Allele | eatsy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | nonsense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 12 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 84,429,069 bp (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | G ⇒ A (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Entpd5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | ectonucleoside triphosphate diphosphohydrolase 5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Pcph, NTPDase-5, mNTPase, ER-UDPase, NTPDase5, Cd39l4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 84,420,649-84,455,803 bp (-) (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to E-type nucleotidases (NTPases)/ecto-ATPase/apyrases. NTPases, such as CD39, mediate catabolism of extracellular nucleotides. ENTPD5 contains 4 apyrase-conserved regions which is characteristic of NTPases. [provided by RefSeq, Jan 2009] PHENOTYPE: Mice homozygous for a null allele develop progressive hepatopathy, hepatocellular tumors, and spermatogenic arrest. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_007647 (variant 1), NM_001026214 (variant 2), NM_001286049 (variant 3), NM_001286058 (variant 4); MGI:1321385 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Arginine changed to Stop codon | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000021662] [ENSMUSP00000071939] [ENSMUSP00000105901] [ENSMUSP00000114011] [ENSMUSP00000112516] [ENSMUSP00000113106] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q9WUZ9 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000021662 Gene: ENSMUSG00000021236 AA Change: R321*
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000071939 Gene: ENSMUSG00000021236 AA Change: R346*
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000105901 Gene: ENSMUSG00000021236 AA Change: R321*
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000114011 Gene: ENSMUSG00000021236 AA Change: R321*
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000112516 Gene: ENSMUSG00000021236 AA Change: R321*
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000113106 Gene: ENSMUSG00000021236 AA Change: R321*
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.9755 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(6) : Chemically induced (other)(1) Targeted(5) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Live Mice, Sperm, gDNA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2022-04-12 3:40 PM by External Program | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2014-12-09 2:41 PM by Jeff SoRelle | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2016-10-28 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The eatsy phenotype was identified among G3 mice of the pedigree R1536, some of which showed reduced body weights compared to wild-type control littermates (Figure 1). Some mice showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 (Figure 2) and 10 (Figure 3) days post-DSS treatment. Some mice also showed increased frequencies of B1 cells in the peripheral blood (Figure 4). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. All of the above phenotypes were linked to a mutation in Entpd5: a C to T transition at base pair 84,382,295 (v38) on chromosome 12, corresponding to base pair 26,735 in the GenBank genomic region NC_000078 encoding Entpd5. The strongest association was found with a recessive model of inheritance (P = 6.479 x 10-5) to the body weight phenotype, wherein five variant homozygotes departed phenotypically from 15 homozygous reference mice and 18 heterozygous mice (Figure 5). The mutation corresponds to residue 1,157 in the NM_007647 (variant 1) mRNA sequence in exon 11 of 14 total exons, residue 1,230 in the NM_001026214 (variant 2) mRNA sequence in exon 13 out of 16 total exons, residue 1,205 in the NM_001286049 (variant 3) mRNA sequence in exon 12 out of 15 total exons, and residue 1,132 in the NM_001286058 mRNA sequence in exon 11 out of 14 total exons.
Genomic numbering corresponds to NC_000078. The mutated nucleotide is indicated in red. The mutation results in substitution of arginine 346 to a premature stop codon (R346*) in isoform A of the ENTPD5 protein, and substitution of arginine 316 to a premature stop codon in isoform B of the ENTPD5 protein. The causative mutation in Entpd5 was confirmed by CRISPR/Cas9-mediated targeting of Entpd5 (Table 1). Table 1. CRISPR Screen Data
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Entpd5 encodes ectonucleoside triphosphate diphosphohydrolase 5 (ENTPD5; alternatively, ER-UDPase or CD39-like 4 [CD39L4]), a divalent cation-dependent glycoprotein. ENTPD5 is a member of the ecto-apyrase gene family of nucleoside triphosphatases (NTPases) that also consists of CD39, CD39-L1, CD39-L2, and CD39-L3. The ecto-apyrase family can be subdivided into two groups based on the structural domains of the proteins. CD39, CD39-L1, and CD39-L3 have one transmembrane domain at both the N- and C-termini, while CD39-L2 and ENTPD5 have hydrophobic portions at their N-termini indicating that they may be secreted (Figure 3) (1). NTPases have four apyrase [nucleotide triphosphate diphosphohydrolase (NTPDase)]-conserved regions (ACRs) near the N-terminus. In mouse ENTPD5 isoform A, ACR I corresponds to amino acids 78-85, ACR II to amino acids 148-158, ACR III to amino acids 193-205, and ACR IV to amino acids 223-230 (2). In mouse ENTPD5 isoform B, ACR I corresponds to amino acids 53-60, ACR II to amino acids 123-133, ACR III to amino acids 168-179, and ACR IV to amino acids 198-205 (2). ACR I and ACR IV are important for nucleotide binding, and each contain a DXG motif that is involved in substrate recognition and binding. ENTPD5 also has one putative N-terminal transmembrane domain and a large extracellular C-terminal domain. ENTPD5 requires binding of divalent cations (Mg2+ or Ca2+) for its activity (3). Entpd5 is alternatively spliced to generate four different mRNAs. One mRNA generates isoform A, while the other three mRNAs generate the same peptide, isoform B. Isoforms A and B differ at the N-terminus due to differences within the 5’ UTR; amino acids 1-25 of isoform A are unique from isoform B. Isoform B has a signal peptide at amino acids 1-24 that can be cleaved. Cleavage of the signal peptide facilitates release of a soluble form of the enzyme into the extracellular space. The Entpd5 mutation in eatsy results in substitution of arginine 346 to a premature stop codon (R346*) in isoform A and substitution of arginine 316 to a premature stop codon (R316*) in isoform B of the ENTPD5 protein. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | Entpd5 is ubiquitously expressed, and is highly expressed in the liver, kidney, prostate, testis, and colon (2). ENTPD5 localizes to the endoplasmic reticulum, and can also be secreted (1). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
The levels of extracellular and intraorganellar nucleotides are regulated by ENTPDs. NTPases hydrolyze extracellular nucleoside tri- and/or diphosphates. Tri-, di-, and monophosphates (NTPs, NDPs, and NMPs, respectively) have several functions in the cell. They are the building blocks of DNA and RNA, but also function as energy sources, in neurotransmission, cardiac function, platelet aggregation, muscle contraction and relaxation, vascular tone, secretion of hormones, immune responses, cell growth, protein folding, and cell signaling [reviewed in (4)]. Nucleotides regulate intracellular signaling mostly through G-protein–coupled P2 cell membrane receptors (P2Xn, P2Yn, and P2T) (5), which promote cell metabolism, adhesion, activation, development, proliferation, differentiation, and apoptosis (6). ATP and ADP are the main ligands of P2 receptors. Activation of P2X receptors results in Na+ and Ca2+ influx and K+ efflux across the cell membrane, which leads to depolarization of the plasma membrane and an increase in the concentration of intracellular Na+ and Ca2+. Membrane depolarization can in turn activate voltage-gated channels, causing firing of action potentials. P2Y receptors activate several secondary messenger transduction pathways including the activation of phospholipase C (PLC), inhibition and stimulation of adenylyl cyclase and direct modulation of ion channel function. ENTPD5 putatively promotes protein glycosylation with UDP-sugars in rat hepatocytes. In the endoplasmic reticulum, proteins bind and are monoglycosylated by UDP-glucose:glycoprotein glucosyltransferase, subsequently promoting binding to ER chaperones calnexin or calreticulin and protein folding (Figure 7). The folded protein is released by hydrolysis of the bound glucose. Several rounds of glycosylation/deglycosylation may be necessary to fold complex proteins. Each round of glycosylation/deglycosylation generates a molecule of UDP. ENTPD5 hydrolyzes purine nucleoside diphosphates UDP and GDP to UMP and GMP, respectively. The UMP is transported from the ER lumen to the cytoplasm in exchange for nucleotide sugars, preventing end product inhibition and promoting reactant importation. Phosphatidylinositol 3-kinases (PI3Ks) and the phosphatase PTEN balance cell growth and survival signals. Upon activation of receptor tyrosine kinases, PI3K phosphorylates phosphatidylinositol 4,5-bisphosphate (PIP2) to generate phosphatidylinositol 3,4,5-trisphosphate (PIP3) that recruits and activates serine/threonine kinase AKT. AKT activates many downstream cell growth and survival targets, including the rapamycin-sensitive mTOR complex 1 (mTORC1). PTEN dephosphorylates PIP3 back to PIP2, antagonizing the signal generated by PI3K. ENTPD5 is upregulated in cell lines and tumor samples with active AKT (7). ENTPD5 functions with cytidine monophosphate kinase-1 (CMPK1) and adenylate kinase 1 (AK1) to form an ATP hydrolysis cycle to convert ATP to AMP, leading to an increase in aerobic glycolysis (i.e., Warburg effect) (7). ENTPD5 is identical to PCPH, a proto-oncogene that is dysregulated in some human cancers, including lung cancer (8), glioblastoma multiforme (9), prostate cancer (10;11). Overexpression of normal ENTPD5/PCPH proto-oncogene and the ENTPD5/mt-PCPH oncogene both promote malignant transformation (12). mt-PCPH has a single base pair deletion in the open reading frame resulting in a frameshift and coding of a premature stop codon (12). The transforming effects are shared by PCPH and mt-PCPH, but the effects resulting from mt-PCPH are much greater compared to PCPH (12). In lung cancer, knockdown of ENTPD5 resulted in reduced lung cancer cell growth, increased apoptosis, and reduced invasion as well as increased caspase expression compared to normal tissue (8). Knockdown of Entpd5 in vitro resulted in induction of ER stress markers, BiP and CHOP as well as increased expression of the spliced form of Xbp1 (13). Entpd5-deficient (Entpd5-/-) mice were born at the expected Mendelian ratio, and appeared normal at birth. However, the Entpd5-/- mice grew more slowly and displayed stunted growth at one year of age. In the serum, the Entpd5-/- mice had increased levels of alanine aminotransferase (ALT), alkaline phosphatase, and bilirubin with concomitant reduced levels of albumin, glucose, cholesterol, and triglycerides. Entpd5-/- mice exhibited hepatopathy characterized by hepatocyte degeneration by 14 to 22 weeks of age, degenerative lesions, hepatocellular neoplasia (i.e., hepatocellular carcinoma, hepatocellular adenoma, or both), centrilobular hepatocyte hypertorophy by 14 to 20 weeks of age, and oval cell proliferation by 45 to 62 weeks of age. Male Entpd5-/- mice also exhibited a failure to produce semen (4). The increased hepatocellular turnover in the Entpd5-/- mice is proposed to be due to loss of NDP degradation in the ER or in the extracellular space. In addition loss of ENTPD5 in the ER could lead to inhibition of UDP inhibition-mediated protein glycosylation. In addition, the increased rate of hepatocyte turnover may be due to loss of extracellular nucleotide signaling. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | The reduced body size/weight of the eatsy mice mimics that of Entpd5-/- mice, indicating that ENTPD5eatsy exhibits loss of function. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer eatsy_pcr_F: TCTACTGGGAAAGAACTGGGAAGCC eatsy_pcr_R: TCAGATTGCCCTGCTGTTTCAGAG Sequencing Primer eatsy_seq_F: TGGGAAGCCACTGCAAC eatsy_seq_R: ACTGCTGCTCAGAGGCTAAG |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 461 nucleotides is amplified (chromosome 12, - strand): 1 tcagattgcc ctgctgtttc agagctccgc ccccaccttg ctgtgagggt acctcagcca Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Katherine Timer | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Zhe Chen, Jeff SoRelle, William McAlpine, Jianhui Wang, and Bruce Beutler |