Phenotypic Mutation 'kringle' (pdf version)
List |< first << previous [record 13 of 30] next >> last >|
Allelekringle
Mutation Type missense
Chromosome1
Coordinate134,747,620 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Syt2
Gene Name synaptotagmin II
Chromosomal Location 134,646,677-134,762,593 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in this gene are associated with myasthenic syndrome, presynaptic, congenital, with or without motor neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele are viable but sterile, weigh less and show ataxia and altered spontaneous and Ca2+-evoked neurotransmitter release. Mice homozygous for a null allele die at weaning showing growth arrest, motor dysfunction and impaired Ca2+-evoked neurotransmitter release. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009307; MGI:99666

Mapped Yes 
Amino Acid Change Alanine changed to Aspartic acid
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000112438] [ENSMUSP00000140081]
SMART Domains Protein: ENSMUSP00000112438
Gene: ENSMUSG00000026452
AA Change: A403D

DomainStartEndE-ValueType
PDB:4KBB|D 5 63 7e-16 PDB
transmembrane domain 65 87 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
C2 158 260 7.21e-22 SMART
C2 289 403 1.86e-24 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
(Using ENSMUST00000121990)
SMART Domains Protein: ENSMUSP00000140081
Gene: ENSMUSG00000026452
AA Change: A403D

DomainStartEndE-ValueType
PDB:4KBB|D 5 63 7e-16 PDB
transmembrane domain 65 87 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
C2 158 260 7.21e-22 SMART
C2 289 403 1.86e-24 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
(Using ENSMUST00000188842)
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological 16642042
Body Weight - decreased 16642042 17192432
growth/size
lethality-postnatal
nervous system
Penetrance  
Alleles Listed at MGI

All mutations/alleles(8) : Chemically induced (other)(1) Gene trapped(2) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02385:Syt2 APN 1 134745815 missense probably benign 0.07
IGL02476:Syt2 APN 1 134747631 missense probably benign 0.01
IGL02487:Syt2 APN 1 134740865 missense probably damaging 0.99
IGL02524:Syt2 APN 1 134741965 missense probably benign
IGL02611:Syt2 APN 1 134741882 missense possibly damaging 0.90
IGL03173:Syt2 APN 1 134743579 missense possibly damaging 0.81
IGL03303:Syt2 APN 1 134741911 missense probably benign 0.44
R1661:Syt2 UTSW 1 134747620 missense probably damaging 1.00
R1665:Syt2 UTSW 1 134747620 missense probably damaging 1.00
R2049:Syt2 UTSW 1 134746741 splice site probably benign
R2130:Syt2 UTSW 1 134746741 splice site probably benign
R2141:Syt2 UTSW 1 134746741 splice site probably benign
R3154:Syt2 UTSW 1 134741861 missense possibly damaging 0.95
R5392:Syt2 UTSW 1 134744021 missense probably damaging 1.00
R5431:Syt2 UTSW 1 134740957 missense probably benign 0.03
R6065:Syt2 UTSW 1 134747557 missense probably benign 0.00
R6381:Syt2 UTSW 1 134746850 missense probably damaging 1.00
R6816:Syt2 UTSW 1 134745800 missense probably damaging 1.00
R6923:Syt2 UTSW 1 134746763 missense possibly damaging 0.76
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm, gDNA
MMRRC Submission 038212-MU
Last Updated 2018-05-22 9:35 AM by Anne Murray
Record Created 2014-12-12 11:01 AM by Jeff SoRelle
Record Posted 2015-08-24
Phenotypic Description
Figure 1. The kringle phenotype.

The kringle phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1665, some of which exhibited an ataxic, broad-based gait and an accompanying tremor (Figure 1).

 

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 86 mutations. Among these, only one affected a gene with known effects on the nervous system, Syt2. The mutation in Syt2 was presumed to be causative because the kringle ataxia phenotype mimics other known alleles of Syt2 (see MGI for a list of Syt2 alleles). The Syt2 mutation is a C to A transversion at base pair 134,747,620 (v38) on chromosome 1, or base pair 101,057 in the GenBank genomic region NC_000067. The mutation corresponds to residue 1,589 in the mRNA sequence NM_009307 within exon 10 of 10 total exons.

 

1573 CCTCGGAGGCCCATTGCCCAGTGGCACTCTCTT

398  -P--R--R--P--I--A--Q--W--H--S--L-

 

The mutated nucleotide is indicated in red.  The mutation results in an alanine (A) to aspartic acid (D) substitution at position 403 (A403D) in the synaptotagmin 2 (Syt2) protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 0.998) (1).

 

Protein Prediction
Figure 2. Domain structure and orientation of Syt2 in the vesicle membrane. The sequence of images depicts a cross-section of two Syt dimers during the transit from the docked and primed state. In all panels, the plasma membrane is pink, and the vesicle membrane is depicted as blue. (A) In the primed state, the membrane spanning domains of the Syt dimers are in close proximity to the vesicle–plasma membrane contact. The palmitoylated cysteine region (orange) serves as a bridge to the juxtamembrane polybasic region (beige) which associates with the vesicle membrane, while the C2 domains project into the cytosol. (B) Upon Ca2+ binding to the C2 domains, the C2 domains insert into the plasma membrane and the juxtamembrane polybasic region dissociates from the vesicle membrane and associates with the plasma membrane. (C) The movement of the Syt dimers shown in B is proposed to induce a lateral movement and pivoting of the Syt dimers. This pivoting of the membrane-spanning domains induces an outward dimpling of the vesicle's inner hemibilayer and an inward folding of the plasma membrane. (D) The rotation of the Syt membrane-spanning domains triggers a further outward bending of the vesicle membrane and an inward flexion of plasma membrane. The luminal domain of each Syt molecule transiently contributes to the wall of the fusion pore, as the release of the bending energy in the vesicular membrane begins to drive the completion of the exocytotic process in panels E and F. As the Syt transmembrane domains continue to rotate toward the extracellular space, they will begin to fold back on the polypeptide backbone of the palmitoylated cysteine region. (E) The continued rotation of the Syt dimers propels the luminal domains into the extracellular space as the nascent fusion pore begins to expand. (F) Compared to panel A, the Syt dimers have rotated 180° relative to the membrane axes. At the same time, the membrane spanning domains have swiveled 180°. The final transition to full fusion is for the palmitoylated cysteine domain to revert back to its inter-lamella position. (G) Fusion of the vesicular and plasma membranes is complete. The C2 domains of the Syts are shown having dissociated from the plasma membrane (subsequent to the dissociation of Ca2+), while the palmitoylated cysteine region has reverted from its interfacial location to the membrane interior. This figure and legend was adapted from Gundersen, C.B. and Umbach, J.A. (2013) 332:146-160.

Syt2 is a member of the synaptotagmin family of synaptic vesicle proteins. The synaptotagmins share similar domain organizations including an intraluminal/vesicular region, a single N-terminal transmembrane domain that anchors the protein to the vesicle membrane, a variable linker, and two tandem C-terminal C2 domains (C2A and C2B) [Figure 2; (2)].

 

The linker sequence contains 13 lysine residues in the first 28 amino acids (juxtamembrane polybasic peptide), followed by 11 aspartic and glutamic acids in the subsequent 23 amino acids. In Syt1, this sequence mediates dimerization (3); a similar role is proposed for Syt2.  The linker sequence is essential for binding the cytosolic layer of the presynaptic membrane at rest (4). Binding of Syt2 to the plasma membrane facilitates the formation of a “hemi-fusion” intermediate that mediates rapid vesicle fusion.

 

C2 domains are internal repeats of 130-140 amino acids that are homologous to the regulatory C2 domains in protein kinase C. Syt2 binds calcium and phospholipids through its two C2 domains (5). The C2A domain regulates the fusion step of synaptic vesicle exocytosis (6), while the C2B domain binds phosphatidylinositol-3,4,5-triphosphate (PIP3) in the absence of calcium, and to phosphatidylinositol bisphosphate (PIP2) in the presence of calcium (5;7;8). Syt1 binds five calcium ions, three via the C2A domain and two via the C2B domain; Syt2 is also predicted to bind five calcium ions through a similar orientation (9;10). The C2 domains of Syt1 insert into the membrane upon calcium binding.

 

Syt2 is predicted to undergo several posttranslational modifications. Phosphorylation of the C2A and C2B domains by WNK1 (with no lysine [K] 1) results in changes in the calcium requirement for Syt2 binding to phospholipid vesicles (11). Other kinases (e.g., casein kinase II and calmodulin protein kinase II) phosphorylate the linker domain of Syt1; the precise locations of Syt2 phosphorylation are unknown (12-14). Asn32 is predicted to be N-linked glycosylated; the function of Syt2 glycosylation has not been studied. Up to five cysteines within a cysteine-rich region (amino acids 82-92) of Syt2 are predicted to be palmitoylated (15). Palmitoylation of Syt2 is predicted to facilitate dimerization of Syt2 (4).

 

The synaptotagmins undergo conformational changes upon calcium binding to assist in efficient neuroexocytosis at the synapse (Figure 2). While the vesicle is prepared for fusion, the membrane spanning domains of the Syt dimers are in close proximity to the vesicle–plasma membrane contact (16). The palmitoylated cysteine region serves as a bridge to the juxtamembrane polybasic region, which associates with the vesicle membrane, while the C2 domains project into the cytosol. During exocytosis, calcium binding to the C2 domains results in movement of the C2 domains of each monomer away from the cytosol followed by insertion into the inner hemi-bilayer of the plasma membrane. Movement of the C2 domains causes the juxtamembrane, polybasic region to dissociate from the surface of the secretory organelle and to bind to the plasma membrane. Binding of the C2 domains and the juxtamembrane regions to the plasma membrane results in both domains being pulled laterally away from the contact region between the vesicle and the plasma membrane. Rotation of the Syt dimer facilitates inward dimpling of the outer hemi-bilayer of the plasma membrane. During exocytosis, the Syt membrane-spanning domains rotate 90° relative to their original orientation. This rotation triggers a further outward bending of the vesicle membrane and an inward flexion of the plasma membrane. The luminal domain of each Syt molecule transiently contributes to the wall of the fusion pore. As the Syt transmembrane domains continue to rotate toward the extracellular space, they will begin to fold back on the polypeptide backbone of the palmitoylated cysteine region. The final transition to full fusion is for the palmitoylated cysteine domain to revert back to its inter-lamella position. Upon complete fusion, the C2 domains of the Syts dissociate from the plasma membrane (subsequent to the dissociation of Ca2+), while the palmitoylated cysteine region reverts from its interfacial location to the membrane interior.

 

The kringle mutation results in an alanine (A) to aspartic acid (D) substitution at position 403 C-terminal within the cytoplasmic C2B domain as predicted by SMART.

Expression/Localization

Syt2 is highly expressed in several brain regions including the cerebellum, hindbrain, striatum, and zona incerta of the subthalamus, the reticular nucleus of the thalamus, and the ventromedial nucleus of the hypothalamus (2;17-19). Syt2 is expressed in the spinal cord as well as in the brainstem. Within the brainstem, Syt2 is highly expressed in the inferior colliculus, the pontine reticular nuclei, the nuclei of the fifth and seventh cranial nerves, and the nucleus of the trapezoid body. In the visual cortex, Syt2 is localized in inhibitory, VGAT-positive boutons (i.e., terminal bulbs at the end of an axon) (20). Syt2 is expressed in the outer plexiform and inner plexiform layers of the mouse retina (21). Syt2 is also expressed in mature mast cells (22).

Background

Figure 3. AChR-associated signaling. The AChR regulates the flow of ions across the cell membrane to mediate synaptic transmission at the neuromuscular junction. A detailed description of the function of AChR is detailed in the key below the figure. See the text for more details.

Figure 4. Model for synaptogagmin function during exocytosis. (1) Upon loading of vesicles with neurotransmitters, the vesicles are targeted to active zones. The fusion machinery is composed of synaptotagmin, SNARES (synaptobrevin, syntaxin, and SNAP-25), and phosphatidylinositol 4,5-bisphosphate. (2) Without calcium, the C2B domain of Syt binds weakly to phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) in the target membrane. (3) The vesicles are quiescent until the nerve terminal experiences an action potential, which triggers the influx of calcium through voltage-gated calcium channels. (4) The SNARES twist together and the the calcium-binding loops of the C2A and C2B domains of Syt pierce the bilayer. (5) The close proximity of the bilayers faciliates the meeting of the outer leaflets and the formation of single bilayer with the inner leaflets. (6) The calcium triggers the opening of fusion pores. The fusion pore may be composed of phospholipids, the membrane anchors of the SNARE proteins, or both. (7) The fusion pores dilate, facilitating the complete fusion of the vesicle with the target membrane. (8) Endocytosis of vesicle contents. Figure is adapted from Chapman, E.R. Nat. Rev. Mol. Cell Biol. (2002), 3:498-508.

Syt2 is the major Syt isoform at the mammalian neuromuscular junctions (i.e., the synapse between a spinal motor neuron and a skeletal muscle cell). The neuromuscular junction facilitates the transmission of signals from the motor neuron to the skeletal muscle, precisely controlling skeletal muscle contraction and voluntary movement (Figure 3). At the neuromuscular junction, Syt2 facilitates the release (i.e., neuroexocytosis) of the acetylcholine neurotransmitter upon an action potential, facilitating the opening of the nicotinic acetylcholine receptor channels on the cell membrane of the muscle fiber (i.e., sarcolemma). Binding of acetylcholine to the receptor depolarizes the muscle fiber, subsequently resulting in muscle contraction.

 

Neuroexocytosis is the process in which synaptic vesicles fuse with the presynaptic membrane, facilitating the release of the vesicle contents into the synaptic cleft (Figure 4). In the presynaptic nerve ending, upon loading of vesicles with neurotransmitters, synaptic vesicles are targeted to regions on the plasma membrane, termed active zones. In the “dyad model”, Gundersen et al. proposes that the calcium-dependent redistribution of synaptotagmin proteins at the secretory vesicle-plasma membrane interface initiates membrane fusion (16). The vesicles are quiescent until the nerve terminal experiences an action potential, which triggers the influx of calcium through voltage-gated calcium channels; calcium triggers the opening of fusion pores. In the dyad model, there are four main steps: (i) pre-docking, where the synaptic vesicle comes in proximity to the plasma membrane, initiating the formation of the SNARE complex; (ii) docking, whereby the SNAREs assist in stabilizing the vesicle at the plasma membrane; (iii) priming, whereby the vesicle is prepared for fusion; at this step the Syt pairs assemble at the vesicle-plasma membrane interface. The fusion pores dilate, facilitating the complete fusion of the vesicle with the target membrane followed by exocytosis of synaptic vesicles; and (iv) exocytosis. Calcium-triggered neurotransmitter release can either be a fast synchronous release induced by brief transients of high calcium concentrations or a slow asynchronous release induced at a slower rate by lower calcium concentrations (23;24).

 

The Syt family consists of 15 members. Most Syt mediate calcium-dependent exocytosis of neurotransmitters and hormones. The standard model proposes that members of the synaptotagmin family regulate the function of SNARE proteins, subsequently regulating exocytosis by triggering membrane fusion (25-27). Syt2 and Syt1 bind the SNARE proteins synaptobrevin, syntaxin, and SNAP-25 as well as phospholipids in a calcium-dependent manner (28;28;29). Syt2 mediates fast neurotransmitter release by functioning as a calcium sensor (6;9;17;30).

 

Mutations in SYT2 (D307A and P308L) have been linked to autosomal dominant presynaptic congenital myasthenic syndrome 7 [CMS7; OMIM: #616040; (31)]. CMS7 is an autosomal dominant disorder that affects the neuromuscular junction due to abnormal signal transmission at the motor endplate whereby patients exhibit variable muscle weakness between infancy and adulthood, loss of tendon reflexes, and childhood-onset foot deformities.

Putative Mechanism

Syt2 is essential for neurotransmitter release in brainstem synapses and in neuromuscular junctions (17). Syt2 mutant (Syt2I377N) mice exhibited reduced calcium-triggered synchronous neurotransmitter release, but increased spontaneous release in the Calyx of Held (17). The Syt2I377N/I377N mice were viable, but infertile. In addition, the Syt2I377N/I377N mice weighed less than their wild-type littermates and were uncoordinated and ataxic. Syt2 deficient (Syt2-/-) mice exhibit severe motor dysfunction by postnatal day (P7-P14) (18). In addition, the mice were almost unable to move at P15. The Syt2-/- mice failed to grow in the second postnatal week. By P19, the Syt2-/- mice exhibited lethality and all mice died by P21-P24 (18;30). The Syt2-/- mice did not exhibit seizures. Similar to the Syt2I377N/I377N mice, the kringle mice exhibit motor defects, indicating defective Syt2kringle function.

Primers PCR Primer
kringle(F):5'- CTTTGCTTGCCTTGCAGAAAGTCC -3'
kringle(R):5'- GCCATGTTGTTGGTCCAAAACCC -3'

Sequencing Primer
kringle_seq(F):5'- CCTTGCAGAAAGTCCAGGTG -3'
kringle_seq(R):5'- TAGGGGACTCTCTTCACACAG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJeff SoRelle, Zhe Chen, Noelle Hutchins
List |< first << previous [record 13 of 30] next >> last >|