Phenotypic Mutation 'ares' (pdf version)
List |< first << previous [record 22 of 511] next >> last >|
Alleleares
Mutation Type nonsense
Chromosome6
Coordinate85,621,275 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Alms1
Gene Name Alstrom syndrome 1
Chromosomal Location 85,587,531-85,702,753 bp (+)
MGI Phenotype Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss.
Accession Number

NCBI RefSeq: NM_145223; MGI:1934606

Mapped Yes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model not available
SMART Domains Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: Q1028*

DomainStartEndE-ValueType
coiled coil region 10 39 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
Blast:MYSc 127 233 1e-21 BLAST
internal_repeat_3 408 511 2.48e-7 PROSPERO
internal_repeat_2 414 804 2.09e-12 PROSPERO
internal_repeat_1 438 834 4.54e-18 PROSPERO
internal_repeat_3 652 757 2.48e-7 PROSPERO
low complexity region 903 908 N/A INTRINSIC
internal_repeat_1 916 1385 4.54e-18 PROSPERO
internal_repeat_2 1024 1390 2.09e-12 PROSPERO
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2760 2773 N/A INTRINSIC
low complexity region 2950 2968 N/A INTRINSIC
low complexity region 3013 3030 N/A INTRINSIC
Pfam:ALMS_motif 3125 3247 1.8e-42 PFAM
Predicted Effect probably null
Phenotypic Category adipose tissue, growth/size, increase in body weight
Penetrance  
Alleles Listed at MGI

All mutations/alleles(13) : Chemically induced (ENU)(2) Gene trapped(9) Spontaneous(1) Targeted(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Alms1 APN 6 85677964 missense possibly damaging 0.94
IGL00331:Alms1 APN 6 85641371 missense possibly damaging 0.91
IGL00658:Alms1 APN 6 85628961 missense possibly damaging 0.94
IGL00835:Alms1 APN 6 85622134 missense probably damaging 1.00
IGL00930:Alms1 APN 6 85601310 missense probably damaging 0.98
IGL01446:Alms1 APN 6 85696701 missense probably damaging 1.00
IGL01448:Alms1 APN 6 85677899 missense probably benign 0.01
IGL01563:Alms1 APN 6 85627983 missense probably damaging 1.00
IGL01632:Alms1 APN 6 85627946 missense probably benign 0.07
IGL01651:Alms1 APN 6 85656476 missense possibly damaging 0.95
IGL01670:Alms1 APN 6 85678150 missense possibly damaging 0.94
IGL01716:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01719:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01720:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01723:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01877:Alms1 APN 6 85622411 missense probably benign 0.41
IGL01919:Alms1 APN 6 85628004 missense possibly damaging 0.70
IGL01976:Alms1 APN 6 85622665 missense possibly damaging 0.61
IGL02003:Alms1 APN 6 85622223 missense possibly damaging 0.54
IGL02069:Alms1 APN 6 85628823 missense probably benign 0.12
IGL02070:Alms1 APN 6 85651403 missense probably benign 0.44
IGL02079:Alms1 APN 6 85628634 missense probably damaging 0.96
IGL02081:Alms1 APN 6 85620303 missense probably benign 0.06
IGL02379:Alms1 APN 6 85629633 missense probably damaging 0.98
IGL02412:Alms1 APN 6 85628872 missense possibly damaging 0.91
IGL02606:Alms1 APN 6 85599967 missense probably benign 0.00
IGL02636:Alms1 APN 6 85628654 missense probably benign 0.28
IGL02702:Alms1 APN 6 85599849 missense probably benign 0.12
IGL02815:Alms1 APN 6 85667957 splice site probably null
IGL02926:Alms1 APN 6 85641450 missense probably damaging 1.00
IGL02945:Alms1 APN 6 85620933 missense probably damaging 0.96
IGL02959:Alms1 APN 6 85629052 nonsense probably null
IGL03124:Alms1 APN 6 85678419 missense probably benign 0.01
IGL03199:Alms1 APN 6 85622497 missense unknown 0.00
IGL03209:Alms1 APN 6 85599973 splice site 0.00
IGL03247:Alms1 APN 6 85678597 missense possibly damaging 0.74
ares2 UTSW 6 85677990 nonsense probably null
fatty UTSW 6 85627934 nonsense probably null
R0003:Alms1 UTSW 6 85629210 missense possibly damaging 0.53
R0095:Alms1 UTSW 6 85620253 missense probably benign 0.32
R0110:Alms1 UTSW 6 85620369 nonsense probably null
R0114:Alms1 UTSW 6 85619803 missense probably benign 0.01
R0153:Alms1 UTSW 6 85641381 missense probably benign 0.34
R0217:Alms1 UTSW 6 85622930 missense probably damaging 0.99
R0328:Alms1 UTSW 6 85610814 splice acceptor site probably null
R0410:Alms1 UTSW 6 85587803 missense unknown
R0469:Alms1 UTSW 6 85620369 nonsense probably null
R0491:Alms1 UTSW 6 85702600 missense probably damaging 0.98
R0510:Alms1 UTSW 6 85620369 nonsense probably null
R0522:Alms1 UTSW 6 85621615 missense probably benign 0.00
R0525:Alms1 UTSW 6 85587760 missense unknown
R0611:Alms1 UTSW 6 85678671 missense possibly damaging 0.61
R0637:Alms1 UTSW 6 85623033 missense probably benign 0.01
R0718:Alms1 UTSW 6 85621821 missense probably benign 0.00
R0831:Alms1 UTSW 6 85628520 missense probably benign 0.00
R1108:Alms1 UTSW 6 85615421 splice donor site probably benign
R1318:Alms1 UTSW 6 85628549 missense possibly damaging 0.62
R1340:Alms1 UTSW 6 85667957 critical splice donor site probably null
R1561:Alms1 UTSW 6 85629052 nonsense probably null
R1648:Alms1 UTSW 6 85678402 missense probably damaging 0.99
R1697:Alms1 UTSW 6 85622454 missense probably benign 0.21
R1699:Alms1 UTSW 6 85622880 missense probably benign 0.06
R1715:Alms1 UTSW 6 85629052 nonsense probably null
R1723:Alms1 UTSW 6 85628753 missense probably damaging 0.99
R1734:Alms1 UTSW 6 85641550 critical splice donor site probably null
R1758:Alms1 UTSW 6 85628505 missense probably damaging 0.98
R1835:Alms1 UTSW 6 85678503 missense possibly damaging 0.91
R1836:Alms1 UTSW 6 85678503 missense possibly damaging 0.91
R2077:Alms1 UTSW 6 85622309 missense possibly damaging 0.49
R2190:Alms1 UTSW 6 85667963 splice donor site probably null
R2196:Alms1 UTSW 6 85667963 splice donor site probably null
R2246:Alms1 UTSW 6 85622967 missense possibly damaging 0.91
R2254:Alms1 UTSW 6 85619848 missense possibly damaging 0.67
R2280:Alms1 UTSW 6 85677973 missense probably damaging 0.99
R2516:Alms1 UTSW 6 85667963 nonsense probably null
R2517:Alms1 UTSW 6 85667963 nonsense probably null
R2518:Alms1 UTSW 6 85667963 nonsense probably null
R2519:Alms1 UTSW 6 85667963 nonsense probably null
R2520:Alms1 UTSW 6 85667963 nonsense probably null
R2566:Alms1 UTSW 6 85622482 missense possibly damaging 0.84
R2850:Alms1 UTSW 6 85621299 missense probably benign 0.00
R2850:Alms1 UTSW 6 85667963 nonsense probably null
R2932:Alms1 UTSW 6 85620562 missense probably benign 0.32
R2944:Alms1 UTSW 6 85628391 missense probably damaging 1.00
R2980:Alms1 UTSW 6 85628835 missense probably damaging 1.00
R3084:Alms1 UTSW 6 85678140 missense probably benign
R3086:Alms1 UTSW 6 85678140 missense probably benign
R3122:Alms1 UTSW 6 85667963 nonsense probably null
R3404:Alms1 UTSW 6 85667963 nonsense probably null
R3405:Alms1 UTSW 6 85667963 nonsense probably null
R3696:Alms1 UTSW 6 85667845 missense noncoding transcript
R3804:Alms1 UTSW 6 85619647 missense possibly damaging 0.90
R3904:Alms1 UTSW 6 85621678 missense probably benign 0.00
R4014:Alms1 UTSW 6 85678352 missense probably benign 0.29
R4056:Alms1 UTSW 6 85587803 missense unknown
R4067:Alms1 UTSW 6 85621289 missense probably damaging 1.00
R4110:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4111:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4112:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4194:Alms1 UTSW 6 85677990 nonsense probably null
R4464:Alms1 UTSW 6 85620021 missense probably benign 0.02
R4539:Alms1 UTSW 6 85620478 missense possibly damaging 0.78
R4554:Alms1 UTSW 6 85624617 missense probably benign
R4696:Alms1 UTSW 6 85620522 missense probably damaging 1.00
R4825:Alms1 UTSW 6 85678245 missense probably damaging 0.99
R4921:Alms1 UTSW 6 85628546 missense probably benign
R5030:Alms1 UTSW 6 85627964 missense probably damaging 0.96
R5051:Alms1 UTSW 6 85627934 nonsense probably null
R5085:Alms1 UTSW 6 85620732 missense probably benign 0.03
R5141:Alms1 UTSW 6 85621432 missense probably benign 0.01
R5233:Alms1 UTSW 6 85656371 intron probably null
R5310:Alms1 UTSW 6 85615368 missense probably benign 0.02
R5344:Alms1 UTSW 6 85696789 missense probably benign 0.00
R5394:Alms1 UTSW 6 85623088 missense probably benign 0.00
R5460:Alms1 UTSW 6 85696731 missense probably benign 0.08
R5558:Alms1 UTSW 6 85641329 nonsense probably null
R5650:Alms1 UTSW 6 85620271 missense probably damaging 1.00
R5667:Alms1 UTSW 6 85696771 missense probably damaging 0.99
R5671:Alms1 UTSW 6 85629208 missense possibly damaging 0.80
R5688:Alms1 UTSW 6 85599895 missense possibly damaging 0.92
R5815:Alms1 UTSW 6 85622838 missense probably damaging 0.99
R5832:Alms1 UTSW 6 85667839 missense noncoding transcript
R5892:Alms1 UTSW 6 85620903 missense probably damaging 0.99
R5947:Alms1 UTSW 6 85619712 missense probably benign 0.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
X0013:Alms1 UTSW 6 85656455 missense probably damaging 1.00
X0025:Alms1 UTSW 6 85620210 missense probably benign 0.27
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm, gDNA
MMRRC Submission 038173-MU
Last Updated 06/23/2017 11:24 AM by Anne Murray
Record Created 01/08/2015 1:41 PM by Jeff SoRelle
Record Posted 03/04/2015
Phenotypic Description

Figure 1. Ares mice exhibit increased body weight. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The ares phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1804, some of which showed increased body weights compared to their littermates (Figure 1). 

Nature of Mutation

Figure 2. Linkage mapping of the increased body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 78 mutations (X-axis) identified in the G1 male of pedigree R1804. Scaled phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 78 mutations. The increased body weight phenotype was linked to a mutation in Alms1: a C to T transition at base pair 85,621,275 (v38) on chromosome 6, or base pair 33,779 in the GenBank genomic region NC_000072 encoding Alms1. Linkage was found with a recessive model of inheritance (P = 1.971 x 10-5), wherein 5 variant homozygotes departed phenotypically from 11 homozygous reference mice and 6 heterozygous mice (Figure 2). The mutation corresponds to residue 3,197 in the mRNA sequence NM_145223 within exon 8 of 23 total exons.

 

3182 GTTGGATCCACTGAACAGAAAACTCAAATACCA

1023 -V--G--S--T--E--Q--K--T--Q--I--P-

 

The mutated nucleotide is indicated in red, and converts glutamine 1028 of the ALMS1 protein to a stop codon.

Protein Prediction

Figure 3. Domain organization of ALMS1. See the text for more details. The ares mutation (Q1028*) is indicated by an asterisk. This image is interactive; click to view additional mutations in Alms1.

Alms1 encodes Alström Syndrome 1 (ALMS1), which has a glutamine-rich segment (amino acids 2-80), a proline-rich segment (amino acids 90-113), a putative leucine zipper (amino acids), a large tandem repeat domain (TRD) comprised of 34 imperfect repeats of a 45-50-amino acid sequence (amino acids 440−1362), a histidine-rich region (amino acids 2582-2618), two putative nuclear localization signals, a serine-rich region, and an ALMS motif (amino acids 3124-3251) [Figure 3; (1-4)]. The functional significance of the domains of ALMS1 is unknown. Leucine zippers often function in protein-DNA or protein-protein interactions (3). The ALMS motif is also found in two other proteins, KIAA1731 and C10orf90, both of which are centriole proteins that are proposed to function in the formation and/or stability of cilia (1;2;4;5). The ares mutation results in coding of a premature stop codon after amino acid 1,028 within the TRD.

Expression/Localization

Alms1 is ubiquitously expressed (2;6). ALMS1 expression shows tissue-specific variability, with highest expression in the testis (2;3). ALMS1 localizes to centrosomes and basal bodies of cell cilia including those in human fetal pancreas, skeletal muscle, liver, kidney, hippocampus, adipocytes, within the hair cells of the developing and functionally mature cochlea, and supporting cells in the organ of Corti (4;5;7-9). During mitosis, ALMS1 localizes to the centrosomal spindle poles and during late mitosis ALMS1 localizes to the contractile ring and the cleavage furrow (10). Alms1 mRNA is upregulated in response to serum starvation (i.e., growth arrest) (11) and downregulated during adipogenesis (12). Alms1 transcription is also regulated by regulatory factor X proteins, which regulate genes of the ciliogenic pathway (13).  

Background

Cilia regulate many physiological processes including sensory (photoreception/vision, mechanosensation/hearing, and chemosensation/olfaction), embryonic development, and male fertility (14-16). Motile cilia facilitate the movement of fluids along cell surfaces as well as sperm motility, while nonmotile (primary) cilia function in the reception and transduction of extracellular signals. Primary cilia have several functions including the intraflagellar transport of signaling proteins and receptors needed for mechanosensation of lumenal flow in kidney tubules, olfaction, photoreception, and signaling through the sonic hedgehog (Shh), Wnt, and platelet-derived growth factor receptor pathways (17). Most cells have a single nonmotile primary cilium that protrudes from the apical face of the cell and is connected to the microtubule complex through the basal body. Bidirectional intraflagellar (i.e., anterograde versus retrograde) transport between the basal body and the distal tip of the cilium mediates the transport of proteins along the primary cilium. Anterograde transport is mediated by kinesin II, while retrograde transport is mediated by dynein [reviewed in (18)].

 

Figure 4. Putative function of ALMS1. ALMS1 is proposed to be involved in intracellular trafficking of one or more uncharacterized receptors to the primary cilium membrane. ALMS1 may be involved in vesicle transport from the Golgi to the cilium and/or in intraflagellar transport. When ALMS1 is present, signals from the transported receptor regulate cellular homeostasis, neurogenesis, or organ function. In the absence of ALMS1, the receptor(s) are not transported within the cilia, resulting in defective signaling. In the absence of ALMS1 there is obesity, neurosensory deficit, and organ failure. Figure adapted from Girard, D., et al. 2011.

ALMS1 has putative roles in cell cycle regulation, cell migration, apoptosis, extracellular matrix production, ciliary assembly and/or function, adipogenesis, cytoplasmic microtubular organization, endosomal transport, and regulation of the transport of proteins between the cytoplasm and the ciliary axoneme (4-8;10;12;19;20). However, the precise role of ALMS1 in these processes is unknown. ALMS1 is not required for the initial development of cilia, but is required to maintain the structural and functional integrity of the cilia and/or for postnatal biogenesis of the cilium [Figure 4; (9)]. The C-terminus of ALMS1 interacts with the cytoskeletal actin-binding proteins α-actinin 1 and α-actinin 4 and other components of the endosomal recycling pathway including Huntington-associated protein isoform A (HAP1A), Rab interacting lysosomal protein-like 1 (RILPL1), myosin Vb (MYO5B; see the record new_gray for information about MYO5A), ring finger protein 31 (RNF31), RAD50 interactor 1 (RINT1), and CBP interacting protein 3 (CIP3 or EXOSC8) (10). Two of the ALMS1-interacting proteins, MYO5B and α-actinin isoform 4, are subunits of the cytoskeleton-associated recycling or transport (CART) complex, which functions in the constitutive recycling of receptors (e.g., the transferrin receptor and the β2-adrenergic receptor) from the early endosomes to the plasma membrane (21). Collin et al. propose that ALMS1 may be a component of the CART complex to mediate movement of endosomes along actin filaments to the plasma membrane (10). ALMS1 is also proposed to function in normal axonal development and migration through the regulation of neuronal intraflagellar transport. ALMS1 has a putative function in maintaining intraflagellar transport in hypothalamic-coupled neurons to regulate hypothalamic satiety and hunger (22). ALMS1 is required for the proper anchoring of C-NAP1, a regulator of centrosome organization during mitosis, at the distal end of the centriole (1). Loss of ALMS1 expression results in reduced expression levels of C-NAP1 and subsequent increased centrosome splitting, a necessary process for anaphase chromosomal division, as well as subsequent defects in cilium stability or formation (1). Short interfering RNA (siRNA)-mediated knockdown of Alms1 in mouse inner medullary collectin duct (mIMCD3) cells resulted in mislocalization of acetylated tubulin in the cells (8). However, the transcriptional program that accompanies cilia biogenesis of kidney epithelial cells was not changed upon loss of Alms1 expression (8). In addition, siRNA-mediated Alms1 knockdown in cultured neonatal mouse cardiomyocytes led to increased cell cycle progression (i.e., an increased percentage of cardiomyocytes in G2/M phases) and proliferation (19).

 

Homozygous or compound heterozygous mutations in ALMS1 that typically result in coding of a premature stop codon and coding of a truncated protein are linked to Alström syndrome (OMIM: #203800; (2;23)]. Alström syndrome has variable symptoms including childhood obesity due to an excess accumulation of subcutaneous adipose tissue, hyperinsulinemia, acanthosis nigricans (a marker of severe insulin resistance), type 2 diabetes mellitus, hypertriglyceridemia that can lead to acute pancreatitis, hypothyroidsism, growth hormone deficiency, sensorineural hearing loss, and progressive rod-cone dystrophy leading to blindness [(24); reviewed in (25;26)]. Approximately 70% of patients with Alström syndrome also have dilated cardiomyopathy during infancy or adolescence [(19); reviewed in (25)]. In addition, many patients have hepatic and urologic dysfunction as well as renal failure and systemic fibrosis with age [reviewed in (25)]. Patients exhibit hypogonadotropic hypogonadism leading to infertility and female patients have symptoms of polycystic ovary syndrome and hyperandrogenism (25;27). The symptoms of Alström syndrome lead to high morbidity and reduced life expectancy (25).

 

Several Alms1 mutant mouse models (fat aussie (foz), Alms1L2131X, and Alms1-/-) have been characterized.  The foz phenotype was linked to a spontaneous 11-base pair (bp 3918-3928) deletion within exon 8 of Alms1 resulting in a frame-shift and coding of a premature stop codon (28). The ENU-induced Alms1 mutation, Alms1L2131X, resulted in premature truncation of the protein at amino acid 2,130 (8). The Alms1-/- model is a gene-trapped Alms1 allele (6;29). All of the mouse models exhibited rapid weight gain due to an increase in body fat and increased eating at weaning so that by 8 weeks of age they were significantly heavier than wild-type mice (6;8;9;29;30). All of the mutant Alms1 alleles also resulted in hyperinsulinemia, increased cholesterol levels (total and HDL), moderate late-onset (after ~16 weeks) diabetes only in the male mice, steatosis of the liver, hyperplastic pancreatic islets, and hypogonadism leading to infertility in the male mice (6;8;28-30). The Alms1-/- retina exhibited age-related degeneration and defective transport of rhodopsin (see the record for Bemr3), the major protein in rod photoreceptor outer segment discs; membrane-bound vesicles accumulated in the distal portion of the inner segments near the connecting cilium (8). Alms1 mutations also led to age-related cochlear degeneration and hearing loss. The Alms1-/- mice exhibited misshapen stereociliary outer hair bundles and mislocalized kinocilia; the inner hair cells bundles in the Alms1-/- mice were largely normal (5). Young female foz/foz mice were fertile, but litter sizes were smaller than those of wild-type or heterozygous mice (28). After the female mice became obese, they became infertile and the ovaries were devoid of corpora lutea, indicating an anovulatory state (28). The foz/foz mice also exhibited a reduction in neurons that displayed cilia marked with adenylyl cyclase 3, a signaling protein that regulates obesity, as well as a reduction in cilia that contained the appetite-regulating proteins, Mchr1 and Sstr3 (9). When fed a high-fat diet the foz/foz mice undergo transition of steatosis to severe fibrosing steatohepatitis that includes the majority of hepatocytes exhibiting severe ballooning degeneration, lobular inflammation, and pericellular and pericentral fibrosis (30). The transition after high-fat diet was associated with higher hepatic triglyceride levels compared to chow-fed foz/foz mice (30). Total GLUT4 content, insulin-stimulated GLUT4 translocation, and glucose uptake was reduced in the Alms1-/- mice indicating that ALMS1 mediates glucose homeostasis through the GLUT4 trafficking pathway (29). The Alms1-/- mice could respond to insulin by stimulating AKT phosphorylation indicating that the impaired GLUT4 translocation is downstream of AKT activation or is independent of AKT signaling.

Putative Mechanism

Centrosome and basal body dysfunction as a result of mutations in Alms1 are predicted to lead to the pathogenesis of obesity, insulin resistance, and type 2 diabetes.  Although the exact function of ALMS1 is unknown, it has been shown to be essential in weight regulation. Other ALMS1-related phenotypes have not been tested or observed in ares, but the weight gain phenotype indicates that the mutation results in loss-of-function.

Primers PCR Primer
ares(F):5'- AGCAGCCTATGTCAGATAGTCAG -3'
ares(R):5'- AGAGCCAGAGCCTACTGATTTC -3'

Sequencing Primer
ares_seq(F):5'- GCCTATGTCAGATAGTCAGCGAAC -3'
ares_seq(R):5'- CCAGAGCCTACTGATTTCAAAAATAC -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsZhe Chen, Jeff SoRelle, Noelle Hutchins
List |< first << previous [record 22 of 511] next >> last >|