_3	602	838	3.2e-73	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9754
• Is this an essential gene?: Possibly nonessential (E-score: 0.483)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• MMRRC Submission: 038206-MU
• Last Updated: 2019-09-04 9:47 PM by Diantha La Vine
• Record Created: 2014-12-03 7:24 AM by Carlos Reyna
• Record Posted: 2015-06-17
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Carlos Reyna Jamie Russell Jeff SoRelle

Accession Number

NCBI RefSeq: NM_016976, NM_001114333; MGI:1351338

Alleles Listed at MGI

All mutations/alleles(13) : Chemically induced (ENU)(2) Gene trapped(1) Spontaneous(5) Targeted(4) Transgenic(1)

Phenotypic Description

Figure 1. The donald phenotype.

The donald phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1615, some of which exhibited ataxia (Figure 1), kyphosis, and premature death.

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. Among these, only one affected a gene (Grm1) with known neurological functions. The mutation in Grm1 was presumed to be causative because the donald neurological phenotype mimics other mutant alleles of Grm1 (see MGI for a list of Grm1 alleles). The Grm1 mutation in donald is a C to A transversion at base pair 10,741,508 (v38) on chromosome 10, or base pair 340,870 in the GenBank genomic region NC_000076 encoding Grm1. The mutation corresponds to residue 1,931 in the NM_016976 mRNA sequence in exon 6 of 9 total exons and residue 1,931 in the NM_001114333 mRNA sequence in exon 6 of 10 total exons.

340853 CTGAATATCGATGATTACAAAATCCAGATGAAC 505    -L--N--I--D--D--Y--K--I--Q--M--N-

Genomic numbering corresponds to NC_000076. The mutated nucleotide is indicated in red.  The mutation results in substitution of tyrosine 510 (Y510) for a premature stop codon (Y510*) in all isoforms of the metabotropic glutamate receptor 1 (mGluR1) protein.

Protein Prediction

Figure 2. Domain structure of mGluR1a. mGluR1a is a G protein-coupled receptor with a signal peptide (SP), a ligand-binding domain (LBD), a Cys-rich domain (CYS), seven transmembrane domains (TM), and a proline-rich region. The donald mutation results in a tyrosine to stop codon substitution at position 510. This image is interactive. Other mutations found in the protein are noted in red. Click on each allele for more information.

Figure 3. Crystal structure of the ligand-binding domain of rat mGluR1a. The two lobes, LB1 (N-terminal) and LB2 (C-terminal), are indicated. Figure was generated using UCSF Chimera and is based on PDB:1ISS and (3).

mGluR1 is a class 3/C G-protein-coupled receptor (GPCR). Class 3 GPCRs include class B GABA (GABA_B) receptors, taste and pheromone receptors, and calcium-sensing receptor (CaR). Class 3 GPCRs have an N-terminal signal peptide (amino acids 1-20 in mGluR1), large extracellular ligand-biding domains (LBDs), a cysteine-rich domain (CRD), seven transmembrane domains, and a variable-length intracellular C-terminal tail (Figure 2).

The N-terminal LBD region of mGluR1 (amino acids 21-510) is essential for the recognition of glutamate as well as receptor agonists and competitive antagonists (1;2). The structure of the LBD of rat mGluR1 (m1-LBR) in both an active (open/closed) and resting (open/open) form have been solved [Figure 3; PDB: 1ISS; (3)]. Both the active and resting m1-LBR structures were a homodimer connected via a disulfide bond between Cys140 from each monomer. The role of mGluR dimerization is unknown, but is proposed to modulate the proper folding of the mGluRs, permitting the proper function of the receptor. The LBD forms two lobes [LB1 (N-terminal) and LB2 (C-terminal)] connected by three short loops and separated by a cavity where glutamate binds (3-5). The relative positions of LB1 and LB2 define the open and closed states of the receptor. Glutamate binding results in closing of the N-terminal lobes around the ligand. The conformational change between the open and closed forms is a rotation about an axis that passes across the three connecting loops (3;6). Within the dimer, the two LB1 domains rotate by about 70° (3)  In the open/closed active state, two molecules of glutamate bind each monomer through an interaction only with the LB1 interface. In the closed state, glutamate interacts with both LB1 and LB2; full mGluR1 activation requires glutamate binding to both subunits (7). Several residues are known to be involved in the interaction with glutamate, including Ser165 and Thr188. Arg178 is also proposed to facilitate an interaction with an acidic group of mGluR agonists (8).

The mGluR1 LBD is separated from the transmembrane region by a cysteine (Cys)-rich region (amino acids 521-570). The Cys-rich region is essential for proper folding and trafficking of mGluRs and is proposed to be a flexible spacer that allows for the displacement of the glutamate binding pocket towards the transmembrane domains (9-12). Several cysteines within the N-terminal tail and the Cys-rich region form intramolecular disulfide bonds including Cys67-Cys109, Cys289-Cys291, Cys378-Cys394, Cys432-Cys439, Cys657-Cys746. 

The second intracellular (i2) loop and the membrane-proximal C-terminal region mediate the interaction with either G_s or G_q; the role of G proteins in the G_i/o family is unclear [(13-17); reviewed in (18)]. Mutation of Lys690 within the i2 region switches mGluR1 coupling to different members of the G_i protein family. Amino acids within the third intracellular (i3) loop are also essential for the activation of G_s or G_q.

Grm1 generates multiple mGluR1 isoforms due to alternative splicing (Table 1). The mGluR1 variants differ in the nature and size of their respective C-termini. mGluR1a is the longest isoform, while the other variants have shorter C-terminal tails; the first 886 amino acids of each isoform is identical to each other (19).

Table 1. Characteristics of the mGluR1 isoforms

Isoform symbol	Alternative designation	Size (amino acids)	Molecular description and features	Source	Expression/Localization	References
mGluR1a	mGluR1α	1199	Longest isoform with a 361 aa intracellular C-terminal domain	Human, rat, mouse	Cerebellum (granule cells, Purkinje cells, and basket cells), cerebral cortex, thalamus, subthalamic nucleus, olfactory bulb, amygdala, hippocampus, substantia nigra, caudate nucleus, and putamen	(19-23)
mGluR1b	mGluR1β1	906	Insertion of an 85-bp exon 9; exon codes for an in-frame stop codon, thus generating a substitution of the last 318 amino acids of mGlu1a with 20 different residues; contains a 68 aa intracellular domain	Human, rat, mouse	Cerebellum, olfactory bulb	(24)
mGluR1c	---	897	Alternatively spliced exon inserted after the seventh transmembrane domain; may derive from a recombination event; differs from mGluR1b in that the 21 C-terminal amino acids of mGluR1b are replaced by 11 aa; contains a 59 aa C-terminal domain	Rat only?	Cerebellum; less expression than mGluR1a and mGluR1b	(25)
mGluR1d	mGluR1γ	908	Alternative splice acceptor site in exon 10 and subsequent frameshit inserts a stop codon 22 amino acids downstream from splice site; contains a 70 aa C-terminus	Human, rat	Cerebellum (granule cells) and kidney	(26-28)
mGluR1f	mGluR1β2	906	Insertion of the same 85-bp exon (exon 9) that generates mGlu1β1, plus the usage of an alternative splice acceptor in exon 10 that is located 35 bp downstream from the 5′-end of the exon; contains a 68 aa C-terminus	Rat only?	Cerebellum	(29)
mGluR1g	---	887	Skipping of the splice donor site in exon 8; in-frame stop codon 1 bp downstream of the skipped splice site; may derive from partially processed pre-mRNA; C-terminus consists of 1 aa after the residue 886	Human, rat	Cerebellar granule cells	(19)
mGluR1h	---	897	Predicted C-terminal splice variant of 10 additional amino acids; encoded by two previously unidentified exons (exon IXa and exon IXb)	Human only?	Melanoma cell lines and melanocytes	(30)
mGluR1E55	mGluR1δ	321	Insertion between exons 3 and 4 of a 110-bp exon (designated as exon E55), which contains an in-frame stop codon; contains only the extracellular domain; may be secreted	Mouse only?	Adult cerebellum and heart; function unknown	(31)

The long C-terminal tail of mGluR1a contains motifs essential for targeting of mGluR1a in Purkinje cell (PC) spines, for inositol 1,4,5-trisphosphate (IP₃) receptor-mediated Ca²⁺ release from the smooth endoplasmic reticulum in PCs, long-term depression induction, CF synapse elimination, and delay eye blink conditioning (32). A PSD-95/discs-large/ZO-1 (PDZ) domain binding sequence (SSSTL; amino acids 1195-1199) mediates interactions with several scaffolding and cytoskeletal proteins (33). A proline-rich domain (PPSPFR; amino acids 1152-1157) interacts with Homer proteins to mediate subsequent interactions with signaling proteins including IP₃ (34;35) as well as to mediate receptor trafficking (36;37). Two calmodulin binding sites have also been identified in the C-terminal tail of mGluR1a (38). Several serine/threonine residues within the CaM-binding sites are phosphorylated by protein kinase C (PKC; see the record for Untied), which suppresses the interaction between mGluR1a and CaM (39-41). Siah1A (seven in absentia homolog 1A), an E3 ubiquitin ligase, binds the C-terminal tail of mGluR1a, resulting in its degradation (42). The shorter C-terminal tail in the mGluR1b, mGluR1c, and mGluR1d variants causes reduced agonist potency and slower agonist-stimulated second messenger responses compared with mGluR1a (17;25;26;43;44).

mGluR1 has several N-linked glycosylation consensus sequences [AsnXxx(Thr/Ser); Xxx is any amino acid] within the N-terminal domain and the extracellular loops. Mouse mGluR1 is predicted to be N-linked glycosylated at Asn98, Asn223, Asn397, Asn515, and Asn747. mGluR1 N-linked glycosylation is essential for efficient agonist-stimulated phosphoinositide hydrolysis and receptor dimerization (45).

The mutation in donald results in substitution of tyrosine 510 (Y510) for a premature stop codon (Y510*) in all mGluR1 isoforms. Y510 is within the LBD of mGluR1; Y510 is not predicted to be involved in glutamate binding.

Expression/Localization

mGluR1 is expressed in all CA3 lamina of the hippocampus (46-48). mGluR1 is localized mainly to the postsynapse including the periphery of the postsynaptic densities (49), but mGluR1 can also be presynaptic. The mGluR1 isoforms exhibit tissue-specific expression patterns including differential expression in the cerebellum, hippocampus, olfactory bulbs, and kidneys (Table 1) (28).

A coat component of caveolae, caveolin-1, binds mGluR1 (50). Association between caveolin-1 and mGluR1 regulates the rate of constitutive receptor internalization and subsequent level of mGluR1 expression at the cell surface as well as mGluR1-associated ERK/MAPK activation and calcium signaling (50;51).

Background

Figure 4. GPCR activation cycle. In its inactive state, the GDP-bound α subunit and the βγ complex are associated. Upon agonist binding, the GPCR undergoes conformational change and exchanges GDP for GTP in the Gα subunit. GTP-Gα and βγ dissociate and modulate effectors. Hydrolysis of GTP to GDP by RGS leads to inactivation of the G-protein.

Figure 5. Glutamate-stimulated signaling through mGluR7 and mGluR1a. Upon presynaptic depolarization, Ca 2+ enters the presynapse through voltage-gated Ca 2+ channels (VGCCs) and induces glutamate release and CaM activation. Upon G-protein activation, PKC is recruited to mGluR7 through binding to PICK1. Activation of mGluR7 results in inhibition of adenylate cyclase activity (i.e., the formation of cAMP and ATP), the attenuation of N-type VGCCs, the activation of K + channels, and the subsequent decrease in neurotransmitter (glutamate and GABA) release. See the record for shaky for more details on the signaling pathways activated downstream of mGluR7. Upon stimulation by glutamate, mGluR1s in the post-synaptic membrane couple to multiple signaling pathways through different G proteins. Several second messenger systems are activated upon mGluR1 activation including PKB, PLCγ, PI3K/AKT/mTOR, IP3/DAG, NFκB and CaM. The C-terminus of mGluR1 interacts with Homer proteins, which facilitate the association of mGluR1 with IP 3 receptors in the endoplasmic reticulum. Activation of these signaling pathways result in cell survival (PKC/PLD), proliferation (PKC/ERK1/2), learning, memory, and long-term potentiation (CaM), synaptic remodeling and plasticity (cAMP, PI3K/AKT/mTOR). See the text for more details on the signaling pathways activated downstream of mGluR1a.

Glutamate is the major excitatory amino acid in the mammalian brain, mediating an estimated 50% of all synaptic transmission in the central nervous system [reviewed in (52)]. Glutamate is synthesized, stored, released from the presynaptic terminal, and acts through both ligand-gated ion channels (ionotropic glutamate receptors; see the record for swagger) and G-protein coupled receptors (mGluRs) on postsynaptic neurons [reviewed in (53)]. Activation of these receptors accounts for basal excitatory synaptic transmission and synaptic plasticity, such as long-term potentiation (LTP) and long-term depression (LTD) that are thought to underlie learning and memory. Glutamatergic synaptic transmission is implicated in nearly all aspects of normal brain function, including learning, memory, movement, cognition, and development. However, at elevated concentrations that excessively stimulate the same receptors, glutamate acts as a neurotoxin capable of causing extensive neuronal damage and death in the development and progression of several neurological disorders. Thus, the brain maintains very low intrasynaptic concentrations of glutamate by the action of glutamate transporters present in the plasma membrane of both glial cells and neurons.

The mGluRs transduce signals through increased ion flux and second messenger signaling pathways. The mGluRs are subdivided into three groups, designated group I, II, and III, according to agonist selectivity, coupling to different effector systems, and sequence homology. Group I includes mGluR1 and mGluR5; group II includes mGluR2 and mGluR3; and group III consists of mGluR4, mGluR6, mGluR7, and mGluR8. Group I mGluRs function in inositol phospholipid metabolism leading to increased levels of intracellular calcium, the activation of ryanodine-sensitive calcium stores (54;55), and alteration in the activity of voltage-gated channels (56-58). Both group II and III are negatively coupled to adenylate cyclase activity, leading to reduced production of cyclic AMP (cAMP) and often resulting in reduced transmitter release (59).

mGluR1-associated signaling is essential for proper cerebellar function including the regulation of excitatory synaptic transmission, neuron excitability, synaptic plasticity, the induction of long-term potentiation (60-62), long-term depression of synaptic transmission in the hippocampus (63), and induction of long-term depression at the parallel fiber-Purkinje cell synapses in the cerebellum (64-67). mGluR1 also regulates the proliferation, differentiation, and survival of neural stem/progenitor cells [reviewed in (68)]. At the presynapse, mGluR1 regulates glutatamate release (69).

As a GPCR, mGluR1 couples with a heterotrimeric G protein to mediate its downstream effects. G proteins, which consist of an α subunit that binds and hydrolyzes GTP (Gα), and β and γ subunits that are constitutively associated in a complex [reviewed in (70); Figure 4].  In the absence of a stimulus, the GDP-bound α subunit and the βγ complex are associated.  Upon activation by ligand binding, the GPCR recruits its cognate heterotrimeric G protein, and undergoes a conformational change enabling it to act as guanine nucleotide exchange factor (GEF) for the G protein α subunit. GEFs promote the exchange of GDP for GTP, resulting in dissociation of the GTP-bound α subunit from the activated receptor and the βγ complex. Both the GTP-bound α subunit and the βγ complex mediate signaling by modulating the activities of other proteins, such as adenylyl cyclases, phospholipases, and ion channels. Gα signaling is terminated upon GTP hydrolysis. The GDP-bound Gα subunit reassociates with the βγ complex and is ready for another activation cycle. 

mGluR1 promotes phospholipase C (PLC; see the record for queen)/inositol-1,4,5-trisphosphate (IP₃)/Ca²⁺ activation through the coupling to G_q/11 proteins upon ligand binding (Figure 5). Upon mGluR1 activation, PLC-mediated phosphatidylinositol-4,5-bisphosphate (PIP2) hydrolysis produces IP₃ and diacylglycerol (DAG) (16;25;71). DAG is responsible for activating PKC and possibly the TRP calcium influx channels, while IP₃ modulates calcium responses within the cell by binding to receptors on intracellular membranes to allow the mobilization of intracellular calcium (55). mGluR1-mediated changes in calcium levels can regulate neurotransmission, gene transcription, and apoptosis. mGluR1-stimulated release of intracellular calcium can also promote the activation of CaM, which acts as a second messenger to transduce calcium-related signals. Binding of calcium to CaM results in the activation of calcium/CaM-dependent kinases (CaMK) and the subsequent signaling regulates learning and memory as well as long-term potentiation (72). mGluR1-associated signaling also results in the PLC- and Ca²⁺/CaM-mediated phosphorylation of focal adhesion kinase (FAK) (73). FAK phosphorylation may mediate glutamate-associated effects on cytoskeleton dynamics. mGluR1-associated signaling results in induction of ERK1/2 phosphorylation independent of Ca²⁺ and phosphatidylinositol 3-kinase (PI3K) activity (74;75). In the spinal cord, mGluR1-mediated activation of ERK1/2 results in nociceptive sensitization, a feature of chronic pain (76;76). During inflammation in the spinal cord, mGluR1 is involved in functional plasticity through the activation of ERKs (76).

Homer1 binding to mGluR1 recruits Shank, a scaffold protein that facilitates an interaction between mGluR1 and NMDARs, subsequently leading to calcium influx (33). Homer1 also couples mGluR1 to PI3K to initiate signaling that will promote cell survival, metabolism, proliferation, and cancer progression (77). The PI3K-Akt-mTOR signaling pathway is activated in mGluR1-dependent long-term depression in the CA1 area of the hippocampus (78). mGluR1-mediated activation of Akt1/2 is both neuroprotective and pro-proliferative in some neuronal cell types (77;79;80); activation of mGluR1 can also be a pro-apoptotic signal in some neural subsets (81). As a pro-survival factor, Akt1 phosphorylates BAD (Bcl2-associated death protein), leading to dissociation of BAD from the Bcl-2/Bcl-XL complex (82). Akt1-mediated phosphorylation of proteins within the mTORC1 complex leads to increased mRNA translation that stimulates cell growth.

In CA3 pyramidal cells, mGluR1-induced excitatory postsynaptic currents is G protein-independent, requiring the activation of tyrosine kinases of the Src family (83). Src tyrosine kinases activate downstream messengers including ERK1/2 (83). G protein-independent signaling regulates long-term potentiation (83).

mGluR1a receptor activation can also mediate cyclic AMP (cAMP) accumulation (16;84;85); the mGluR1b, mGluR1c, and mGlu1d splice variants did not promote cAMP accumulation (17;26;86).

mGluRs have roles in epilepsy, neurotoxicity, and neurodegenerative diseases including Huntington’s Disease and Alzheimer’s disease (87;88). Mutations in GRM1 have been linked to autosomal recessive spinocerebellar ataxia (OMIM: #614831) (89;90). Patients with spinocerebellar ataxia exhibit developmental delay, stance and gait ataxia, dysarthria, dysmetria and tremors, and intellectual deficit.

mGluR1 has additional functions outside of the central nervous system. In the kidney, mGluR1 regulates podocyte foot process morphology and signaling in the podocyte. Grm1^crv4/crv4 mice, harboring a spontaneous splicing mutation within intron 4, exhibit albuminuria, podocyte foot process effacement, and reduced levels of proteins that regulate the maintenance of podocyte cell structure including nephrin, podocin, and ZO-1 (28). mGluR1 expression is also required for melanoma development and growth (91). Conditional expression of mGluR1 in melanocytes resulted in the formation of pigmented lesions on the ears and tails 29 weeks after transgene activation (91).

Putative Mechanism

Grm1-deficient (Grm1^-/-) and Grm1 mutant mice have normal anatomy of the hippocampus, excitatory synaptic transmission from parallel fibers to Purkinje cells and from climbing fibers to Purkinje cells, and short-term potentiation in the CA1 region of the hippocampus (92;93). However, the Grm1 mutant mice exhibit ataxia by postnatal day (P) 14, action tremors, loss or ability to right themselves, spatial learning deficits, impaired long-term depression, and reduced long-term potentiation (22;67;92-96). Similar to Grm1 mutant mice, donald mice exhibit ataxia, indicating loss of function in mGluR1^donald.

Primers

PCR Primer
donald_pcr_F: TGCAGTTCTAGCTAAACATAAGGGCAG
donald_pcr_R: GGTCTCAGCTTTGTAAGACTTCCCATC

Sequencing Primer
donald_seq_F: GCTAAACATAAGGGCAGTCTTC
donald_seq_R: ACTTGTTCAAAGGGTACTACCTGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 737 nucleotides is amplified (chromosome 10, - strand):

1   ggtctcagct ttgtaagact tcccatcttc caaaacgtca ttgtaatgaa aatggcaact
61  gagtataaaa agagaatgtg aaataaaagt agacaagcat ggaaattagt gttttcatgg
121 atagtatgaa tggttacttg ttcaaagggt actacctgga tttaaagagt tgatcaacta
181 aacacataca ttattacctt ttgaatcgta aacagagaaa aaatgagagt aatatattat
241 ttaacaaaaa tggatggtat agagacattc tctgagaatt agaggaagca ttcacaataa
301 actataaatg tgacagtcac tggtgctgat gtgtgatgat ccaagttttg agctctcttc
361 ttccactaaa atccatttac aaattgtctt tgtttcctca ctcacatgta tttattttct
421 ttgttaggta tgacattatg aatctgcagt acacagaggc taatcgctat gactatgtcc
481 atgtgggaac ctggcatgaa ggtgtgctga atatcgatga ttacaaaatc cagatgaaca
541 aaagcggaat ggtacgatct gtgtgcagcg agccttgctt aaagggtcag attaaggtaa
601 ggcacaaaca catccctgta cattatttgc aaagaagttc accaccttag caatagcaaa
661 gaaaaacata tttttttaag caagactatc cagaaagagt atatagaaga ctgcccttat
721 gtttagctag aactgca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Takahashi, K., Tsuchida, K., Tanabe, Y., Masu, M., and Nakanishi, S. (1993) Role of the Large Extracellular Domain of Metabotropic Glutamate Receptors in Agonist Selectivity Determination. J Biol Chem. 268, 19341-19345.

  2. Tones, M. A., Bendali, N., Flor, P. J., Knopfel, T., and Kuhn, R. (1995) The Agonist Selectivity of a Class III Metabotropic Glutamate Receptor, Human mGluR4a, is Determined by the N-Terminal Extracellular Domain. Neuroreport. 7, 117-120.

  3. Kunishima, N., Shimada, Y., Tsuji, Y., Sato, T., Yamamoto, M., Kumasaka, T., Nakanishi, S., Jingami, H., and Morikawa, K. (2000) Structural Basis of Glutamate Recognition by a Dimeric Metabotropic Glutamate Receptor. Nature. 407, 971-977.

  4. Costantino, G., Macchiarulo, A., and Pellicciari, R. (2001) Homology Model of the Closed, Functionally Active, Form of the Amino Terminal Domain of mGlur1. Bioorg Med Chem. 9, 847-852.

  5. Costantino, G., and Pellicciari, R. (1996) Homology Modeling of Metabotropic Glutamate Receptors. (mGluRs) Structural Motifs Affecting Binding Modes and Pharmacological Profile of mGluR1 Agonists and Competitive Antagonists. J Med Chem. 39, 3998-4006.

  6. Jingami, H., Nakanishi, S., and Morikawa, K. (2003) Structure of the Metabotropic Glutamate Receptor. Curr Opin Neurobiol. 13, 271-278.

  7. Kammermeier, P. J., and Yun, J. (2005) Activation of Metabotropic Glutamate Receptor 1 Dimers Requires Glutamate Binding in both Subunits. J Pharmacol Exp Ther. 312, 502-508.

  8. Jensen, A. A., Sheppard, P. O., O'Hara, P. J., Krogsgaard-Larsen, P., and Brauner-Osborne, H. (2000) The Role of Arg(78) in the Metabotropic Glutamate Receptor mGlu(1) for Agonist Binding and Selectivity. Eur J Pharmacol. 397, 247-253.

  9. Peltekova, V., Han, G., Soleymanlou, N., and Hampson, D. R. (2000) Constraints on Proper Folding of the Amino Terminal Domains of Group III Metabotropic Glutamate Receptors. Brain Res Mol Brain Res. 76, 180-190.

  10. Robbins, M. J., Ciruela, F., Rhodes, A., and McIlhinney, R. A. (1999) Characterization of the Dimerization of Metabotropic Glutamate Receptors using an N-Terminal Truncation of mGluR1alpha. J Neurochem. 72, 2539-2547.

  11. Fan, G. F., Ray, K., Zhao, X. M., Goldsmith, P. K., and Spiegel, A. M. (1998) Mutational Analysis of the Cysteines in the Extracellular Domain of the Human Ca2+ Receptor: Effects on Cell Surface Expression, Dimerization and Signal Transduction. FEBS Lett. 436, 353-356.

  12. Pace, A. J., Gama, L., and Breitwieser, G. E. (1999) Dimerization of the Calcium-Sensing Receptor Occurs within the Extracellular Domain and is Eliminated by Cys --> Ser Mutations at Cys101 and Cys236. J Biol Chem. 274, 11629-11634.

  13. Gomeza, J., Joly, C., Kuhn, R., Knopfel, T., Bockaert, J., and Pin, J. P. (1996) The Second Intracellular Loop of Metabotropic Glutamate Receptor 1 Cooperates with the Other Intracellular Domains to Control Coupling to G-Proteins. J Biol Chem. 271, 2199-2205.

  14. Pin, J. P., Joly, C., Heinemann, S. F., and Bockaert, J. (1994) Domains Involved in the Specificity of G Protein Activation in Phospholipase C-Coupled Metabotropic Glutamate Receptors. EMBO J. 13, 342-348.

  15. Francesconi, A., and Duvoisin, R. M. (1998) Role of the Second and Third Intracellular Loops of Metabotropic Glutamate Receptors in Mediating Dual Signal Transduction Activation. J Biol Chem. 273, 5615-5624.

  16. Aramori, I., and Nakanishi, S. (1992) Signal Transduction and Pharmacological Characteristics of a Metabotropic Glutamate Receptor, mGluR1, in Transfected CHO Cells. Neuron. 8, 757-765.

  17. Joly, C., Gomeza, J., Brabet, I., Curry, K., Bockaert, J., and Pin, J. P. (1995) Molecular, Functional, and Pharmacological Characterization of the Metabotropic Glutamate Receptor Type 5 Splice Variants: Comparison with mGluR1. J Neurosci. 15, 3970-3981.

  18. Ferraguti, F., Crepaldi, L., and Nicoletti, F. (2008) Metabotropic Glutamate 1 Receptor: Current Concepts and Perspectives. Pharmacol Rev. 60, 536-581.

  19. Makoff, A. J., Phillips, T., Pilling, C., and Emson, P. (1997) Expression of a Novel Splice Variant of Human mGluR1 in the Cerebellum. Neuroreport. 8, 2943-2947.

  20. Stephan, D., Bon, C., Holzwarth, J. A., Galvan, M., and Pruss, R. M. (1996) Human Metabotropic Glutamate Receptor 1: MRNA Distribution, Chromosome Localization and Functional Expression of Two Splice Variants. Neuropharmacology. 35, 1649-1660.

  21. Ryo, Y., Miyawaki, A., Furuichi, T., and Mikoshiba, K. (1993) Expression of the Metabotropic Glutamate Receptor mGluR1 Alpha and the Ionotropic Glutamate Receptor GluR1 in the Brain during the Postnatal Development of Normal Mouse and in the Cerebellum from Mutant Mice. J Neurosci Res. 36, 19-32.

  22. Ichise, T., Kano, M., Hashimoto, K., Yanagihara, D., Nakao, K., Shigemoto, R., Katsuki, M., and Aiba, A. (2000) MGluR1 in Cerebellar Purkinje Cells Essential for Long-Term Depression, Synapse Elimination, and Motor Coordination. Science. 288, 1832-1835.

  23. Sugiyama, H., Ito, I., and Hirono, C. (1987) A New Type of Glutamate Receptor Linked to Inositol Phospholipid Metabolism. Nature. 325, 531-533.

  24. Tanabe, Y., Masu, M., Ishii, T., Shigemoto, R., and Nakanishi, S. (1992) A Family of Metabotropic Glutamate Receptors. Neuron. 8, 169-179.

  25. Pin, J. P., Waeber, C., Prezeau, L., Bockaert, J., and Heinemann, S. F. (1992) Alternative Splicing Generates Metabotropic Glutamate Receptors Inducing Different Patterns of Calcium Release in Xenopus Oocytes. Proc Natl Acad Sci U S A. 89, 10331-10335.

  26. Mary, S., Stephan, D., Gomeza, J., Bockaert, J., Pruss, R. M., and Pin, J. P. (1997) The Rat mGlu1d Receptor Splice Variant Shares Functional Properties with the Other Short Isoforms of mGlu1 Receptor. Eur J Pharmacol. 335, 65-72.

  27. Laurie, D. J., Boddeke, H. W., Hiltscher, R., and Sommer, B. (1996) HmGlu1d, a Novel Splice Variant of the Human Type I Metabotropic Glutamate Receptor. Eur J Pharmacol. 296, R1-R3.

  28. Puliti, A., Rossi, P. I., Caridi, G., Corbelli, A., Ikehata, M., Armelloni, S., Li, M., Zennaro, C., Conti, V., Vaccari, C. M., Cassanello, M., Calevo, M. G., Emionite, L., Ravazzolo, R., and Rastaldi, M. P. (2011) Albuminuria and Glomerular Damage in Mice Lacking the Metabotropic Glutamate Receptor 1. Am J Pathol. 178, 1257-1269.

  29. Soloviev, M. M., Ciruela, F., Chan, W. Y., and McIlhinney, R. A. (1999) Identification, Cloning and Analysis of Expression of a New Alternatively Spliced Form of the Metabotropic Glutamate Receptor mGluR1 mRNA1. Biochim Biophys Acta. 1446, 161-166.

  30. DiRaddo, J. O., Pshenichkin, S., Gelb, T., and Wroblewski, J. T. (2013) Two Newly Identified Exons in Human GRM1 Express a Novel Splice Variant of Metabotropic Glutamate 1 Receptor. Gene. 519, 367-373.

  31. Zhu, H., Ryan, K., and Chen, S. (1999) Cloning of Novel Splice Variants of Mouse mGluR1. Brain Res Mol Brain Res. 73, 93-103.

  32. Ohtani, Y., Miyata, M., Hashimoto, K., Tabata, T., Kishimoto, Y., Fukaya, M., Kase, D., Kassai, H., Nakao, K., Hirata, T., Watanabe, M., Kano, M., and Aiba, A. (2014) The Synaptic Targeting of mGluR1 by its Carboxyl-Terminal Domain is Crucial for Cerebellar Function. J Neurosci. 34, 2702-2712.

  33. Tu, J. C., Xiao, B., Naisbitt, S., Yuan, J. P., Petralia, R. S., Brakeman, P., Doan, A., Aakalu, V. K., Lanahan, A. A., Sheng, M., and Worley, P. F. (1999) Coupling of mGluR/Homer and PSD-95 Complexes by the Shank Family of Postsynaptic Density Proteins. Neuron. 23, 583-592.

  34. Ango, F., Prezeau, L., Muller, T., Tu, J. C., Xiao, B., Worley, P. F., Pin, J. P., Bockaert, J., and Fagni, L. (2001) Agonist-Independent Activation of Metabotropic Glutamate Receptors by the Intracellular Protein Homer. Nature. 411, 962-965.

  35. Tu, J. C., Xiao, B., Yuan, J. P., Lanahan, A. A., Leoffert, K., Li, M., Linden, D. J., and Worley, P. F. (1998) Homer Binds a Novel Proline-Rich Motif and Links Group 1 Metabotropic Glutamate Receptors with IP3 Receptors. Neuron. 21, 717-726.

  36. Roche, K. W., Tu, J. C., Petralia, R. S., Xiao, B., Wenthold, R. J., and Worley, P. F. (1999) Homer 1b Regulates the Trafficking of Group I Metabotropic Glutamate Receptors. J Biol Chem. 274, 25953-25957.

  37. Ciruela, F., Soloviev, M. M., and McIlhinney, R. A. (1999) Co-Expression of Metabotropic Glutamate Receptor Type 1alpha with Homer-1a/Vesl-1S Increases the Cell Surface Expression of the Receptor. Biochem J. 341 ( Pt 3), 795-803.

  38. Ishikawa, K., Nash, S. R., Nishimune, A., Neki, A., Kaneko, S., and Nakanishi, S. (1999) Competitive Interaction of Seven in Absentia Homolog-1A and Ca2+/calmodulin with the Cytoplasmic Tail of Group 1 Metabotropic Glutamate Receptors. Genes Cells. 4, 381-390.

  39. Minakami, R., Jinnai, N., and Sugiyama, H. (1997) Phosphorylation and Calmodulin Binding of the Metabotropic Glutamate Receptor Subtype 5 (mGluR5) are Antagonistic in Vitro. J Biol Chem. 272, 20291-20298.

  40. Masu, M., Tanabe, Y., Tsuchida, K., Shigemoto, R., and Nakanishi, S. (1991) Sequence and Expression of a Metabotropic Glutamate Receptor. Nature. 349, 760-765.

  41. Francesconi, A., and Duvoisin, R. M. (2000) Opposing Effects of Protein Kinase C and Protein Kinase A on Metabotropic Glutamate Receptor Signaling: Selective Desensitization of the Inositol trisphosphate/Ca2+ Pathway by Phosphorylation of the Receptor-G Protein-Coupling Domain. Proc Natl Acad Sci U S A. 97, 6185-6190.

  42. Moriyoshi, K., Iijima, K., Fujii, H., Ito, H., Cho, Y., and Nakanishi, S. (2004) Seven in Absentia Homolog 1A Mediates Ubiquitination and Degradation of Group 1 Metabotropic Glutamate Receptors. Proc Natl Acad Sci U S A. 101, 8614-8619.

  43. Prezeau, L., Gomeza, J., Ahern, S., Mary, S., Galvez, T., Bockaert, J., and Pin, J. P. (1996) Changes in the Carboxyl-Terminal Domain of Metabotropic Glutamate Receptor 1 by Alternative Splicing Generate Receptors with Differing Agonist-Independent Activity. Mol Pharmacol. 49, 422-429.

  44. Mary, S., Gomeza, J., Prezeau, L., Bockaert, J., and Pin, J. P. (1998) A Cluster of Basic Residues in the Carboxyl-Terminal Tail of the Short Metabotropic Glutamate Receptor 1 Variants Impairs their Coupling to Phospholipase C. J Biol Chem. 273, 425-432.

  45. Mody, N., Hermans, E., Nahorski, S. R., and Challiss, R. A. (1999) Inhibition of N-Linked Glycosylation of the Human Type 1alpha Metabotropic Glutamate Receptor by Tunicamycin: Effects on Cell-Surface Receptor Expression and Function. Neuropharmacology. 38, 1485-1492.

  46. Baude, A., Nusser, Z., Roberts, J. D., Mulvihill, E., McIlhinney, R. A., and Somogyi, P. (1993) The Metabotropic Glutamate Receptor (mGluR1 Alpha) is Concentrated at Perisynaptic Membrane of Neuronal Subpopulations as Detected by Immunogold Reaction. Neuron. 11, 771-787.

  47. Lujan, R., Nusser, Z., Roberts, J. D., Shigemoto, R., and Somogyi, P. (1996) Perisynaptic Location of Metabotropic Glutamate Receptors mGluR1 and mGluR5 on Dendrites and Dendritic Spines in the Rat Hippocampus. Eur J Neurosci. 8, 1488-1500.

  48. Shigemoto, R., Kinoshita, A., Wada, E., Nomura, S., Ohishi, H., Takada, M., Flor, P. J., Neki, A., Abe, T., Nakanishi, S., and Mizuno, N. (1997) Differential Presynaptic Localization of Metabotropic Glutamate Receptor Subtypes in the Rat Hippocampus. J Neurosci. 17, 7503-7522.

  49. Ferraguti, F., and Shigemoto, R. (2006) Metabotropic Glutamate Receptors. Cell Tissue Res. 326, 483-504.

  50. Francesconi, A., Kumari, R., and Zukin, R. S. (2009) Regulation of Group I Metabotropic Glutamate Receptor Trafficking and Signaling by the caveolar/lipid Raft Pathway. J Neurosci. 29, 3590-3602.

  51. Roh, S. E., Hong, Y. H., Jang, D. C., Kim, J., and Kim, S. J. (2014) Lipid Rafts Serve as Signaling Platforms for mGlu1 Receptor-Mediated Calcium Signaling in Association with Caveolin. Mol Brain. 7, 9-6606-7-9.

  52. Rousseaux, C. G. (2008) A Review of Glutamate Receptors I: Current Understanding of their Biology. J Toxicol Pathol. 21, 25-51.

  53. Hermans, E., and Challiss, R. A. (2001) Structural, Signalling and Regulatory Properties of the Group I Metabotropic Glutamate Receptors: Prototypic Family C G-Protein-Coupled Receptors. Biochem J. 359, 465-484.

  54. Chavis, P., Fagni, L., Lansman, J. B., and Bockaert, J. (1996) Functional Coupling between Ryanodine Receptors and L-Type Calcium Channels in Neurons. Nature. 382, 719-722.

  55. Fagni, L., Chavis, P., Ango, F., and Bockaert, J. (2000) Complex Interactions between mGluRs, Intracellular Ca2+ Stores and Ion Channels in Neurons. Trends Neurosci. 23, 80-88.

  56. Guerineau, N. C., Bossu, J. L., Gahwiler, B. H., and Gerber, U. (1995) Activation of a Nonselective Cationic Conductance by Metabotropic Glutamatergic and Muscarinic Agonists in CA3 Pyramidal Neurons of the Rat Hippocampus. J Neurosci. 15, 4395-4407.

  57. Guerineau, N. C., Gahwiler, B. H., and Gerber, U. (1994) Reduction of Resting K+ Current by Metabotropic Glutamate and Muscarinic Receptors in Rat CA3 Cells: Mediation by G-Proteins. J Physiol. 474, 27-33.

  58. Swartz, K. J., and Bean, B. P. (1992) Inhibition of Calcium Channels in Rat CA3 Pyramidal Neurons by a Metabotropic Glutamate Receptor. J Neurosci. 12, 4358-4371.

  59. Cartmell, J., and Schoepp, D. D. (2000) Regulation of Neurotransmitter Release by Metabotropic Glutamate Receptors. J Neurochem. 75, 889-907.

  60. Ran, I., Laplante, I., Bourgeois, C., Pepin, J., Lacaille, P., Costa-Mattioli, M., Pelletier, J., Sonenberg, N., and Lacaille, J. C. (2009) Persistent Transcription- and Translation-Dependent Long-Term Potentiation Induced by mGluR1 in Hippocampal Interneurons. J Neurosci. 29, 5605-5615.

  61. Richter-Levin, G., Errington, M. L., Maegawa, H., and Bliss, T. V. (1994) Activation of Metabotropic Glutamate Receptors is Necessary for Long-Term Potentiation in the Dentate Gyrus and for Spatial Learning. Neuropharmacology. 33, 853-857.

  62. Bortolotto, Z. A., Bashir, Z. I., Davies, C. H., and Collingridge, G. L. (1994) A Molecular Switch Activated by Metabotropic Glutamate Receptors Regulates Induction of Long-Term Potentiation. Nature. 368, 740-743.

  63. Bolshakov, V. Y., and Siegelbaum, S. A. (1994) Postsynaptic Induction and Presynaptic Expression of Hippocampal Long-Term Depression. Science. 264, 1148-1152.

  64. Daniel, H., Hemart, N., Jaillard, D., and Crepel, F. (1992) Coactivation of Metabotropic Glutamate Receptors and of Voltage-Gated Calcium Channels Induces Long-Term Depression in Cerebellar Purkinje Cells in Vitro. Exp Brain Res. 90, 327-331.

  65. Ito, M., and Karachot, L. (1990) Receptor Subtypes Involved in, and Time Course of, the Long-Term Desensitization of Glutamate Receptors in Cerebellar Purkinje Cells. Neurosci Res. 8, 303-307.

  66. Linden, D. J. (1994) Long-Term Synaptic Depression in the Mammalian Brain. Neuron. 12, 457-472.

  67. Conquet, F., Bashir, Z. I., Davies, C. H., Daniel, H., Ferraguti, F., Bordi, F., Franz-Bacon, K., Reggiani, A., Matarese, V., and Conde, F. (1994) Motor Deficit and Impairment of Synaptic Plasticity in Mice Lacking mGluR1. Nature. 372, 237-243.

  68. Catania, M. V., D'Antoni, S., Bonaccorso, C. M., Aronica, E., Bear, M. F., and Nicoletti, F. (2007) Group I Metabotropic Glutamate Receptors: A Role in Neurodevelopmental Disorders? Mol Neurobiol. 35, 298-307.

  69. Musante, V., Neri, E., Feligioni, M., Puliti, A., Pedrazzi, M., Conti, V., Usai, C., Diaspro, A., Ravazzolo, R., Henley, J. M., Battaglia, G., and Pittaluga, A. (2008) Presynaptic mGlu1 and mGlu5 Autoreceptors Facilitate Glutamate Exocytosis from Mouse Cortical Nerve Endings. Neuropharmacology. 55, 474-482.

  70. Wettschureck, N., and Offermanns, S. (2005) Mammalian G Proteins and their Cell Type Specific Functions. Physiol Rev. 85, 1159-1204.

  71. Hermans, E., Young, K. W., Challiss, R. A., and Nahorski, S. R. (1998) Effects of Human Type 1alpha Metabotropic Glutamate Receptor Expression Level on Phosphoinositide and Ca2+ Signalling in an Inducible Cell Expression System. J Neurochem. 70, 1772-1775.

  72. Tabata, T., and Kano, M. (2004) Calcium Dependence of Native Metabotropic Glutamate Receptor Signaling in Central Neurons. Mol Neurobiol. 29, 261-270.

  73. Shinohara, Y., Nakajima, Y., and Nakanishi, S. (2001) Glutamate Induces Focal Adhesion Kinase Tyrosine Phosphorylation and Actin Rearrangement in Heterologous mGluR1-Expressing CHO Cells Via calcium/calmodulin Signaling. J Neurochem. 78, 365-373.

  74. Thandi, S., Blank, J. L., and Challiss, R. A. (2002) Group-I Metabotropic Glutamate Receptors, mGlu1a and mGlu5a, Couple to Extracellular Signal-Regulated Kinase (ERK) Activation Via Distinct, but Overlapping, Signalling Pathways. J Neurochem. 83, 1139-1153.

  75. Ferraguti, F., Baldani-Guerra, B., Corsi, M., Nakanishi, S., and Corti, C. (1999) Activation of the Extracellular Signal-Regulated Kinase 2 by Metabotropic Glutamate Receptors. Eur J Neurosci. 11, 2073-2082.

  76. Karim, F., Wang, C. C., and Gereau, R. W.,4th. (2001) Metabotropic Glutamate Receptor Subtypes 1 and 5 are Activators of Extracellular Signal-Regulated Kinase Signaling Required for Inflammatory Pain in Mice. J Neurosci. 21, 3771-3779.

  77. Rong, R., Ahn, J. Y., Huang, H., Nagata, E., Kalman, D., Kapp, J. A., Tu, J., Worley, P. F., Snyder, S. H., and Ye, K. (2003) PI3 Kinase Enhancer-Homer Complex Couples mGluRI to PI3 Kinase, Preventing Neuronal Apoptosis. Nat Neurosci. 6, 1153-1161.

  78. Hou, L., and Klann, E. (2004) Activation of the Phosphoinositide 3-Kinase-Akt-Mammalian Target of Rapamycin Signaling Pathway is Required for Metabotropic Glutamate Receptor-Dependent Long-Term Depression. J Neurosci. 24, 6352-6361.

  79. Allen, J. W., Knoblach, S. M., and Faden, A. I. (2000) Activation of Group I Metabotropic Glutamate Receptors Reduces Neuronal Apoptosis but Increases Necrotic Cell Death in Vitro. Cell Death Differ. 7, 470-476.

  80. Chong, Z. Z., Kang, J. Q., and Maiese, K. (2003) Metabotropic Glutamate Receptors Promote Neuronal and Vascular Plasticity through Novel Intracellular Pathways. Histol Histopathol. 18, 173-189.

  81. Pshenichkin, S., Dolinska, M., Klauzinska, M., Luchenko, V., Grajkowska, E., and Wroblewski, J. T. (2008) Dual Neurotoxic and Neuroprotective Role of Metabotropic Glutamate Receptor 1 in Conditions of Trophic Deprivation - Possible Role as a Dependence Receptor. Neuropharmacology. 55, 500-508.

  82. Schelman, W. R., Andres, R. D., Sipe, K. J., Kang, E., and Weyhenmeyer, J. A. (2004) Glutamate Mediates Cell Death and Increases the Bax to Bcl-2 Ratio in a Differentiated Neuronal Cell Line. Brain Res Mol Brain Res. 128, 160-169.

  83. Heuss, C., Scanziani, M., Gahwiler, B. H., and Gerber, U. (1999) G-Protein-Independent Signaling Mediated by Metabotropic Glutamate Receptors. Nat Neurosci. 2, 1070-1077.

  84. Parmentier, M. L., Joly, C., Restituito, S., Bockaert, J., Grau, Y., and Pin, J. P. (1998) The G Protein-Coupling Profile of Metabotropic Glutamate Receptors, as Determined with Exogenous G Proteins, is Independent of their Ligand Recognition Domain. Mol Pharmacol. 53, 778-786.

  85. Thomsen, C. (1996) Metabotropic Glutamate Receptor Subtype 1A Activates Adenylate Cyclase when Expressed in Baby Hamster Kidney Cells. Prog Neuropsychopharmacol Biol Psychiatry. 20, 709-726.

  86. Hiltscher, R., Seuwen, K., Boddeke, H. W., Sommer, B., and Laurie, D. J. (1998) Functional Coupling of Human Metabotropic Glutamate Receptor hmGlu1d: Comparison to Splice Variants hmGlu1a and -1b. Neuropharmacology. 37, 827-837.

  87. Schoepp, D. D., and Conn, P. J. (1993) Metabotropic Glutamate Receptors in Brain Function and Pathology. Trends Pharmacol Sci. 14, 13-20.

  88. Sacaan, A. I., and Schoepp, D. D. (1992) Activation of Hippocampal Metabotropic Excitatory Amino Acid Receptors Leads to Seizures and Neuronal Damage. Neurosci Lett. 139, 77-82.

  89. Sillevis Smitt, P., Kinoshita, A., De Leeuw, B., Moll, W., Coesmans, M., Jaarsma, D., Henzen-Logmans, S., Vecht, C., De Zeeuw, C., Sekiyama, N., Nakanishi, S., and Shigemoto, R. (2000) Paraneoplastic Cerebellar Ataxia due to Autoantibodies Against a Glutamate Receptor. N Engl J Med. 342, 21-27.

  90. Guergueltcheva, V., Azmanov, D. N., Angelicheva, D., Smith, K. R., Chamova, T., Florez, L., Bynevelt, M., Nguyen, T., Cherninkova, S., Bojinova, V., Kaprelyan, A., Angelova, L., Morar, B., Chandler, D., Kaneva, R., Bahlo, M., Tournev, I., and Kalaydjieva, L. (2012) Autosomal-Recessive Congenital Cerebellar Ataxia is Caused by Mutations in Metabotropic Glutamate Receptor 1. Am J Hum Genet. 91, 553-564.

  91. Ohtani, Y., Harada, T., Funasaka, Y., Nakao, K., Takahara, C., Abdel-Daim, M., Sakai, N., Saito, N., Nishigori, C., and Aiba, A. (2008) Metabotropic Glutamate Receptor Subtype-1 is Essential for in Vivo Growth of Melanoma. Oncogene. 27, 7162-7170.

  92. Aiba, A., Chen, C., Herrup, K., Rosenmund, C., Stevens, C. F., and Tonegawa, S. (1994) Reduced Hippocampal Long-Term Potentiation and Context-Specific Deficit in Associative Learning in mGluR1 Mutant Mice. Cell. 79, 365-375.

  93. Aiba, A., Kano, M., Chen, C., Stanton, M. E., Fox, G. D., Herrup, K., Zwingman, T. A., and Tonegawa, S. (1994) Deficient Cerebellar Long-Term Depression and Impaired Motor Learning in mGluR1 Mutant Mice. Cell. 79, 377-388.

  94. Sachs, A. J., Schwendinger, J. K., Yang, A. W., Haider, N. B., and Nystuen, A. M. (2007) The Mouse Mutants Recoil Wobbler and nmf373 Represent a Series of Grm1 Mutations. Mamm Genome. 18, 749-756.

  95. Conti, V., Aghaie, A., Cilli, M., Martin, N., Caridi, G., Musante, L., Candiano, G., Castagna, M., Fairen, A., Ravazzolo, R., Guenet, J. L., and Puliti, A. (2006) Crv4, a Mouse Model for Human Ataxia Associated with Kyphoscoliosis Caused by an mRNA Splicing Mutation of the Metabotropic Glutamate Receptor 1 (Grm1). Int J Mol Med. 18, 593-600.

  96. Nakao, H., Nakao, K., Kano, M., and Aiba, A. (2007) Metabotropic Glutamate Receptor Subtype-1 is Essential for Motor Coordination in the Adult Cerebellum. Neurosci Res. 57, 538-543.