Phenotypic Mutation 'tinsel' (pdf version)
List |< first << previous [record 520 of 584] next >> last >|
Alleletinsel
Mutation Type missense
Chromosome1
Coordinate34,164,167 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Dst
Gene Name dystonin
Synonym(s) BPAG1-n, ah, athetoid, bullous pemphigoid antigen 1, A830042E19Rik, Macf2, nmf339, Bpag1, nmf203, bullous pemphigoid antigen 1, BPAG1, Bpag, 2310001O04Rik
Chromosomal Location 33,908,225-34,308,661 bp (+)
MGI Phenotype PHENOTYPE: Mutations in this gene produce peripheral nervous system demyelination resulting in impaired muscle function and shorter lifespan. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001276764, NM_134448, NM_133833, NM_010081; MGI:104627

Mapped Yes 
Amino Acid Change Glutamic Acid changed to Glycine
Institutional SourceBeutler Lab
Ref Sequences
E719G in Ensembl: ENSMUSP00000110756 (fasta)
Gene Model predicted gene model for protein(s): [ENSMUSP00000095392] [ENSMUSP00000095393] [ENSMUSP00000110756] [ENSMUSP00000138308] [ENSMUSP00000138376] [ENSMUSP00000141127] [ENSMUSP00000139888] [ENSMUSP00000140560]
SMART Domains

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 1e-42 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 4e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 6e-63 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
PLEC 1537 1581 9.05e-3 SMART
PLEC 1582 1619 2.7e0 SMART
PLEC 1657 1694 2.23e0 SMART
PLEC 1695 1732 4.25e1 SMART
PLEC 1735 1770 1.39e2 SMART
PLEC 1771 1808 7.4e-8 SMART
PLEC 1811 1846 5.8e-1 SMART
PLEC 1847 1884 2.71e1 SMART
PLEC 1886 1922 4.66e0 SMART
low complexity region 2294 2307 N/A INTRINSIC
low complexity region 2366 2381 N/A INTRINSIC
low complexity region 2477 2491 N/A INTRINSIC
low complexity region 2566 2593 N/A INTRINSIC
low complexity region 2661 2675 N/A INTRINSIC
low complexity region 2793 2799 N/A INTRINSIC
low complexity region 2839 2847 N/A INTRINSIC
low complexity region 3046 3057 N/A INTRINSIC
low complexity region 3294 3314 N/A INTRINSIC
SPEC 3321 3427 5.36e-1 SMART
low complexity region 3515 3527 N/A INTRINSIC
low complexity region 3548 3558 N/A INTRINSIC
SPEC 3569 3678 2.19e-1 SMART
internal_repeat_7 3771 3811 5.08e-5 PROSPERO
SPEC 3852 3971 1.75e-9 SMART
SPEC 3978 4084 3.7e-8 SMART
SPEC 4091 4190 4.56e-8 SMART
SPEC 4200 4299 3.78e0 SMART
low complexity region 4372 4388 N/A INTRINSIC
SPEC 4447 4552 1.98e-8 SMART
SPEC 4559 4663 3.62e-11 SMART
SPEC 4673 4773 1.65e-5 SMART
SPEC 4780 4882 7.75e-11 SMART
SPEC 4889 4989 2.3e-4 SMART
SPEC 4999 5098 3.01e0 SMART
SPEC 5105 5208 2.74e-2 SMART
SPEC 5215 5319 2.46e-4 SMART
SPEC 5326 5428 1.27e-15 SMART
SPEC 5435 5537 1.54e-14 SMART
SPEC 5544 5646 8.07e-2 SMART
SPEC 5653 5755 3.67e-12 SMART
SPEC 5762 5863 1.97e-12 SMART
SPEC 5870 5976 4.19e-7 SMART
SPEC 5983 6085 2.06e-15 SMART
SPEC 6092 6195 2.89e-10 SMART
SPEC 6202 6304 2.61e-26 SMART
SPEC 6311 6413 5.31e-18 SMART
SPEC 6420 6522 1.25e-14 SMART
SPEC 6529 6632 9.1e-17 SMART
SPEC 6639 6740 9.3e-23 SMART
SPEC 6747 6849 5.43e-15 SMART
SPEC 6859 6989 1.5e-8 SMART
EFh 7023 7051 4.12e-3 SMART
EFh 7059 7087 1.25e-2 SMART
GAS2 7098 7176 3.85e-52 SMART
low complexity region 7200 7218 N/A INTRINSIC
low complexity region 7228 7240 N/A INTRINSIC
low complexity region 7326 7349 N/A INTRINSIC
PDB:3GJO|H 7377 7406 9e-10 PDB
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using Ensembl: ENSMUSP00000110756)
Phenotypic Category Autosomal Recessive
Penetrance  
Alleles Listed at MGI

All mutations/alleles(297) : Chemically induced (ENU)(3) Chemically induced (other)(1) Gene trapped(274) Spontaneous(15) Targeted(3) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Dst APN 1 34251839 missense probably damaging 1.00
IGL00309:Dst APN 1 34160652 missense probably damaging 1.00
IGL00334:Dst APN 1 34166292 missense probably damaging 1.00
IGL00470:Dst APN 1 34188962 missense probably damaging 1.00
IGL00481:Dst APN 1 34169329 unclassified noncoding transcript
IGL00499:Dst APN 1 34290423 missense probably damaging 0.99
IGL00803:Dst APN 1 34164124 missense possibly damaging 0.89
IGL00850:Dst APN 1 34306624 missense probably damaging 1.00
IGL00957:Dst APN 1 34228407 missense probably benign 0.27
IGL00975:Dst APN 1 34188312 missense possibly damaging 0.86
IGL00984:Dst APN 1 34256320 missense probably damaging 1.00
IGL01284:Dst APN 1 34163928 missense probably damaging 1.00
IGL01393:Dst APN 1 34167625 missense possibly damaging 0.91
IGL01397:Dst APN 1 34257744 missense probably damaging 1.00
IGL01399:Dst APN 1 34117517 missense probably benign 0.41
IGL01412:Dst APN 1 34242620 unclassified probably benign 0.21
IGL01527:Dst APN 1 34247653 missense probably damaging 1.00
IGL01537:Dst APN 1 34275320 missense probably damaging 1.00
IGL01618:Dst APN 1 34188909 nonsense probably null
IGL01636:Dst APN 1 34215569 missense probably damaging 1.00
IGL01642:Dst APN 1 34189389 missense probably damaging 1.00
IGL01672:Dst APN 1 34225693 missense probably damaging 1.00
IGL01685:Dst APN 1 34170452 missense probably damaging 0.99
IGL01694:Dst APN 1 34188160 missense probably benign 0.13
IGL01777:Dst APN 1 34199397 missense probably benign 0.07
IGL01800:Dst APN 1 34262092 missense probably damaging 1.00
IGL01811:Dst APN 1 34164092 missense probably damaging 1.00
IGL01960:Dst APN 1 34290489 missense probably damaging 1.00
IGL02031:Dst APN 1 34189917 missense possibly damaging 0.95
IGL02103:Dst APN 1 34190118 missense possibly damaging 0.90
IGL02121:Dst APN 1 34228657 missense probably damaging 1.00
IGL02315:Dst APN 1 34198665 missense probably damaging 1.00
IGL02317:Dst APN 1 34295163 missense probably damaging 1.00
IGL02469:Dst APN 1 34188828 missense probably damaging 1.00
IGL02492:Dst APN 1 34152193 unclassified noncoding transcript
IGL02510:Dst APN 1 34229251 unclassified probably benign
IGL02522:Dst APN 1 34250700 unclassified noncoding transcript
IGL02540:Dst APN 1 34135204 missense probably damaging 1.00
IGL02588:Dst APN 1 34117484 missense probably damaging 1.00
IGL02676:Dst APN 1 34307587 missense probably damaging 1.00
IGL02688:Dst APN 1 34195952 missense probably damaging 1.00
IGL02700:Dst APN 1 34262120 missense probably damaging 1.00
IGL02794:Dst APN 1 34270829 unclassified probably damaging 1.00
IGL02823:Dst APN 1 34192083 missense possibly damaging 0.83
IGL02935:Dst APN 1 34186845 nonsense probably null
IGL02940:Dst APN 1 34289587 missense probably benign 0.36
IGL02994:Dst APN 1 34229252 unclassified probably benign
IGL02996:Dst APN 1 34188398 missense possibly damaging 0.93
IGL02998:Dst APN 1 34268275 missense probably damaging 1.00
IGL03027:Dst APN 1 34186025 missense possibly damaging 0.51
IGL03033:Dst APN 1 34169745 unclassified noncoding transcript
IGL03099:Dst APN 1 34275781 missense probably damaging 1.00
IGL03119:Dst APN 1 34161062 missense probably damaging 1.00
IGL03121:Dst APN 1 34217803 unclassified probably benign
IGL03132:Dst APN 1 34256641 missense probably benign 0.06
IGL03220:Dst APN 1 34185995 missense probably damaging 0.99
IGL03230:Dst APN 1 34184052 nonsense probably null
IGL03245:Dst APN 1 34211148 unclassified probably benign
IGL03380:Dst APN 1 34257800 missense probably damaging 1.00
Doodle UTSW 1 34208558 nonsense probably null
gobble UTSW 1 34165155 critical splice donor site probably null
phelps UTSW 1 34223795 splice acceptor site probably null
Wastable UTSW 1 34295289 missense probably damaging 1.00
E0370:Dst UTSW 1 34249471 splice site probably benign
FR4304:Dst UTSW 1 34200964 missense probably damaging 0.99
IGL02799:Dst UTSW 1 34179849 missense possibly damaging 0.92
R0006:Dst UTSW 1 34228918 missense probably benign 0.30
R0006:Dst UTSW 1 34228918 missense probably benign 0.30
R0023:Dst UTSW 1 34189119 missense probably damaging 1.00
R0023:Dst UTSW 1 34189119 missense probably damaging 1.00
R0024:Dst UTSW 1 34189119 missense probably damaging 1.00
R0027:Dst UTSW 1 34189119 missense probably damaging 1.00
R0049:Dst UTSW 1 34275781 missense probably damaging 1.00
R0053:Dst UTSW 1 34294550 splice donor site probably benign
R0053:Dst UTSW 1 34294550 splice site probably benign
R0058:Dst UTSW 1 34006224 missense possibly damaging 0.93
R0066:Dst UTSW 1 34189553 missense possibly damaging 0.67
R0066:Dst UTSW 1 34189553 missense possibly damaging 0.67
R0085:Dst UTSW 1 34229187 missense probably damaging 1.00
R0125:Dst UTSW 1 34270903 missense probably damaging 1.00
R0152:Dst UTSW 1 34189119 missense probably damaging 1.00
R0165:Dst UTSW 1 34154646 splice site noncoding transcript
R0172:Dst UTSW 1 34270854 missense probably damaging 1.00
R0207:Dst UTSW 1 34186935 missense probably benign 0.02
R0219:Dst UTSW 1 34303478 missense probably damaging 0.99
R0349:Dst UTSW 1 34199553 missense probably benign 0.12
R0386:Dst UTSW 1 34217836 missense probably damaging 1.00
R0389:Dst UTSW 1 34294550 splice site probably benign
R0395:Dst UTSW 1 34189119 missense probably damaging 1.00
R0423:Dst UTSW 1 34278035 missense possibly damaging 0.95
R0443:Dst UTSW 1 34294550 splice site probably benign
R0472:Dst UTSW 1 34266960 critical splice donor site probably null
R0490:Dst UTSW 1 34307368 nonsense probably null
R0513:Dst UTSW 1 34219531 splice site probably benign
R0539:Dst UTSW 1 34189119 missense probably damaging 1.00
R0562:Dst UTSW 1 34227981 missense probably damaging 1.00
R0569:Dst UTSW 1 34293427 missense probably damaging 1.00
R0600:Dst UTSW 1 34189119 missense probably damaging 1.00
R0608:Dst UTSW 1 34290356 splice site probably null
R0609:Dst UTSW 1 34266960 critical splice donor site probably null
R0630:Dst UTSW 1 34193450 missense probably benign 0.05
R0630:Dst UTSW 1 34199473 missense probably damaging 0.98
R0632:Dst UTSW 1 34271413 missense probably damaging 1.00
R0713:Dst UTSW 1 34189119 missense probably damaging 1.00
R0724:Dst UTSW 1 34188677 missense probably benign 0.00
R0761:Dst UTSW 1 34182767 missense probably benign 0.33
R0801:Dst UTSW 1 34170389 missense probably damaging 0.99
R0829:Dst UTSW 1 34163220 missense probably damaging 1.00
R0939:Dst UTSW 1 34244383 missense probably damaging 1.00
R0945:Dst UTSW 1 34271419 missense probably damaging 1.00
R0992:Dst UTSW 1 34199536 missense probably damaging 0.97
R1018:Dst UTSW 1 34194093 missense probably damaging 1.00
R1077:Dst UTSW 1 34164167 missense probably damaging 1.00
R1079:Dst UTSW 1 34186863 missense possibly damaging 0.86
R1127:Dst UTSW 1 34275277 missense probably damaging 1.00
R1129:Dst UTSW 1 34199554 missense probably benign 0.28
R1141:Dst UTSW 1 34188696 missense possibly damaging 0.85
R1167:Dst UTSW 1 34223858 missense probably damaging 1.00
R1195:Dst UTSW 1 34211154 missense probably damaging 1.00
R1195:Dst UTSW 1 34211154 missense probably damaging 1.00
R1195:Dst UTSW 1 34211154 missense probably damaging 1.00
R1333:Dst UTSW 1 34228347 missense probably damaging 1.00
R1352:Dst UTSW 1 34229248 critical splice donor site probably null
R1365:Dst UTSW 1 34188194 missense probably benign 0.02
R1382:Dst UTSW 1 34268833 missense probably damaging 0.99
R1389:Dst UTSW 1 34211232 missense probably damaging 1.00
R1394:Dst UTSW 1 34165155 critical splice donor site probably null
R1395:Dst UTSW 1 34165155 critical splice donor site probably null
R1435:Dst UTSW 1 34113945 missense probably damaging 1.00
R1450:Dst UTSW 1 34188395 missense probably damaging 1.00
R1450:Dst UTSW 1 34212259 missense probably damaging 0.99
R1453:Dst UTSW 1 34189446 missense possibly damaging 0.85
R1479:Dst UTSW 1 34264515 splice site probably null
R1483:Dst UTSW 1 34252998 missense probably damaging 1.00
R1491:Dst UTSW 1 34154594 missense probably damaging 0.99
R1536:Dst UTSW 1 34260372 splice site probably benign
R1551:Dst UTSW 1 34192212 missense probably benign 0.01
R1573:Dst UTSW 1 34201231 missense probably damaging 1.00
R1614:Dst UTSW 1 34275263 missense probably damaging 1.00
R1615:Dst UTSW 1 34199371 missense probably damaging 1.00
R1645:Dst UTSW 1 34225722 missense probably damaging 1.00
R1655:Dst UTSW 1 34282576 nonsense probably null
R1663:Dst UTSW 1 34163385 missense probably damaging 1.00
R1674:Dst UTSW 1 34223795 splice acceptor site probably null
R1702:Dst UTSW 1 34167340 missense probably damaging 1.00
R1707:Dst UTSW 1 34167646 missense probably damaging 1.00
R1747:Dst UTSW 1 34160709 missense probably damaging 1.00
R1760:Dst UTSW 1 34228603 missense probably damaging 1.00
R1773:Dst UTSW 1 34291899 missense probably damaging 0.99
R1793:Dst UTSW 1 34152471 nonsense probably null
R1842:Dst UTSW 1 34164119 missense probably null 0.98
R1869:Dst UTSW 1 34252832 missense probably damaging 0.99
R1879:Dst UTSW 1 34188843 missense probably benign 0.15
R1883:Dst UTSW 1 34189308 missense possibly damaging 0.74
R1912:Dst UTSW 1 34291850 missense probably damaging 1.00
R1920:Dst UTSW 1 34161029 missense probably damaging 0.99
R1921:Dst UTSW 1 34161029 missense probably damaging 0.99
R1943:Dst UTSW 1 34228369 missense possibly damaging 0.67
R1958:Dst UTSW 1 34163721 missense probably damaging 1.00
R1962:Dst UTSW 1 34191016 missense possibly damaging 0.47
R1991:Dst UTSW 1 34190258 missense probably benign 0.11
R1998:Dst UTSW 1 34256347 missense probably damaging 1.00
R2001:Dst UTSW 1 34184063 missense probably damaging 0.97
R2007:Dst UTSW 1 34226012 splice site probably benign
R2021:Dst UTSW 1 34166291 missense possibly damaging 0.70
R2022:Dst UTSW 1 34166291 missense possibly damaging 0.70
R2035:Dst UTSW 1 34271413 missense probably damaging 1.00
R2077:Dst UTSW 1 34211170 missense probably damaging 1.00
R2103:Dst UTSW 1 34190258 missense probably benign 0.11
R2111:Dst UTSW 1 34169178 missense probably damaging 1.00
R2112:Dst UTSW 1 34169178 missense probably damaging 1.00
R2113:Dst UTSW 1 34275236 missense probably damaging 0.97
R2201:Dst UTSW 1 34195921 missense possibly damaging 0.60
R2214:Dst UTSW 1 34271401 missense probably damaging 1.00
R2219:Dst UTSW 1 34170433 missense probably damaging 1.00
R2233:Dst UTSW 1 34274262 missense probably damaging 1.00
R2267:Dst UTSW 1 34295466 missense probably damaging 1.00
R2290:Dst UTSW 1 34229200 missense probably damaging 1.00
R2323:Dst UTSW 1 34228437 missense possibly damaging 0.93
R2424:Dst UTSW 1 34167060 missense probably damaging 1.00
R2426:Dst UTSW 1 34192812 missense probably benign 0.03
R2495:Dst UTSW 1 34199373 missense probably damaging 0.99
R2507:Dst UTSW 1 34011909 missense probably damaging 0.98
R2507:Dst UTSW 1 34188417 missense possibly damaging 0.85
R2510:Dst UTSW 1 34212286 missense probably benign
R2831:Dst UTSW 1 34275292 missense probably damaging 1.00
R2929:Dst UTSW 1 34167062 nonsense probably null
R3033:Dst UTSW 1 34152285 missense probably damaging 0.99
R3121:Dst UTSW 1 34289648 missense probably damaging 1.00
R3424:Dst UTSW 1 34198505 splice site probably benign
R3437:Dst UTSW 1 34190222 missense probably damaging 1.00
R3699:Dst UTSW 1 34213074 splice site probably benign
R3739:Dst UTSW 1 34268894 splice site noncoding transcript
R3796:Dst UTSW 1 34181915 missense probably benign 0.15
R3847:Dst UTSW 1 34212319 missense probably damaging 1.00
R3848:Dst UTSW 1 34212319 missense probably damaging 1.00
R3849:Dst UTSW 1 34212319 missense probably damaging 1.00
R3850:Dst UTSW 1 34189274 nonsense probably null
R3850:Dst UTSW 1 34212319 missense probably damaging 1.00
R3873:Dst UTSW 1 34289620 missense probably damaging 1.00
R3875:Dst UTSW 1 34171247 missense probably damaging 1.00
R3973:Dst UTSW 1 34011898 missense probably benign 0.34
R4014:Dst UTSW 1 34191282 nonsense probably null
R4043:Dst UTSW 1 34190684 missense probably benign 0.03
R4057:Dst UTSW 1 34186054 splice site noncoding transcript
R4074:Dst UTSW 1 34192269 missense probably benign 0.20
R4074:Dst UTSW 1 34228461 missense probably damaging 0.97
R4075:Dst UTSW 1 34192269 missense probably benign 0.20
R4076:Dst UTSW 1 34192269 missense probably benign 0.20
R4206:Dst UTSW 1 34212247 missense probably damaging 1.00
R4230:Dst UTSW 1 34195828 missense probably benign 0.04
R4242:Dst UTSW 1 34006216 missense possibly damaging 0.88
R4273:Dst UTSW 1 34192340 missense possibly damaging 0.72
R4366:Dst UTSW 1 34251878 missense probably damaging 1.00
R4370:Dst UTSW 1 34251728 frame shift probably null
R4379:Dst UTSW 1 34163235 missense probably damaging 1.00
R4379:Dst UTSW 1 34227975 missense probably benign 0.07
R4380:Dst UTSW 1 34163235 missense probably damaging 1.00
R4381:Dst UTSW 1 34163235 missense probably damaging 1.00
R4423:Dst UTSW 1 34188393 missense possibly damaging 0.76
R4427:Dst UTSW 1 34181460 missense probably benign 0.19
R4456:Dst UTSW 1 34190719 missense probably benign 0.06
R4469:Dst UTSW 1 34191842 missense probably benign 0.02
R4502:Dst UTSW 1 34247691 missense probably damaging 0.99
R4503:Dst UTSW 1 34262253 critical splice donor site probably null
R4545:Dst UTSW 1 34188738 missense probably damaging 0.99
R4610:Dst UTSW 1 34169856 missense probably damaging 1.00
R4633:Dst UTSW 1 34170434 missense probably damaging 1.00
R4675:Dst UTSW 1 34275703 missense possibly damaging 0.94
R4687:Dst UTSW 1 34201123 missense probably damaging 1.00
R4739:Dst UTSW 1 34191147 missense probably benign 0.01
R4751:Dst UTSW 1 34191884 missense probably benign 0.21
R4754:Dst UTSW 1 34212309 missense probably damaging 1.00
R4771:Dst UTSW 1 34249484 missense probably damaging 1.00
R4819:Dst UTSW 1 33968835 missense probably benign 0.03
R4830:Dst UTSW 1 34198505 splice site probably null
R4839:Dst UTSW 1 34190862 missense probably damaging 0.96
R4845:Dst UTSW 1 34193127 missense probably benign 0.02
R4904:Dst UTSW 1 34169798 missense probably damaging 0.99
R4932:Dst UTSW 1 34228683 missense possibly damaging 0.47
R4934:Dst UTSW 1 34208588 missense probably damaging 1.00
R4952:Dst UTSW 1 34271422 missense probably damaging 1.00
R4961:Dst UTSW 1 33968823 missense possibly damaging 0.53
R4976:Dst UTSW 1 34195969 nonsense probably null
R4980:Dst UTSW 1 34256288 missense probably damaging 1.00
R5011:Dst UTSW 1 34250647 missense probably damaging 1.00
R5013:Dst UTSW 1 34250647 missense probably damaging 1.00
R5059:Dst UTSW 1 34163346 missense possibly damaging 0.70
R5074:Dst UTSW 1 34295263 missense probably damaging 1.00
R5114:Dst UTSW 1 34202559 missense probably damaging 0.98
R5119:Dst UTSW 1 34195969 nonsense probably null
R5182:Dst UTSW 1 34179086 missense probably benign
R5236:Dst UTSW 1 34164417 missense probably damaging 1.00
R5240:Dst UTSW 1 34208558 nonsense probably null
R5254:Dst UTSW 1 34177931 nonsense probably null
R5275:Dst UTSW 1 34180148 missense probably benign 0.13
R5281:Dst UTSW 1 34257782 missense probably benign 0.29
R5299:Dst UTSW 1 34135092 missense probably damaging 1.00
R5316:Dst UTSW 1 34223848 missense probably damaging 0.97
R5319:Dst UTSW 1 34225977 missense possibly damaging 0.95
R5425:Dst UTSW 1 34179750 missense probably benign 0.00
R5443:Dst UTSW 1 34228539 missense probably damaging 1.00
R5522:Dst UTSW 1 34257873 missense possibly damaging 0.46
R5537:Dst UTSW 1 34189878 missense probably benign 0.25
R5548:Dst UTSW 1 34189328 missense probably benign
R5557:Dst UTSW 1 34282586 missense probably damaging 1.00
R5597:Dst UTSW 1 34192713 missense probably benign 0.07
R5623:Dst UTSW 1 34190133 missense possibly damaging 0.56
R5630:Dst UTSW 1 34188785 frame shift probably null
R5660:Dst UTSW 1 34282493 missense probably damaging 1.00
R5730:Dst UTSW 1 34117526 critical splice donor site probably null
R5762:Dst UTSW 1 34179357 missense probably damaging 0.99
R5810:Dst UTSW 1 34183040 utr 3 prime noncoding transcript
R5816:Dst UTSW 1 34179234 missense probably benign
R5846:Dst UTSW 1 34195861 nonsense probably null
R5874:Dst UTSW 1 34179589 missense probably damaging 0.98
R5899:Dst UTSW 1 34295289 missense probably damaging 1.00
R5923:Dst UTSW 1 34181759 missense probably benign 0.00
R5936:Dst UTSW 1 34307458 missense probably damaging 1.00
R5946:Dst UTSW 1 34174192 missense probably benign 0.01
R5950:Dst UTSW 1 34262060 missense probably damaging 1.00
R5958:Dst UTSW 1 34186050 missense probably damaging 0.97
R5973:Dst UTSW 1 34156857 missense probably damaging 1.00
R5979:Dst UTSW 1 34160372 missense unknown
R5980:Dst UTSW 1 34182891 missense probably benign 0.34
R5984:Dst UTSW 1 34172263 missense probably benign 0.05
R6000:Dst UTSW 1 34212223 missense possibly damaging 0.92
R6014:Dst UTSW 1 34264834 missense probably damaging 1.00
R6042:Dst UTSW 1 34188972 missense probably damaging 1.00
R6064:Dst UTSW 1 34194051 missense probably damaging 1.00
R6126:Dst UTSW 1 34228183 missense probably damaging 1.00
R6157:Dst UTSW 1 34211172 missense probably damaging 1.00
R6162:Dst UTSW 1 34006237 missense probably damaging 0.99
R6185:Dst UTSW 1 34173080 missense probably damaging 0.99
R6226:Dst UTSW 1 34270874 missense probably damaging 1.00
R6227:Dst UTSW 1 34194540 missense probably benign 0.41
R6232:Dst UTSW 1 34188172 missense probably damaging 1.00
R6259:Dst UTSW 1 34182396 missense probably benign 0.26
R6267:Dst UTSW 1 34228672 missense probably damaging 1.00
R6273:Dst UTSW 1 34275266 missense probably damaging 1.00
R6284:Dst UTSW 1 34229085 missense probably damaging 1.00
R6347:Dst UTSW 1 34179684 missense probably benign
R6365:Dst UTSW 1 34191927 missense probably damaging 1.00
R6385:Dst UTSW 1 34307468 missense possibly damaging 0.85
R6389:Dst UTSW 1 34193184 missense probably damaging 0.99
R6395:Dst UTSW 1 34182690 missense probably benign 0.17
R6416:Dst UTSW 1 34116128 missense probably damaging 1.00
R6467:Dst UTSW 1 34295196 missense probably damaging 1.00
R6470:Dst UTSW 1 34295237 missense probably damaging 1.00
R6477:Dst UTSW 1 34208728 intron probably null
R6485:Dst UTSW 1 34294529 missense probably damaging 1.00
R6491:Dst UTSW 1 34193012 missense probably benign 0.10
R6525:Dst UTSW 1 34163135 missense probably damaging 1.00
R6533:Dst UTSW 1 34303509 missense probably benign 0.08
R6595:Dst UTSW 1 34250680 missense probably damaging 1.00
R6622:Dst UTSW 1 34179251 missense probably benign 0.13
R6648:Dst UTSW 1 34262041 missense possibly damaging 0.84
X0026:Dst UTSW 1 34213055 missense probably damaging 0.97
X0028:Dst UTSW 1 34192199 missense probably damaging 1.00
X0063:Dst UTSW 1 34195895 missense probably damaging 1.00
X0066:Dst UTSW 1 34275703 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 038168-MU
Last Updated 2016-05-13 3:09 PM by Anne Murray
Record Created 2014-12-15 4:28 PM by Jeff SoRelle
Record Posted 2015-03-03
Phenotypic Description
Figure 1. The phenotype of the tinsel mice.

The tinsel phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1077, some of which walked with their head horizontally tilted at approximately 30 degrees to the right constantly (Figure 1). When walking, the tinsel mice appeared to follow the perimeter of the cage only making right turns. No tremor, head tossing, or ataxia was observed.

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 41 mutations. A mutation in Dst was presumed to be causative because the tinsel phenotype was similar to other Dst alleles (see gobble, phelps, and MGI). The mutation in Dst is an A to G transition at base pair 34,164,167 (v38) on chromosome 1, or base pair 255,961 in the GenBank genomic region NC_000067 encoding Dst.  The mutation corresponds to residue 2,156 in the muscle-specific Dst isoform (Dst-b1; NM_134448) within exon 17 of 98 total exons residue 2,156 in the neuron-specific Dst isoform (Dst-a1; NM_133833) within exon 17 of 93 total exons, and residue 1,178 in the epithelial-specific Dst isoform (Dst-e; NM_010081) within exon 7 of 24 total exons.

 
255945 TGGTTGAATGAAAAGGAGGAGTCGGAAGTTGCT
714    -W--L--N--E--K--E--E--S--E--V--A- (Dst-b1)
714    -W--L--N--E--K--E--E--S--E--V--A- (Dst-a1)
388    -W--L--N--E--K--E--E--S--E--V--A- (Dst-e)

 

Genomic numbering corresponds to NC_000067. The mutated nucleotide is indicated in red.  The mutation results in a glutamic acid (E) to glycine (G) substitution at position 719 (E719G) in the DST-b1 protein, a glutamic acid (E) to glycine (G) substitution at position 419 (E419G) in the DST-a1 protein, and a glutamic acid (E) to glycine (G) substitution at position 393 (E393G) in the DST-e protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00).

Protein Prediction

Figure 2. Dst encodes several DST isoforms. The DST-b1, -a1, and e isoforms are shown. Alternative splicing of the first 5' exons yields three dystonin-a/b isoforms (e.g., DST-a1, DST-a2, and DST-a3 and DST-b1, DST-b2, and DST-b3, respectively). Dystonin-a/b1 contain a unique N-terminal region followed by CH1 and CH2 domains in tandem. Dystonin-a/b2 (not shown) contain a highly conserved N-terminal transmembrane (TM) domain followed by a CH1 and CH2 domain in tandem. Dystonin-a/b3 (not shown) harbor a conserved myristoylation motif (myr) followed by a single CH2 domain. The spectrin domain contains several plectin and spectrin repeats. See the text for more details. The tinsel mutation is a glutamic acid (E) to glycine (G) substitution at position 719 (E719G) in the DST-b1 protein, a glutamic acid (E) to glycine (G) substitution at position 419 (E419G) in the DST-a1 protein (not shown), and a glutamic acid (E) to glycine (G) substitution at position 393 (E393G) in the DST-e protein (not shown). Image is interactive; click to view other Dst mutations. Abbreviations: SPEC, spectrin repeat domain; EF, EF hands; CH1/2, calponin homology domains; IFBD, intermediate filament-binding domain, PRD, plakin-repeat domain.

Dst encodes dystonin (DST) [alternatively, bullous pemphigoid antigen 1 (Bpag1), a member of the plakin family of proteins [(1); Figure 2]. DST has an N-terminal plakin domain as well as different combinations of structural domains including an actin-binding domain (ABD), a spectrin-repeat (SR)-containing rod domain, and a microtubule-binding domain (MTBD). Dst encodes three tissue-specific DST isoforms, including a neuronal isoform (DST-a), a muscle isoform (DST-b), and an epithelial isoform (DST-e) [(1-4); reviewed in (5)]. DST-e has the plakin domain, rod domain, and a C-terminal intermediate filament-binding domain/plakin-repeat domain 2 (IFBD/PRD2) only (6). The DST-a and DST-b isoforms share similar domains including the ABD, plakin, and rod domains as well as the EF hand calcium-binding motifs and a growth arrest specific protein 2 (GAS2) related (GAR) domain that contains a MTBD and a Gly-Ser-Arg (GSR) repeat region (2;6). DST-b differs from DST-a in that DST-b has a putative IFBD/PRD2 domain following the plakin domain. Alternative splicing of 5’ exons in Dst results in three tissue-specific isoforms in muscle (i.e., DST-b1/2/3) and neurons (i.e., DST-a1/2/3) [(2;7;8); reviewed in (5)]. Each DST isoform has different domains upstream of the ABD (1;9). The unique N-terminal domains in the DST-a isoforms facilitate cell-specific localization and function (8;10-12). DST-a2/b2 have an N-terminal transmembrane domain upstream of tandem calponin-homology (CH)1/CH2 domains (7). The DST-a1/b1 isoforms lack N-terminal transmembrane domains, but have CH1 and CH2 domains [reviewed in (5)]. The DST-a3/b3 isoforms do not have a transmembrane domain or a CH1 domain, but have a myristoylation motif followed by one CH2 domain [reviewed in (5)]. The tinsel mutation is within the plakin domain of all of the DST isoforms.

 

Please see the record gobble for more information about Dst.

Putative Mechanism

Proteins in the plakin family are scaffold proteins that link intermediate filaments to desmosomes and hemidesmosomes to regulate cytoskeletal dynamics, cell migration, differentiation, and stress responses (8;13). Homozygous mutations in DST that cause loss of DST-a1/2/3 expression have been documented to cause hereditary sensory and autonomic neuropathy type 6 (HSAN6) (14;15). Patients with HSAN6 exhibit limb contractures and dysautonomia; HSAN6 is ultimately fatal (15). A mutation within the MTBD of the DST-a/b isoforms leads to sensory autonomic neuropathy with dysautonomia, severe psychomotor retardation, and early death (14). Collectively, the phenotype of mice with mutations in Dst is referred to as dystonia musculorum (dt) and is characterized by sensory neuron degeneration, ataxia, tremor, muscle weakness, low body weights, and reduced numbers of motor neurons at approximately 2 weeks after birth (16-19). The phenotype of the tinsel mice indicates that the mutation results in loss of function in the DST protein(s). However, the tinsel mice do not exhibit as severe of a neurological phenotype as dt mice and do not exhibit skin lesions indicating that some DST function remains.

Primers PCR Primer
tinsel(F):5'- GACAGCGCCTCTGAAACTCTCTTAC -3'
tinsel(R):5'- ATCAGCTCCTAGCGAGGAAGCATC -3'

Sequencing Primer
tinsel_seq(F):5'- GAGTCAGTACGCTAAACTCTTGG -3'
tinsel_seq(R):5'- AGCATCAGGAAGCGTATCAG -3'
References

1. Brown, A., Dalpe, G., Mathieu, M., and Kothary, R. (1995) Cloning and Characterization of the Neural Isoforms of Human Dystonin. Genomics. 29, 777-780.

Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJeff SoRelle, Zhao Zhang, Bruce Beutler
List |< first << previous [record 520 of 584] next >> last >|