Phenotypic Mutation 'charbon'

• Allele: charbon
• Mutation Type: missense
• Chromosome: 7
• Coordinate: 56,316,405 bp (GRCm38)
• Base Change: A ⇒ G (forward strand)
• Gene: Oca2
• Gene Name: oculocutaneous albinism II
• Synonym(s): D7H15S12, p, D7H15S12
• Chromosomal Location: 56,239,760-56,536,517 bp (+)
• MGI Phenotype: Mutations generally result in varying degrees of coat and eye pigment dilution. Specific alleles produce cleft palate, reproductive, endocrine or neurological disorders, and/or lethality.
• Mapped: Yes
• Amino Acid Change: Threonine changed to Alanine
• Institutional Source: Beutler Lab
• Ref Sequences:
  T382A in Ensembl: ENSMUSP00000032633
• Gene Model: not available
• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.40; Specificity: 0.98)
  (Using Ensembl: ENSMUSP00000032633)
• Phenotypic Category: pigmentation, skin/coat/nails
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• Last Updated: 01/05/2017 2:02 PM by Katherine Timer
• Record Created: unknown
• Record Posted: 04/10/2008
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Celine Eidenschenk, Sophie Rutschmann, Bruce Beutler

Accession Number

NCBI RefSeq: NM_021879; MGI: 97454

Alleles Listed at MGI

All alleles(66) : Gene trapped(1) Spontaneous(19) Chemically induced(7) Radiation induced(39)

Repository

none

Phenotypic Description

The charbon mutation was induced by an N-ethyl-N-nitrosourea (ENU)-mutagenesis on a C57BL/6J (black) background. Charbon is a strictly recessive phenotype with hypopigmented fur and ocular albinism, similar to the phenotype created by mutations at the Oca2 or p (pink-eyed dilution) locus.  Mutations at Oca2 are known to cause a reduction of eumelanin (black-brown) pigment and altered morphology of black pigment granules (eumelanosomes), but have little effect on pheomelanin (yellow-red) pigment (1;2).

 

Immune system function is largely normal in charbon mutants.  Charbon mice, like allelic quicksilver and snowflake mice, display normal resistance to murine cytomegalovirus (MCMV) (MCMV Susceptibility and Resistance Screen).  Charbon mutants are slightly susceptible to infection by Listeria monocytogenes, showing a 75% survival rate compared with 100% survival in wild type controls.  However, they produce normal amounts of cytokines in response to Listeria infection and clear infection from the liver as well as wild type mice.  In vitro, NK cells from charbon mice degranulate normally upon stimulation of Ly49H or NKp46 receptors, PMA ionomycin treatment, or upon exposure to YAC-1 cells.  IFN-γ production after PMA ionomycin stimulation is also normal. The pigmentation phenotype for charbon mice is very similar to quicksilver mutants.

 

Nature of Mutation

The charbon mutation mapped to Chromosome 7, and corresponds to an A to G transition at position 1274 of the Oca2 transcript, in exon 11 of 24 total exons.

 

1259 TGGATTGATTTCGAGACTCTGGCCCTGCTGTTT

377  -W--I--D--F--E--T--L--A--L--L--F-

 

The mutated nucleotide is indicated in red lettering and results in a threonine to alanine change at amino acid 382 in the OCA2 protein.

Protein Prediction

 

The charbon mutation occurs in the fourth transmembrane domain of the OCA2 protein (Figure 1).  It is unknown whether normal levels of the altered OCA2 protein exist in charbon mice or whether the protein is localized appropriately.

 

Please see the record for quicksilver for information about Oca2.

Putative Mechanism

The charbon mutation results in a T382A change in the fourth transmembrane region of the OCA2 protein.  This region is well-conserved between the mouse and human proteins as well as in related bacterial transporters.  The change from polar threonine to nonpolar alanine may disrupt the structure of this transmembrane domain, but the effect on the structure of the protein is unknown.  Threonine can undergo post-translational modifications such as phosphorylation and O-linked glycosylation, but whether this occurs at T382 in the OCA2 protein has not been tested.  Human mutations in the same region cause oculocutaneous albinism.

 

For a further explanation of the charbon mutant phenotype, please refer to the record for quicksilver.

Primers

Primers cannot be located by automatic search.

Genotyping

Charbon genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

Char(F): 5’-GGCTGGAGTGAGATTGCCTCTGATA-3’

Char(R): 5’-TGCCAACTTTTGGAAATAATGATGCCAC-3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Char_seq(F): 5’- CAGGCAATAATTCTTCCTGGAGC-3’

Char_seq(R): 5’- GCCACTTCATTGTTCAAAAGC-3’

 

The following sequence of 1309 nucleotides (from Genbank genomic region NC_000073 for linear DNA sequence of Oca2) is amplified:

 

75599                                                                gg

75601 ctggagtgag attgcctctg atatatttta taaagctaat ggtatgtttc atacagagga

75661 gtatggtgtg gagggatgga ggacctcagc aggcccaggt tgaggcatct ctcccctgag

75721 gtatcagcca tactaagggt ctagtataga atagagttag ttaggggatg ggaaggggag

75781 ttgagaaggg agtagaggca gagaaagaga gggatcagag gacagagaga gatagagaaa

75841 ggagaaagaa gaggctggct gggaacacat gagggaggag agaaagggaa agagaggaga

75901 gagagagaga gagagagaga gagagagaga gagagagaga gagagagaga gaagagtcag

75961 agtgacaaaa gggtcagaga gaggaaagag aagccaaaca gtccctttta tagacagtca

76021 ggcctatctg ctattgctaa gtaactttgg cagagcctag aaggaatgct aacacgctaa

76081 cagcctccga gtctctgagt catgcacttg ttctcatgag tatggttcac ataatgtttc

76141 atttggaaaa ttgctcttat ggcatatagt aggcacatgc atcaagaagc ccccagggta

76201 ctcagtgaac tgccctttcc gaggcaggct cggttctggc agtccctcac ttcacacttt

76261 gttctagtgg cacttggaga gtagaataga gagtgtcaat catgccaccc cactgaggaa

76321 gaccaaacca gcagtccagg caataattct tcctggagct tccaggatta gatcccctcc

76381 cttttgttca tgaatacttt ggatgtgaca gattcactgg gtcatgagtg taattcagca

76441 gtgtgataga attcaacttc aaaggcaagt ggatgcagtg tttccagctt tggcccaatg

76501 tctgcgcttg cagtaagggc agcccatttt tagagctttg ctcagtaggt tgatgcacag

76561 gattaattgg caaatttgtg ctttgattac agagacccag cctgacccac gtggtggagt

76621 ggattgattt cgagactctg gccctgctgt ttggcatggt aattacagtc ttcccagcag

76681 gatatggctc caagtctggg tccttcacta tcccacagtt gctgatccta tcattatagt

76741 caagatggca tatctcttga cagttagggc tttattgaga agtgttaata caggtctagt

76801 tattttctca gggaggaggg actggctggt gctggtttgt taactaaaga cttcatctct

76861 aaggcttttg aacaatgaag tggcatcatt atttccaaaa gttggca

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.

References

   1.  Rinchik, E. M., Bultman, S. J., Horsthemke, B., Lee, S. T., Strunk, K. M., Spritz, R. A., Avidano, K. M., Jong, M. T., and Nicholls, R. D. (1993) A gene for the mouse pink-eyed dilution locus and for human type II oculocutaneous albinism, Nature 361, 72-76.

   2.  Russell, E. S. (1949) A quantitative histological study of the pigment found in the coat-color mutants of the house mouse. IV. The nature of the effects of genic substitution in five major allelic series, Genetics 34, 146-166.