Phenotypic Mutation 'samson'

• Allele: samson
• Mutation Type: nonsense
• Chromosome: 10
• Coordinate: 95,248,943 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Socs2
• Gene Name: suppressor of cytokine signaling 2
• Synonym(s): SOCS-2, D130043N08Rik, STAT-induced STAT inhibitor 2, Cish2, JAB, cytokine-inducible SH2 protein 2, SSI-2, CIS2
• Chromosomal Location: 95,221,224-95,253,042 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the suppressor of cytokine signaling (SOCS) family. SOCS family members are cytokine-inducible negative regulators of cytokine receptor signaling via the Janus kinase/signal transducer and activation of transcription pathway (the JAK/STAT pathway). SOCS family proteins interact with major molecules of signaling complexes to block further signal transduction, in part, by proteasomal depletion of receptors or signal-transducing proteins via ubiquitination. The expression of this gene can be induced by a subset of cytokines, including erythropoietin, GM-CSF, IL10, interferon (IFN)-gamma and by cytokine receptors such as growth horomone receptor. The protein encoded by this gene interacts with the cytoplasmic domain of insulin-like growth factor-1 receptor (IGF1R) and is thought to be involved in the regulation of IGF1R mediated cell signaling. This gene has pseudogenes on chromosomes 20 and 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012] ; PHENOTYPE: Mutations in this gene cause accelerated postnatal growth. Homozygotes for a targeted mutation also show increased bone growth, enlargement of most organs, collagen deposition in the skin and some ducts and vessels, lower major urinary protein levels, and elevated IGF-I mRNA levels in some tissues. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamic Acid changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000020215] [ENSMUSP00000113378] [ENSMUSP00000117576] [ENSMUSP00000118720] [ENSMUSP00000131875] [ENSMUSP00000129331] [ENSMUSP00000117785]
• AlphaFold: O35717
• SMART Domains: Protein: ENSMUSP00000020215; Gene: ENSMUSG00000020027; AA Change: E57*

Domain	Start	End	E-Value	Type
low complexity region	32	43	N/A	INTRINSIC
SH2	46	135	5.22e-22	SMART
SOCS	154	195	3.15e-16	SMART
SOCS_box	160	194	1.06e-9	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000113378; Gene: ENSMUSG00000020027; AA Change: E57*

Domain	Start	End	E-Value	Type
low complexity region	32	43	N/A	INTRINSIC
SH2	46	135	5.22e-22	SMART
SOCS	154	195	3.15e-16	SMART
SOCS_box	160	194	1.06e-9	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000117576; Gene: ENSMUSG00000020027; AA Change: E57*

Domain	Start	End	E-Value	Type
SCOP:d1a81a2	30	62	8e-4	SMART
PDB:4JGH|A	45	62	7e-6	PDB

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000118720; Gene: ENSMUSG00000020027; AA Change: E57*

Domain	Start	End	E-Value	Type
low complexity region	32	43	N/A	INTRINSIC
Pfam:SH2	48	80	1.9e-8	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000131875; Gene: ENSMUSG00000020027; AA Change: E57*

Domain	Start	End	E-Value	Type
low complexity region	32	43	N/A	INTRINSIC
SH2	46	135	5.22e-22	SMART
SOCS	154	195	3.15e-16	SMART
SOCS_box	160	194	1.06e-9	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000121305; Gene: ENSMUSG00000020027; AA Change: E10*

Domain	Start	End	E-Value	Type
SH2	1	89	5.07e-20	SMART
SOCS	108	149	3.15e-16	SMART
SOCS_box	114	148	1.06e-9	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000129331; Gene: ENSMUSG00000020027; AA Change: E57*

Domain	Start	End	E-Value	Type
low complexity region	32	43	N/A	INTRINSIC
SH2	46	135	5.22e-22	SMART
SOCS	154	195	3.15e-16	SMART
SOCS_box	160	194	1.06e-9	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000117785; Gene: ENSMUSG00000020027; AA Change: E57*

Domain	Start	End	E-Value	Type
SCOP:d1bg1a3	40	70	3e-7	SMART
PDB:2C9W|A	45	70	5e-12	PDB
Blast:SH2	46	70	8e-11	BLAST

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9754
• Is this an essential gene?: Probably nonessential (E-score: 0.149)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• MMRRC Submission: 038190-MU
• Last Updated: 2019-09-04 9:47 PM by Bruce Beutler
• Record Created: 2014-12-23 8:11 PM by Jeff SoRelle
• Record Posted: 2015-04-30
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Zhe Chen, Jeff SoRelle, Noelle Hutchins

Accession Number

NCBI RefSeq: NM_007706, NM_001168655, NM_001168656, NM_00168657; MGI:1201787

Alleles Listed at MGI

All mutations/alleles(23) : Gene trapped(18) Spontaneous(1) Targeted(4)

Phenotypic Description

Figure 1. Samson mice exhibit increased body weights compared to wild-type littermates. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The samson phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1617, some of which showed increased body weights compared to their littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 82 mutations (X-axis) identified in the G1 male of pedigree R1617. Scaled weight phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 82 mutations. The increased body weight phenotype was linked to a mutation in Socs2: a G to T transversion at base pair 95,413,081 (v38) on chromosome 10, or base pair 4,173 in the GenBank genomic region NC_000076 encoding Socs2. Linkage was found with a recessive model of inheritance (P = 1.231 x 10^-6), wherein 3 variant homozygotes departed phenotypically from 7 homozygous reference mice and 10 heterozygous mice (Figure 2). The mutation corresponds to residue 631 in the mRNA sequence NM_145223 within exon 3 of 3 total exons.

616 AGTATGACTGTTAATGAAGCCAAAGAGAAATTA 52  -S--M--T--V--N--E--A--K--E--K--L-

The mutated nucleotide is indicated in red, and converts glutamine 57 of the SOCS2 protein to a stop codon.

Protein Prediction

Figure 3. Domain organization of SOCS2. The effect of the samson mutation (E57*) is indicated in red. Abbreviations: ESS, extended SH2 subdomain; SH2, Src homology 2; SOCS, SOCS-box.

Figure 4. Crystal structure of human SOCS2. Figure was generated by Chimera software and is based on PDB: 2C9W.

Socs2 encodes suppressor of cytokine signaling 2 [SOCS2; alternatively, cytokine-inducible Src homology 2 (SH2)-containing protein (CIS)-2 or STAT-induced Stat-inhibitor-2 (SSI-2)], a member of the SOCS protein family. There are eight known members of the SOCS family including SOCS1-SOCS7 and CIS. Each member of the SOCS family has a variable length N-terminus, a central SH2 domain, and a highly conserved C-terminal SOCS-box motif [Figure 3 & 4; (1;2); PDB:2C9W].

The SH2 domain of SOCS2 (amino acids 46-135) is required for SOCS2 function and is proposed to bind to tyrosine phosphorylated sites of JAK kinases (see the record mount_tai for information about JAK3), cytokine receptors, growth hormone receptors, and STATS (see the record for domino for information about STAT1) after cytokine stimulation (1-4). N-terminal to the SH2 is the extended SH2 subdomain (ESS) (5).  Although the mechanism is unclear, deletion of the ESS inhibits SOCS2-mediated regulation of the growth hormone receptor (4).

The SOCS-box (amino acids 154-195 in SOCS2) is essential for the inhibitory functions of SOCS2 (4). The SOCS-box can interact with Elongin B and C to form a complex with members of the Cullin and Rbx families (4;6;7). The SOCS2-Elongin B/C complex functions as an E3 ubiquitin ligase that targets proteins for polyubiquitination and subsequent proteasomal-mediated degradation (8). The SOCS2-Elongin B/C complex has been crystallized (PDB:2C9W) (5). The ESS is formed from a single amphipathic helix. N-terminal to the ESS is not predicted to have secondary structure (9). The ESS packs alongside the C-terminus and forms hydrophobic interactions with the SH2 domain and electrostatic interactions with the SOCS-box (5). The SH2 domain has a classic phosphotyrosine pocket (5). The SOCS-box has three core helices (H1-H3) that pack together with the H4 helix of Elongin B/C into a four-helix cluster. The H1 helix of SOCS2 is buried into a deep cleft between the Elongin C loop 5 and H4. The C-terminus of SOCS2 is buried in the interface between the SH2 domain and the SOCS-box.

The samson mutation (E57*) is within the SH2 domain. The expression and function of SOCS2^samson have not been examined.

Expression/Localization

Socs2 is highly expressed in fetal kidney, adult heart, skeletal muscle, pancreas, and liver (10). The SOCS2 protein is highly expressed in the heart, lung, placenta, skeletal muscle, and peripheral blood lymphocytes (1). Between embryonic day 10 and postnatal day 8, SOCS2 is highly expressed in neural progenitor cells and neurons (11;12).  

Socs2 expression is induced by cytokines and other factors (Table 1). See (13) for a comprehensive list of hormones and cytokines that regulate Socs2 expression.

Table 1. Factors that regulate Socs2 expression

Factor	Cell-type or organ	References
IL-2 and IL-4	CT4S cells	(1;2;14)
IL-3 and granulocyte colony-stimulating factor (G-CSF)	NSF60 cells
Erythropoietin (EPO)	F36E cells
IL-15	Resting human NK cells	(14)
IFN-γ, EPO, granulocyte-macrophage colony stimulating factor (GM-CSF), and IL-3	Bone marrow cells	(15)
Growth hormone (GH)	Intestine, liver	(16;17)
IFN-γ, leukemia inhibitory factor (LIF), ciliary neurotrophic factor (CNTF), and oncostatin M	Neural progenitor cells	(11)
Lipoxin (LXA4)	Dendritic cells and B cells	(18)
Toll-like receptor (TLR) stimulation  (i.e., LPS)	Dendritic cells	(19)
Estrogen		(20)

Background

Figure 5. JAK-STAT Pathway. Cytokine receptors are associated with the normally dephosphorylated and inactive JAK tyrosine kinases. Latent STAT1 exists in the cytoplasm as a monomer. Upon receptor stimulation, JAK proteins phosphorylate the receptor cytoplasmic domains. STAT proteins are recruited to the receptor, tyrosine phosphorylated by JAKs, and dimerize for translocation to the nucleus with the assistance of importin-α5 (associated with importin-β). Once STAT1 binds to its DNA target, importin-α5 is recycled to the cytoplasm by the cellular apoptosis susceptibility protein (CAS) export receptor. Suppressors of cytokine signaling (SOCS) proteins can directly bind and suppress JAKs or can compete with STATs for receptor binding. The tyrosine phosphatases SHP1 and SHP2 inhibit signaling by dephosphorylating STAT proteins.

Cytokines regulate growth, differentiation, metabolism, and the immune system. Upon receptor binding, cytokines activate the JAK (Janus kinase)-STAT pathway (Figure 5). The cytokine receptors are associated with JAK tyrosine kinases, which are normally dephosphorylated and inactive. Receptor stimulation results in dimerization/oligomerization and subsequent apposition of JAK proteins, which are now capable of trans-phosphorylation as they are brought in close proximity. This activates JAKs to phosphorylate the receptor cytoplasmic domains, creating phosphotyrosine ligands for the SH2 domains of STAT proteins. Once recruited to the receptor, STAT proteins are also tyrosine phosphorylated by JAKs, a phosphorylation event which occurs on a single tyrosine residue that is found at around residue 700 of all STATs. Tyrosine phosphorylation of STATs may allow formation and/or conformational reorganization of the activated STAT dimer, involving reciprocal SH2 domain-phosphotyrosine interactions between STAT monomers. Although STAT activation downstream of cytokine receptors in the JAK-STAT pathway is the best studied, STATs may also be activated by other means, including growth factor receptors [e.g. epidermal growth factor (EGF; see the record for Velvet) and platelet-derived growth factor (PDGF) receptors] potentially through the function of the Src nonreceptor tyrosine kinase, and by G-protein coupled seven-transmembrane receptors (21-23). Phosphorylated, activated STATs enter the nucleus and accumulate there to promote transcription (24). For more information on JAK-STAT signaling, see the record for domino.

Termination of STAT signaling requires ending both transcriptional activation and cytoplasmic STAT signaling. Protein tyrosine phosphatases including SHP1 (see the record for styx) and SHP2 prevent further cytoplasmic STAT tyrosine phosphorylation (25;26). SOCS proteins are recruited to active receptor complexes to induce inhibition. The SOCS proteins can directly bind and suppress JAKs or can compete with STATs for receptor binding (27;28). The inhibitory function of SOCS2 is dependent both on competitive binding via its SH2 domain and on SOCS2-mediated ubiquitination and proteasomal-mediated degradation by functioning in the SOCS2-Elongin B/C E3 ubiquitin ligase complex.

SOCS2 has several purported functions including the regulation of growth, metabolism, central nervous system development, cancer, and response to infection through either the positive or negative regulation of several signaling pathways including the GH receptor (GHR), insulin growth factor (IGF)-I receptor, prolactin, IL-2, IL-3, EPO receptor (EPOR), LIF, epidermal growth factor receptor (EGFR), IFN–α, leptin receptor (LEPR), FMS-like tyrosine kinase 3 (FLT3), and aryl hydrocarbon receptor (AhR)-dependent signaling pathways [Table 2; reviewed in (13)]. Several functions of SOCS2 are described in more detail, below.

Table 2. SOCS2 regulates several signaling pathways.

Signaling pathway	Summary of SOCS2-related biological role	Associated Mutagenetix page (if applicable)	References
GHR	Somatic growth and metabolism; central nervous system development	gnome	(29;30)
IGF-IR	Somatic growth and metabolism	---	(10)
LEPR	Metabolism	Business_class	(31)
IL-2 and IL-3	Response to infections	---	(32)
LIF		---	(1)
IFN–α		macro-1	(33)
AhR and LXAR		---	(18)
Pyk2			(14)
TLR4		lps3	(19)
NGF	Central nervous system development	---	(34)
EPOR		---	(31;35)
EGFR		Velvet	(36)
FLT3	Mediates the proliferation, survival, and differentiation of hematopoietic stem cells and progenitor cells	warmflash	(37;38)
Prolactin	Mammary gland development	---	(39;40)

Abbreviations: GHR, growth hormone receptor; IGF-IR, insulin growth factor-I receptor; LEPR, leptin receptor; IL-2, interleukin-2; IL-3, interleukin-3; LIF, leukemia inhibitory factor; IFN–α, interferon-alpha; AhR, aryl-hydrocarbon receptor; LXAR, LXR alpha (alternatively, nuclear receptor subfamily 1, group H, member 3 (NR1H3); Pyk2, PTK2 protein tyrosine kinase 2 beta; TLR4, toll-like receptor 4; NGF, nerve growth factor; EPOR, erythropoietin receptor, EGFR, epidermal growth factor receptor; FLT3, FMS-like tyrosine kinase 3

Figure 6. SOCS2 and GHR signaling. Growth hormone binds the growth hormone receptor, causing the dimerization of the GHR. The major intracellular pathways currently identified are the JAK–STAT pathways and the Ras–Raf pathway. Phosphorylation of JAK2 and the GHR recruit several signaling proteins including MAPKs, IRS1, PI3K, DAG, PKC, calcium and STATs. GHR-associated signaling contributes to changes in growth and metabolism. Activation of PI3K and IRS1 by GH signaling results in increased glucose uptake by effecting the translocation of GLUT4 from an intracellular compartment to the plasma membrane. PI3K also activates the AKT pathway through PDK1, resulting in cell survival. SOCS2 and SHP1 downregulate GHR-associated signaling. See the text for more details. Abbreviations: Grb2, growth factor receptor bound 2; JAK2, Janus kinase 2; IRS, insulin receptor substrate; SHP-2, protein tyrosine phosphatase; MAPK, mitogen-activated protein kinase; MAPKK, mitogen-activated protein kinase kinase; PI-3K, phosphatidylinositol-3′-kinase; Raf, protooncogene protein raf; Ras, proto-oncogene protein P21 (ras); SHC, Src homology containing protein; SOS, son of sevenless protein; STAT, signal transducers and activators of transcription.

SOCS2 function in GHR signaling

Growth hormone receptor (GHR) signaling regulates postnatal longitudinal growth, stimulates differentiation and mitogenesis, and modulates lipid, nitrogen, and mineral metabolism. The GHR signals through the JAK2/STAT5b signaling pathway (Figure 6). Upon binding of GH to the GHR, the GHR dimerizes and activates JAK2, which recruits STAT5. STAT5 dimerizes and translocates to the nucleus where it regulates the transcription of several target genes including those that encode IGF-I, IGF binding protein 3 (IGFBP3), SOCS1, SOCS2, and SOCS3, and CIS. GHR-associated signaling can also activate ERK (see the record for wabasha) through SRC, phospholipase C (PLC)γ (see the record for queen), and RAS, or by JAK2 via SH2-domain containing transforming protein (SHC), growth factor receptor-bound protein (GRB), and son of sevenless (SOS).

SOCS2 has a dual effect on GH-associated signaling by inhibiting the signaling at low concentrations, but stimulating signaling when highly expressed (29;30). SOCS2 interacts with the growth hormone receptor (GHR) and negatively regulates GHR-associated signaling by mediating the ubiqutination and proteasomal degradation of the GHR (4;7;30). SOCS2 binding to the GHR may also block the association between the GHR and positive regulators (4;5;41). SOCS2 may block access of STAT5 to the activated GHR; SOCS2 binds Tyr595 on the GHR, a known binding site for STAT5 (42).

SOCS2 regulates normal intestinal growth by limiting the actions of GH and/or GH-induced IGF-I on intestinal epithelial cell proliferation and mucosal growth (16). In Caco-2 cells, SOCS2 overexpression inhibited cell proliferation and promoted differentiation. In addition, in IEC-6 cells, GH induced SOCS2 expression, but reduced basal or IGF-I-induced proliferation. In isolated crypts from Socs2^-/- mice, GH did not reduce the proliferative activity as observed in wild-type crypts.

Socs2^-/- mice exhibit a 30-50% increase in body weight and length by 12 weeks of age (30;43-45). The increased growth was less marked in the female mice in that the females attained the weight of wild-type male mice on average (44). The increase body weights in the Socs2^-/- mice is not due increased fat tissue, but due to a proportional enlargement of bone and muscle tissue as well as increased internal organ size and an increase in body length (44;46). The trabecular and cortical volumetric bone mineral density in the Socs2^-/- mice is reduced compared to wild-type mice (47). The increased organ weights was due to elevated cell numbers rather than increased cell size (44). The Socs2^-/- mice exhibit changes in major urinary protein levels, thickening of dermal layers due to collagen deposition, and elevated Igf1 mRNA in some tissues including heart, lungs, and spleen (44).

High growth (hg) mice have a spontaneous 500 Kb deletion within chromosome 10 affecting intron 2 of Socs2 as well as Raidd/Cradd (caspase and RIP adaptor with death domain) and Plexin C1 (viral encoded semaphorin receptor) (48;49). The two deletion breakpoints reside within intron 2 of both Socs2 and Plexin C1, leading to the formation of a Socs2-Plexin C1 fusion transcript  (48). The hg mice exhibit a similar phenotype to the Socs2^-/- mice in that they exhibit a 30-50% increase in postweaning growth, an increase in skin collagen content, increased organ and skeletal growth, and an increase in muscle mass (45;50;51). The hg mice have increased levels of plasma IGF-I with a concomitant decrease in plasma and pituitary GH (52).

Transgenic mice that overexpress SOCS2 (SOCS2-TG) also exhibit a mild excessive growth phenotype (30).

Neuron-related functions

SOCS2 has several functions in neurons. SOCS2 regulates the differentiation of neural progenitor cells into neurons and blocks GH-associated inhibition of neural progenitor cell differentiation by blocking GH-mediated downregulation of neurogenin-1 (NGN-1) (11). Socs2^-/- mice have decreased neuronal density and NGN1-expressing cells in the cortex and a reduction in the number of neural stem cells (11).

SOCS2 is a regulator of nerve growth factor (NGF) signaling (34). NGF binds to the tropomyosin receptor kinase A (TrkA) receptor to promote neuronal survival and neurite extension (34). Neuronal survival is promoted through the inhibition of apoptosis signaling through the activation of PI3K and AKT. Ras-mediated signaling and PLC activate the MAP kinase pathway to stimulate proliferation. The level of SOCS2 expression is proportional to the degree of neurite outgrowth in cortical neurons and differentiated neurospheres. SOCS2-TG exhibited increased neurite outgrowth. Differentiated neurospheres from the SOCS2-TG mice had more neurons with more complex processes (36;53). Increased SOCS2 expression resulted in NGF-dependent neurite outgrowth and increased TrkA receptor surface localization in dorsal root ganglion neurons and PC12 cells with a concomitant increased activation of pAKT and pERK1/2 (34). Socs2^-/- mice had reduced neurite numbers and neurite length (36).

SOCS2 binds to epidermal growth factor receptor (EGFR) and results in the phosphorylation of EGFR to regulate neurite outgrowth; see the record Velvet for information about EGFR-related signaling (36;54). SOCS2 and EGFR promote both primary neurite number and neurite length in an EGFR kinase- and Src kinase-dependent manner (54). SOCS2 mediates these effects by competing with SHP2 for binding to the EGFR.

Immune-related functions

SOCS2 has immune-related functions. Socs2^-/- mice exhibit decreased microbial proliferation, production of proinflammatory cytokines, leukocyte infiltration, and high mortality upon infection (18). Socs2^-/- mice exhibit abnormal leukcoyte infiltration, uncontrolled production of proinflammatory cytokines, decreased microbial proliferation, and increased mortality upon infection. The number of peripheral platelets, lymphocytes, monocytes, neutrophils and eosinophils was normal in the Socs2^-/- mice (44). The Socs2^-/- mice had increased inflammatory signaling in the liver and adipose tissues (55). The expression of IL-6, IFN-γ, RANTES (CCL5), iNOS, and NOX were increased in the livers of the high fat diet (HFD)-fed Socs2^-/- mice compared to the HFD-fed wild-type mice (55). In the liver, phosphorylation of p65 NF-κB was increased and IκBα levels were decreased in the Socs2^-/- mice; both were exacerbated with the HFD (55). The levels of IFN-γ, CCL2, and IL-1β were higher in adipose tissues of the Socs2^-/- mice compared to HFD-fed wild-type mice (55). Socs2^-/- mice exhibited elevated IgE, eosinophilia, type 2 responses, and inflammatory pathology in atopic dermatitis and allergen (OVA)-induced airway inflammation models compared to wild-type mice (56). SOCS2 expression in activated CD4⁺ T cells can regulate IL-2 and IL-3 signals (32). CD4⁺ T cells from Socs2^-/- mice have increased IL-4, IL-5, and IL-13 production as well as CD4⁺ T helper 2 (Th2) differentiation compared to those from wild-type mice. In addition, the SOCS2^−/− CD4⁺ T cells have increased SOCS3- and IL-4-induced STAT6, but reduced IL-6-induced STAT3 phosphorylation compared to wild-type CD4⁺ T cells (56).

During IL-15-mediated NK priming, SOCS2 interacts with and ubiquitinates phosphorylated proline-rich tyrosine kinase 2 (Pyk2) to promote the proteasome-mediated degradation of Pyk2 and subsequent NK effector functions (14). RNA interference (RNAi)-mediated knockdown of SOCS2 resulted in compromised natural killer (NK) cell effector functions including IL-15-primed NK cell cytotoxicity and IFN-γ production (14). Loss of SOCS2 expression did not have an impact on IL-15 receptor signaling, IL-15-mediated NK cell differentiation, or IL-15-dependent NK cell survival (14).

SOCS1 and SOCS3 are known to negatively regulate TLR signaling in macrophage and DC maturation (57;58). SOCS2 is a feedback inhibitor of TLR-induced DC maturation and activation (19).  In DCs, SOCS2 is a TLR-responsive gene. IL-10 and IL-1β expression was increased upon silencing of SOCS2 expression in DCs (19). In addition, IL-10-independent STAT3 phosphorylation was increased in SOCS2-deficient DCs (19). SOCS2-deficient immature DCs stimulated with lipopolysaccharide (LPS), a TLR4 ligand, failed to express CD83, a marker of DC maturation. In addition, the expression of co-stimulatory molecules CD40 (see the record for walla), CD86, and the MHC class II receptor HLA-DR on the stimulated cells was reduced. Silencing of SOCS2 resulted in reduced TLR4-associated MyD88-dependent and –independent signaling including a reduction in LPS-inducible genes encoding TNF-α (see the record for PanR1), IL-6, IL-1β, CCL-4, INF-β, CXCL-9 and CXCL-10 (59). SOCS2 deficiency also results in a decrease in LPS-induced NF-κB nuclear translocation (see the record for Finlay) (60), the phosphorylation of IRF3 (61), and the activation of MAP kinases (62). In dendritic cells, SOCS2 also targets TNFR-associated factors 2 and 6 for proteasome-mediated degradation (18).

Humans conditions

Mutations in SOCS2 have been linked to increased susceptibility to type 2 diabetes in the Japanese population (63).

Putative Mechanism

Similar to the hg and Socs2^-/- mice, samson mice exhibit an increase in body weights, indicating a loss of function of the SOCS2^samson protein, if expressed. Other SOCS2-related functions in samson have not been examined.

Primers

PCR Primer
samson_pcr_F: TCAGATGAACCACACTGTCAAACTGTT
samson_pcr_R: GCCTTGGTAAACTTTAACTCACAGGCT

Sequencing Primer
samson_seq_F: ACTCAATCCGCAGGTTAGTC
samson_seq_R: ggaggtgagtgaagaagaacaag

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 548 nucleotides is amplified (chromosome 10, - strand):

1   gccttggtaa actttaactc acaggcttta aaaaaaaaaa aaaaaggtgt aacaagagaa
61  attagttgag cactgtggta caggtttata aatcccaaga cttgggaggt gagtgaagaa
121 gaacaagaag gttcaaggtt atccttggct acaaagtaaa attgaggcca gcctgggcta
181 caggctgccc tgtctcaaac aaagcaaacc gactagaaaa acgactgcca agtacagacc
241 atactctaaa aattcttaat aataactatt tcactttctc ttctttttct tttttgaatg
301 aaaaacccca ggatggtact ggggaagtat gactgttaat gaagccaaag agaaattaaa
361 agaggctcca gaaggaactt tcttgattag agatagttcg cattcagact acctactaac
421 tatatccgtt aagacgtcag ctggaccgac taacctgcgg attgagtacc aagatgggaa
481 attcagattg gattctatca tatgtgtcaa gtccaagctt aaacagtttg acagtgtggt
541 tcatctga

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Minamoto, S., Ikegame, K., Ueno, K., Narazaki, M., Naka, T., Yamamoto, H., Matsumoto, T., Saito, H., Hosoe, S., and Kishimoto, T. (1997) Cloning and Functional Analysis of New Members of STAT Induced STAT Inhibitor (SSI) Family: SSI-2 and SSI-3. Biochem Biophys Res Commun. 237, 79-83.

  2. Masuhara, M., Sakamoto, H., Matsumoto, A., Suzuki, R., Yasukawa, H., Mitsui, K., Wakioka, T., Tanimura, S., Sasaki, A., Misawa, H., Yokouchi, M., Ohtsubo, M., and Yoshimura, A. (1997) Cloning and Characterization of Novel CIS Family Genes. Biochem Biophys Res Commun. 239, 439-446.

  3. Biener, E., Maurice, S., Sandowski, Y., Cohen, Y., Gusakowsky, E. E., Hooghe, R., Yoshimura, A., Livnah, O., and Gertler, A. (2002) Recombinant Human CIS2 (SOCS2) Protein: Subcloning, Expression, Purification, and Characterization. Protein Expr Purif. 25, 305-312.

  4. Greenhalgh, C. J., Rico-Bautista, E., Lorentzon, M., Thaus, A. L., Morgan, P. O., Willson, T. A., Zervoudakis, P., Metcalf, D., Street, I., Nicola, N. A., Nash, A. D., Fabri, L. J., Norstedt, G., Ohlsson, C., Flores-Morales, A., Alexander, W. S., and Hilton, D. J. (2005) SOCS2 Negatively Regulates Growth Hormone Action in Vitro and in Vivo. J Clin Invest. 115, 397-406.

  5. Bullock, A. N., Debreczeni, J. E., Edwards, A. M., Sundstrom, M., and Knapp, S. (2006) Crystal Structure of the SOCS2-Elongin C-Elongin B Complex Defines a Prototypical SOCS Box Ubiquitin Ligase. Proc Natl Acad Sci U S A. 103, 7637-7642.

  6. Zhang, J. G., Farley, A., Nicholson, S. E., Willson, T. A., Zugaro, L. M., Simpson, R. J., Moritz, R. L., Cary, D., Richardson, R., Hausmann, G., Kile, B. J., Kent, S. B., Alexander, W. S., Metcalf, D., Hilton, D. J., Nicola, N. A., and Baca, M. (1999) The Conserved SOCS Box Motif in Suppressors of Cytokine Signaling Binds to Elongins B and C and may Couple Bound Proteins to Proteasomal Degradation. Proc Natl Acad Sci U S A. 96, 2071-2076.

  7. Vesterlund, M., Zadjali, F., Persson, T., Nielsen, M. L., Kessler, B. M., Norstedt, G., and Flores-Morales, A. (2011) The SOCS2 Ubiquitin Ligase Complex Regulates Growth Hormone Receptor Levels. PLoS One. 6, e25358.

  8. Kamura, T., Burian, D., Yan, Q., Schmidt, S. L., Lane, W. S., Querido, E., Branton, P. E., Shilatifard, A., Conaway, R. C., and Conaway, J. W. (2001) Muf1, a Novel Elongin BC-Interacting Leucine-Rich Repeat Protein that can Assemble with Cul5 and Rbx1 to Reconstitute a Ubiquitin Ligase. J Biol Chem. 276, 29748-29753.

  9. Babon, J. J., Yao, S., DeSouza, D. P., Harrison, C. F., Fabri, L. J., Liepinsh, E., Scrofani, S. D., Baca, M., and Norton, R. S. (2005) Secondary Structure Assignment of Mouse SOCS3 by NMR Defines the Domain Boundaries and Identifies an Unstructured Insertion in the SH2 Domain. FEBS J. 272, 6120-6130.

  10. Dey, B. R., Spence, S. L., Nissley, P., and Furlanetto, R. W. (1998) Interaction of Human Suppressor of Cytokine Signaling (SOCS)-2 with the Insulin-Like Growth Factor-I Receptor. J Biol Chem. 273, 24095-24101.

  11. Turnley, A. M., Faux, C. H., Rietze, R. L., Coonan, J. R., and Bartlett, P. F. (2002) Suppressor of Cytokine Signaling 2 Regulates Neuronal Differentiation by Inhibiting Growth Hormone Signaling. Nat Neurosci. 5, 1155-1162.

  12. Polizzotto, M. N., Bartlett, P. F., and Turnley, A. M. (2000) Expression of "Suppressor of Cytokine Signalling" (SOCS) Genes in the Developing and Adult Mouse Nervous System. J Comp Neurol. 423, 348-358.

  13. Rico-Bautista, E., Flores-Morales, A., and Fernandez-Perez, L. (2006) Suppressor of Cytokine Signaling (SOCS) 2, a Protein with Multiple Functions. Cytokine Growth Factor Rev. 17, 431-439.

  14. Lee, S. H., Yun, S., Piao, Z. H., Jeong, M., Kim, D. O., Jung, H., Lee, J., Kim, M. J., Kim, M. S., Chung, J. W., Kim, T. D., Yoon, S. R., Greenberg, P. D., and Choi, I. (2010) Suppressor of Cytokine Signaling 2 Regulates IL-15-Primed Human NK Cell Function Via Control of Phosphorylated Pyk2. J Immunol. 185, 917-928.

  15. Starr, R., Willson, T. A., Viney, E. M., Murray, L. J., Rayner, J. R., Jenkins, B. J., Gonda, T. J., Alexander, W. S., Metcalf, D., Nicola, N. A., and Hilton, D. J. (1997) A Family of Cytokine-Inducible Inhibitors of Signalling. Nature. 387, 917-921.

  16. Miller, M. E., Michaylira, C. Z., Simmons, J. G., Ney, D. M., Dahly, E. M., Heath, J. K., and Lund, P. K. (2004) Suppressor of Cytokine Signaling-2: A Growth Hormone-Inducible Inhibitor of Intestinal Epithelial Cell Proliferation. Gastroenterology. 127, 570-581.

  17. Tollet-Egnell, P., Flores-Morales, A., Stavreus-Evers, A., Sahlin, L., and Norstedt, G. (1999) Growth Hormone Regulation of SOCS-2, SOCS-3, and CIS Messenger Ribonucleic Acid Expression in the Rat. Endocrinology. 140, 3693-3704.

  18. Machado, F. S., Johndrow, J. E., Esper, L., Dias, A., Bafica, A., Serhan, C. N., and Aliberti, J. (2006) Anti-Inflammatory Actions of Lipoxin A4 and Aspirin-Triggered Lipoxin are SOCS-2 Dependent. Nat Med. 12, 330-334.

  19. Posselt, G., Schwarz, H., Duschl, A., and Horejs-Hoeck, J. (2011) Suppressor of Cytokine Signaling 2 is a Feedback Inhibitor of TLR-Induced Activation in Human Monocyte-Derived Dendritic Cells. J Immunol. 187, 2875-2884.

  20. Leung, K. C., Doyle, N., Ballesteros, M., Sjogren, K., Watts, C. K., Low, T. H., Leong, G. M., Ross, R. J., and Ho, K. K. (2003) Estrogen Inhibits GH Signaling by Suppressing GH-Induced JAK2 Phosphorylation, an Effect Mediated by SOCS-2. Proc Natl Acad Sci U S A. 100, 1016-1021.

  21. Vignais, M. L., Sadowski, H. B., Watling, D., Rogers, N. C., and Gilman, M. (1996) Platelet-Derived Growth Factor Induces Phosphorylation of Multiple JAK Family Kinases and STAT Proteins. Mol Cell Biol. 16, 1759-1769.

  22. Leaman, D. W., Pisharody, S., Flickinger, T. W., Commane, M. A., Schlessinger, J., Kerr, I. M., Levy, D. E., and Stark, G. R. (1996) Roles of JAKs in Activation of STATs and Stimulation of c-Fos Gene Expression by Epidermal Growth Factor. Mol Cell Biol. 16, 369-375.

  23. Madamanchi, N. R., Li, S., Patterson, C., and Runge, M. S. (2001) Thrombin Regulates Vascular Smooth Muscle Cell Growth and Heat Shock Proteins Via the JAK-STAT Pathway. J Biol Chem. 276, 18915-18924.

  24. Schindler, C., Shuai, K., Prezioso, V. R., and Darnell, J. E.,Jr. (1992) Interferon-Dependent Tyrosine Phosphorylation of a Latent Cytoplasmic Transcription Factor. Science. 257, 809-813.

  25. David, M., Chen, H. E., Goelz, S., Larner, A. C., and Neel, B. G. (1995) Differential Regulation of the alpha/beta Interferon-Stimulated Jak/Stat Pathway by the SH2 Domain-Containing Tyrosine Phosphatase SHPTP1. Mol Cell Biol. 15, 7050-7058.

  26. You, M., Yu, D. H., and Feng, G. S. (1999) Shp-2 Tyrosine Phosphatase Functions as a Negative Regulator of the Interferon-Stimulated Jak/STAT Pathway. Mol Cell Biol. 19, 2416-2424.

  27. Endo, T. A., Masuhara, M., Yokouchi, M., Suzuki, R., Sakamoto, H., Mitsui, K., Matsumoto, A., Tanimura, S., Ohtsubo, M., Misawa, H., Miyazaki, T., Leonor, N., Taniguchi, T., Fujita, T., Kanakura, Y., Komiya, S., and Yoshimura, A. (1997) A New Protein Containing an SH2 Domain that Inhibits JAK Kinases. Nature. 387, 921-924.

  28. Naka, T., Narazaki, M., Hirata, M., Matsumoto, T., Minamoto, S., Aono, A., Nishimoto, N., Kajita, T., Taga, T., Yoshizaki, K., Akira, S., and Kishimoto, T. (1997) Structure and Function of a New STAT-Induced STAT Inhibitor. Nature. 387, 924-929.

  29. Favre, H., Benhamou, A., Finidori, J., Kelly, P. A., and Edery, M. (1999) Dual Effects of Suppressor of Cytokine Signaling (SOCS-2) on Growth Hormone Signal Transduction. FEBS Lett. 453, 63-66.

  30. Greenhalgh, C. J., Metcalf, D., Thaus, A. L., Corbin, J. E., Uren, R., Morgan, P. O., Fabri, L. J., Zhang, J. G., Martin, H. M., Willson, T. A., Billestrup, N., Nicola, N. A., Baca, M., Alexander, W. S., and Hilton, D. J. (2002) Biological Evidence that SOCS-2 can Act either as an Enhancer Or Suppressor of Growth Hormone Signaling. J Biol Chem. 277, 40181-40184.

  31. Lavens, D., Ulrichts, P., Catteeuw, D., Gevaert, K., Vandekerckhove, J., Peelman, F., Eyckerman, S., and Tavernier, J. (2007) The C-Terminus of CIS Defines its Interaction Pattern. Biochem J. 401, 257-267.

  32. Tannahill, G. M., Elliott, J., Barry, A. C., Hibbert, L., Cacalano, N. A., and Johnston, J. A. (2005) SOCS2 can Enhance Interleukin-2 (IL-2) and IL-3 Signaling by Accelerating SOCS3 Degradation. Mol Cell Biol. 25, 9115-9126.

  33. Shen, X., Hong, F., Nguyen, V. A., and Gao, B. (2000) IL-10 Attenuates IFN-Alpha-Activated STAT1 in the Liver: Involvement of SOCS2 and SOCS3. FEBS Lett. 480, 132-136.

  34. Uren, R. T., Turbic, A., Wong, A. W., Klein, R., Murray, S. S., and Turnley, A. M. (2014) A Novel Role of Suppressor of Cytokine Signaling-2 in the Regulation of TrkA Neurotrophin Receptor Biology. J Neurochem. 129, 614-627.

  35. Jegalian, A. G., and Wu, H. (2002) Differential Roles of SOCS Family Members in EpoR Signal Transduction. J Interferon Cytokine Res. 22, 853-860.

  36. Goldshmit, Y., Walters, C. E., Scott, H. J., Greenhalgh, C. J., and Turnley, A. M. (2004) SOCS2 Induces Neurite Outgrowth by Regulation of Epidermal Growth Factor Receptor Activation. J Biol Chem. 279, 16349-16355.

  37. Masson, K., and Ronnstrand, L. (2009) Oncogenic Signaling from the Hematopoietic Growth Factor Receptors c-Kit and Flt3. Cell Signal. 21, 1717-1726.

  38. Kazi, J. U., and Ronnstrand, L. (2013) Suppressor of Cytokine Signaling 2 (SOCS2) Associates with FLT3 and Negatively Regulates Downstream Signaling. Mol Oncol. 7, 693-703.

  39. Pezet, A., Favre, H., Kelly, P. A., and Edery, M. (1999) Inhibition and Restoration of Prolactin Signal Transduction by Suppressors of Cytokine Signaling. J Biol Chem. 274, 24497-24502.

  40. Harris, J., Stanford, P. M., Sutherland, K., Oakes, S. R., Naylor, M. J., Robertson, F. G., Blazek, K. D., Kazlauskas, M., Hilton, H. N., Wittlin, S., Alexander, W. S., Lindeman, G. J., Visvader, J. E., and Ormandy, C. J. (2006) Socs2 and elf5 Mediate Prolactin-Induced Mammary Gland Development. Mol Endocrinol. 20, 1177-1187.

  41. Uyttendaele, I., Lemmens, I., Verhee, A., De Smet, A. S., Vandekerckhove, J., Lavens, D., Peelman, F., and Tavernier, J. (2007) Mammalian Protein-Protein Interaction Trap (MAPPIT) Analysis of STAT5, CIS, and SOCS2 Interactions with the Growth Hormone Receptor. Mol Endocrinol. 21, 2821-2831.

  42. Smit, L. S., Meyer, D. J., Billestrup, N., Norstedt, G., Schwartz, J., and Carter-Su, C. (1996) The Role of the Growth Hormone (GH) Receptor and JAK1 and JAK2 Kinases in the Activation of Stats 1, 3, and 5 by GH. Mol Endocrinol. 10, 519-533.

  43. Greenhalgh, C. J., Bertolino, P., Asa, S. L., Metcalf, D., Corbin, J. E., Adams, T. E., Davey, H. W., Nicola, N. A., Hilton, D. J., and Alexander, W. S. (2002) Growth Enhancement in Suppressor of Cytokine Signaling 2 (SOCS-2)-Deficient Mice is Dependent on Signal Transducer and Activator of Transcription 5b (STAT5b). Mol Endocrinol. 16, 1394-1406.

  44. Metcalf, D., Greenhalgh, C. J., Viney, E., Willson, T. A., Starr, R., Nicola, N. A., Hilton, D. J., and Alexander, W. S. (2000) Gigantism in Mice Lacking Suppressor of Cytokine Signalling-2. Nature. 405, 1069-1073.

  45. Horvat, S., and Medrano, J. F. (2001) Lack of Socs2 Expression Causes the High-Growth Phenotype in Mice. Genomics. 72, 209-212.

  46. Dobie, R., MacRae, V. E., Huesa, C., van't Hof, R., Ahmed, S. F., and Farquharson, C. (2014) Direct Stimulation of Bone Mass by Increased GH Signalling in the Osteoblasts of Socs2-/- Mice. J Endocrinol. 223, 93-106.

  47. Lorentzon, M., Greenhalgh, C. J., Mohan, S., Alexander, W. S., and Ohlsson, C. (2005) Reduced Bone Mineral Density in SOCS-2-Deficient Mice. Pediatr Res. 57, 223-226.

  48. Wong, M. L., Islas-Trejo, A., and Medrano, J. F. (2002) Structural Characterization of the Mouse High Growth Deletion and Discovery of a Novel Fusion Transcript between Suppressor of Cytokine Signaling-2 (Socs-2) and Viral Encoded Semaphorin Receptor (Plexin C1). Gene. 299, 153-163.

  49. Horvat, S., and Medrano, J. F. (1996) Fine Genetic Mapping of the Region Surrounding the High Growth (Hg) Locus in Mouse Chromosome 10: Targeting Random Amplified Polymorphic DNA (RAPD) Markers. Mamm Genome. 7, 312-314.

  50. Famula, T. R., Calvert, C. C., Luna, E., and Bradford, G. E. (1988) Organ and Skeletal Growth in Mice with a Major Gene for Rapid Postweaning Growth. Growth Dev Aging. 52, 145-150.

  51. Summers, P. J., and Medrano, J. F. (1994) Morphometric Analysis of Skeletal Muscle Growth in the High Growth Mouse. Growth Dev Aging. 58, 135-148.

  52. Medrano, J. F., Pomp, D., Sharrow, L., Bradford, G. E., Downs, T. R., and Frohman, L. A. (1991) Growth Hormone and Insulin-Like Growth Factor-I Measurements in High Growth (Hg) Mice. Genet Res. 58, 67-74.

  53. Scott, H. J., Stebbing, M. J., Walters, C. E., McLenachan, S., Ransome, M. I., Nichols, N. R., and Turnley, A. M. (2006) Differential Effects of SOCS2 on Neuronal Differentiation and Morphology. Brain Res. 1067, 138-145.

  54. Goldshmit, Y., Greenhalgh, C. J., and Turnley, A. M. (2004) Suppressor of Cytokine Signalling-2 and Epidermal Growth Factor Regulate Neurite Outgrowth of Cortical Neurons. Eur J Neurosci. 20, 2260-2266.

  55. Zadjali, F., Santana-Farre, R., Vesterlund, M., Carow, B., Mirecki-Garrido, M., Hernandez-Hernandez, I., Flodstrom-Tullberg, M., Parini, P., Rottenberg, M., Norstedt, G., Fernandez-Perez, L., and Flores-Morales, A. (2012) SOCS2 Deletion Protects Against Hepatic Steatosis but Worsens Insulin Resistance in High-Fat-Diet-Fed Mice. FASEB J. 26, 3282-3291.

  56. Knosp, C. A., Carroll, H. P., Elliott, J., Saunders, S. P., Nel, H. J., Amu, S., Pratt, J. C., Spence, S., Doran, E., Cooke, N., Jackson, R., Swift, J., Fitzgerald, D. C., Heaney, L. G., Fallon, P. G., Kissenpfennig, A., and Johnston, J. A. (2011) SOCS2 Regulates T Helper Type 2 Differentiation and the Generation of Type 2 Allergic Responses. J Exp Med. 208, 1523-1531.

  57. Kinjyo, I., Hanada, T., Inagaki-Ohara, K., Mori, H., Aki, D., Ohishi, M., Yoshida, H., Kubo, M., and Yoshimura, A. (2002) SOCS1/JAB is a Negative Regulator of LPS-Induced Macrophage Activation. Immunity. 17, 583-591.

  58. Yoshimura, A., Naka, T., and Kubo, M. (2007) SOCS Proteins, Cytokine Signalling and Immune Regulation. Nat Rev Immunol. 7, 454-465.

  59. Hu, J., Winqvist, O., Flores-Morales, A., Wikstrom, A. C., and Norstedt, G. (2009) SOCS2 Influences LPS Induced Human Monocyte-Derived Dendritic Cell Maturation. PLoS One. 4, e7178.

  60. Carmody, R. J., and Chen, Y. H. (2007) Nuclear Factor-kappaB: Activation and Regulation during Toll-Like Receptor Signaling. Cell Mol Immunol. 4, 31-41.

  61. Doyle, S., Vaidya, S., O'Connell, R., Dadgostar, H., Dempsey, P., Wu, T., Rao, G., Sun, R., Haberland, M., Modlin, R., and Cheng, G. (2002) IRF3 Mediates a TLR3/TLR4-Specific Antiviral Gene Program. Immunity. 17, 251-263.

  62. Nakahara, T., Moroi, Y., Uchi, H., and Furue, M. (2006) Differential Role of MAPK Signaling in Human Dendritic Cell Maturation and Th1/Th2 Engagement. J Dermatol Sci. 42, 1-11.

  63. Kato, H., Nomura, K., Osabe, D., Shinohara, S., Mizumori, O., Katashima, R., Iwasaki, S., Nishimura, K., Yoshino, M., Kobori, M., Ichiishi, E., Nakamura, N., Yoshikawa, T., Tanahashi, T., Keshavarz, P., Kunika, K., Moritani, M., Kudo, E., Tsugawa, K., Takata, Y., Hamada, D., Yasui, N., Miyamoto, T., Shiota, H., Inoue, H., and Itakura, M. (2006) Association of Single-Nucleotide Polymorphisms in the Suppressor of Cytokine Signaling 2 (SOCS2) Gene with Type 2 Diabetes in the Japanese. Genomics. 87, 446-458.