Phenotypic Mutation 'paleo'

• Allele: paleo
• Mutation Type: missense
• Chromosome: 4
• Coordinate: 101,602,842 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Lepr
• Gene Name: leptin receptor
• Synonym(s): leptin receptor gene-related protein, obl, Obr, Leprb, obese-like, Modb1, LEPROT, OB-RGRP
• Chromosomal Location: 101,574,601-101,672,549 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010] ; PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Methionine changed to Lysine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000037385] [ENSMUSP00000099838] [ENSMUSP00000102534]
• AlphaFold: P48356
• SMART Domains: Protein: ENSMUSP00000037385; Gene: ENSMUSG00000057722; AA Change: M210K

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	328	418	6.3e-23	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC
low complexity region	908	921	N/A	INTRINSIC
low complexity region	1050	1065	N/A	INTRINSIC

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
  (Using ENSMUST00000037552)
• SMART Domains: Protein: ENSMUSP00000099838; Gene: ENSMUSG00000057722; AA Change: M210K

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
  (Using ENSMUST00000102777)
• SMART Domains: Protein: ENSMUSP00000102534; Gene: ENSMUSG00000057722; AA Change: M210K

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
  (Using ENSMUST00000106921)
• Meta Mutation Damage Score: 0.9083
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm, gDNA
• MMRRC Submission: 038250-MU
• Last Updated: 2019-09-04 9:47 PM by Diantha La Vine
• Record Created: 2015-01-08 10:53 PM by Jeff SoRelle
• Record Posted: 2015-02-10
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Jeff SoRelle, Zhe Chen, Noelle Hutchins

Accession Number

NCBI RefSeq: NM_146146, NM_010704, NM_001122899; MGI:104993

Alleles Listed at MGI

All mutations/alleles(42) : Chemically induced (ENU)(8) Spontaneous(14) Targeted(19) Transgenic(1)

Phenotypic Description

Figure 1. Paleo mice exhibit increased body weights. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The paleo phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1602, some of which showed increased body weights compared to wild-type mice (Figure 1). 

Nature of Mutation

Figure 2. Linkage mapping of the increased body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 47 mutations (X-axis) identified in the G1 male of pedigree R1602. Scaled weight phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 47 mutations. The body weight phenotype was linked to a mutation in Lepr:  a T to A transversion at base pair 101,745,645 (v38) on chromosome 4, or base pair 28,239 in the GenBank genomic region NC_000070.  Linkage was found with a recessive model of inheritance (P = 1.518 x 10^-20), wherein four variant homozygotes departed phenotypically from nine homozygous reference mice and 23 heterozygous mice (Figure 2).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive.  The mutation corresponds to residue 1,181 in the mRNA sequence NM_146146 within exon 5 of 19 total exons.

1165 AACTACGCTCTTCTGATGTATTTGGAAATCACA 205  -N--Y--A--L--L--M--Y--L--E--I--T-

The mutated nucleotide is indicated in red.  The mutation results in a methionine (M) to lysine (K) substitution at position 210 (M210K) in the Lepr protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.938).

Protein Prediction

Figure 3. Domain of OB-Rb and structure of mouse leptin receptor isoforms. OB-Rb contains the longest intracellular domain, which is crucial for leptin signaling. OB-Ra, OB-Rc and OB-Rd have varying short cytoplasmic domains. All isoforms contain the Box 1 motif known to bind JAK kinases. OB-Re is a secreted isoform of the leptin receptor. Cytokine receptor homology module (CRH)2 is the main binding site for leptin. The immunoglobin-like (IG-like) and fibronectin type III (FNIII) domains are involved in OB-R activation. The role of CRH1 remains to be determined. Both CRH domains also contain a FNIII fold. The paleo mutation causes a conversion of methionine 210 to a lysine. This image is interactive. Other mutations found in the Lepr gene are noted in red. Click on the mutations for more specific information. 

The Lepr or obr gene encodes an 1162 amino acid protein that is the receptor for leptin, a four-helical cytokine-like hormone produced primarily by adipocytes [Figure 3; (1;2)]. The leptin receptor is a member of the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT (signal transducer and activator of transcription) proteins (see domino for more information on STAT signaling). Six isoforms of the leptin receptor are generated by alternative splicing; each isoform, with the exception of a soluble isoform (OB-Re) are single-pass membrane-spanning proteins differing only in the sequences of their C-terminal intracellular domains. The extracellular portion of the human leptin receptor contains two CK domains that contain conserved cysteine-containing motifs (amino acids 62-178 and amino acids 428-535), four domains that contain a fibronectin type III (FNIII) fold (amino acids 235-327, 536-635, 636-731, and amino acids 732-841), and a domain that has an Ig-like fold (amino acids 328-427). The first CK domain and the first FNIII domain form the cytokine receptor homology module 1 (CRH1), while the second CK domain and remaining FNIII domains form the cytokine receptor homology module 2. The paleo mutation is a missense mutation at amino acid 210 (M210K). Residue 210 is within CRH1 in an undefined region between the cysteine-containing CK motif and the fibronectin III (FNIII) domains. The function of CRH1 remains to be determined.

Please see the record for Business class for more information on Lepr.

Putative Mechanism

Leptin, a systemic hormone, regulates multiple functions of the body including energy utilization and storage, various endocrine axes, bone metabolism, thermoregulation, angiogenesis, immunity and inflammation by binding to the long form of the leptin receptor (OB-Rb) and subsequent initiation of various signal transduction pathways [reviewed in (3-5)].  It is primarily produced by adipocytes in proportion to fat stores, but can also be produced by placenta (syncytiotrophoblasts), ovaries, skeletal muscle, stomach, mammary epithelial cells, bone marrow, pituitary and liver (6). Humans and other animals deficient for leptin or its receptor, exhibit hyperphagia and low metabolism that results in obesity and insulin resistance [OMIM #614963; (2;7;8)].  Similar to other Lepr mouse models, the paleo mice exhibit obesity. The phenotype of the paleo mice indicates that the Lepr^paleo protein exhibits loss of function.

Primers

PCR Primer
paleo_pcr_F: GCCCTTGCTTATGCTACCTTGACAG
paleo_pcr_R: AGGGTCTCCAGCCTCTATGCTAATC

Sequencing Primer
paleo_seq_F: ATGCTACCTTGACAGTCAGTC
paleo_seq_R: CTTACCAACAAGCATGGGCT

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 663 nucleotides is amplified (chromosome 4, + strand):

1   gcccttgctt atgctacctt gacagtcagt ctccataccc atcttatatt ttgttcttat
61  atttgaatat aggcctgaag tcatagatga ttcgcctctg cccccactga aagacagctt
121 tcagactgtc caatgcaact gcagtcttcg gggatgtgaa tgtcatgtgc cggtacccag
181 agccaaactc aactacgctc ttctgatgta tttggaaatc acatctgccg gtgtgagttt
241 tcagtcacct ctgatgtcac tgcagcccat gcttgttggt aagttgcact tcagagtgac
301 agtgacccta aaaaaaaaaa tcaatcatgc aaagctgttg aaaggttact tgtgggttaa
361 agattttcac tggcttacat cactgtgatc actgctgaaa aacatggcta gtcctagggt
421 gttattggca gcttctccac atgttcatag tagtcaacat ctctaacatt agcactgaaa
481 tggtcttttg aagcagctgg ggctccttta agtcttggat ttagtgaatg gatgtgtatt
541 gtttgattac catctgttta tatcatagtt aactattttt gaaaattatt aaaaacctat
601 ttctccaata aatacaactt agaattcatg tgtgcaggga ttagcataga ggctggagac
661 cct

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Zhang, F., Basinski, M. B., Beals, J. M., Briggs, S. L., Churgay, L. M., Clawson, D. K., DiMarchi, R. D., Furman, T. C., Hale, J. E., Hsiung, H. M., Schoner, B. E., Smith, D. P., Zhang, X. Y., Wery, J. P., and Schevitz, R. W. (1997) Crystal Structure of the Obese Protein Leptin-E100. Nature. 387, 206-209.

  2. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., and Friedman, J. M. (1994) Positional Cloning of the Mouse Obese Gene and its Human Homologue. Nature. 372, 425-432.

  3. Zhang, F., Chen, Y., Heiman, M., and Dimarchi, R. (2005) Leptin: Structure, Function and Biology. Vitam Horm. 71, 345-372.

  4. Malendowicz, L. K., Rucinski, M., Belloni, A. S., Ziolkowska, A., and Nussdorfer, G. G. (2007) Leptin and the Regulation of the Hypothalamic-Pituitary-Adrenal Axis. Int Rev Cytol. 263, 63-102.

  5. Lam, Q. L., and Lu, L. (2007) Role of Leptin in Immunity. Cell Mol Immunol. 4, 1-13.

  6. Margetic, S., Gazzola, C., Pegg, G. G., and Hill, R. A. (2002) Leptin: A Review of its Peripheral Actions and Interactions. Int J Obes Relat Metab Disord. 26, 1407-1433.

  7. Chen, H., Charlat, O., Tartaglia, L. A., Woolf, E. A., Weng, X., Ellis, S. J., Lakey, N. D., Culpepper, J., Moore, K. J., Breitbart, R. E., Duyk, G. M., Tepper, R. I., and Morgenstern, J. P. (1996) Evidence that the Diabetes Gene Encodes the Leptin Receptor: Identification of a Mutation in the Leptin Receptor Gene in db/db Mice. Cell. 84, 491-495.

  8. Farooqi, I. S., Wangensteen, T., Collins, S., Kimber, W., Matarese, G., Keogh, J. M., Lank, E., Bottomley, B., Lopez-Fernandez, J., Ferraz-Amaro, I., Dattani, M. T., Ercan, O., Myhre, A. G., Retterstol, L., Stanhope, R., Edge, J. A., McKenzie, S., Lessan, N., Ghodsi, M., De, R.,V, Perna, F., Fontana, S., Barroso, I., Undlien, D. E., and O'Rahilly, S. (2007) Clinical and Molecular Genetic Spectrum of Congenital Deficiency of the Leptin Receptor. N Engl J Med. 356, 237-247.