Phenotypic Mutation 'Grahamcracker'

• Allele: Grahamcracker
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 5,852,165 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Gck
• Gene Name: glucokinase
• Synonym(s): Gls006, hexokinase 4, HK4, MODY2, Hlb62
• Chromosomal Location: 5,850,820-5,900,081 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. Alternative splicing of this gene results in three tissue-specific forms of glucokinase, one found in pancreatic islet beta cells and two found in liver. The protein localizes to the outer membrane of mitochondria. In contrast to other forms of hexokinase, this enzyme is not inhibited by its product glucose-6-phosphate but remains active while glucose is abundant. Mutations in this gene have been associated with non-insulin dependent diabetes mellitus (NIDDM), maturity onset diabetes of the young, type 2 (MODY2) and persistent hyperinsulinemic hypoglycemia of infancy (PHHI). [provided by RefSeq, Apr 2009] ; PHENOTYPE: Targeted disruption of this gene causes mild hyperglycemia in heterozygous mice and extreme hyperglycemia and embryonic to postnatal lethality in homozygous mice. Hyperglycemic knock-out or ENU-induced mutants may show reduced body weight and liver glycogen level, hepatic steatosis, and glucosuria. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Asparagine changed to Lysine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000099984] [ENSMUSP00000105447] [ENSMUSP00000105448]
• AlphaFold: P52792
• SMART Domains: Protein: ENSMUSP00000099984; Gene: ENSMUSG00000041798; AA Change: N391K

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	10	217	4.3e-80	PFAM
Pfam:Hexokinase_2	219	458	1.3e-100	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000102920)
• SMART Domains: Protein: ENSMUSP00000105447; Gene: ENSMUSG00000041798; AA Change: N391K

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	10	217	1e-79	PFAM
Pfam:Hexokinase_2	219	458	7.8e-101	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000109822)
• SMART Domains: Protein: ENSMUSP00000105448; Gene: ENSMUSG00000041798; AA Change: N391K

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	15	216	1.9e-74	PFAM
Pfam:Hexokinase_2	221	455	2.2e-79	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000109823)
• SMART Domains: Protein: ENSMUSP00000123016; Gene: ENSMUSG00000041798

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
Pfam:Hexokinase_2	45	87	1.1e-8	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.6467
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Live Mice, Sperm, gDNA
• MMRRC Submission: 038191-MU
• Last Updated: 2019-09-04 9:46 PM by Katherine Timer
• Record Created: 2015-01-16 9:53 AM by Jeff SoRelle
• Record Posted: 2015-05-04
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Zhe Chen, Jeff SoRelle, Noelle Hutchins, Jianhui Wang

Accession Number

NCBI RefSeq: NM_010292, NM_001287386; MGI:1270854

Alleles Listed at MGI

All mutations/alleles(34) : Chemically induced (ENU)(18) Gene trapped(5) Targeted(11)

Phenotypic Description

Figure 1. Grahamcracker mice exhibit impaired glucose tolerance 30 minutes after glucose stimulation. Normalized data are shown for pedigrees R0691 (orange) and R1868 (cyan). Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Grahamcracker phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1868, some of which exhibited impaired glucose tolerance (i.e., hyperglycemia) 30 minutes after glucose administration (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the impaired glucose tolerance 30 minutes after glucose stimulation using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 170 mutations (X-axis) identified in the G1 males of pedigrees R0691 and R1868 using Superpedigree Analysis. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 120 mutations. The hyperglycemia phenotype was linked by continuous variable mapping to a mutation in Gck by gene-based Superpedigree Analysis of pedigrees R0691 and R1868. The Gck mutation in pedigree R1868 is a T to A transversion at base pair 5,902,165 (v38) on chromosome 11, or base pair 47,917 in the GenBank genomic region NC_000077 encoding Gck. Linkage was found with an additive model of inheritance in the Superpedigree Analysis, wherein one variant homozygote and 14 heterozygotes departed phenotypically from 7 homozygous reference mice with a P value of 4.175 x 10^-5 (Figure 2).  

The mutation corresponds to residue 1,655 in the mRNA sequence NM_010292 (variant 1) within exon 9 of 10 total exons and to residue 1,297 in the mRNA sequence NM_001287386 (variant 2) within exon 9 of 10 total exons.

47900 CTAGCGGGGGTCATAAATCGCATGCGCGAAAGC 386   -L--A--G--V--I--N--R--M--R--E--S-

Genomic numbering corresponds to NC_000077. The mutated nucleotide is indicated in red. The mutation results in an asparagine (N) to lysine (K) substitution at position 391 (N391K) in both isoforms of the glucokinase (GCK) protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 1.00) (1).

Protein Prediction

Figure 3. Domain stucture of GCK. The residues involved in ATP and glucose binding are indicated. The small and large domains refer to the corresponding domains in the crystal structures shown in Figure 4. The Grahamcracker mutation results in an asparagine (N) to lysine (K) substitution at position 391.

Figure 4. Crystal structures of human GCK in an active/closed form (GCK(Δ1-11)) and in an inactive super-open form (GK(Δ1-15). The large and small subdomains as well as the location of the residue affected by the Grahamcracker mutation. The figures were generated by Chimera and are based on PDB:1V4S (active), PDB:1V4T (inactive), and Kamata et al. 2004. PDB:1V4S comprises amino acids 11-465 and PDB:1V4T comprises amino acids 15-465. The image is interactive; click to rotate.

Glucokinase [GCK; alternatively, hexokinase 4 (HK4)] is a member of the hexokinase family (Figure 3). Alternative splicing of Gck generates three tissue-specific 465-amino acid GCK isoforms: GCK-B1, GCK-B2, and GCK-L1 (2-5). GCK-B1 and GCK-B2 are specific to pancreatic β-cells, while GCK-L1 is specific to the liver. At present, it is unknown whether it is the B1 or B2 isoform (or both) that generate the pancreatic GCK enzymatic activity. The GCK-L1 isoform differs from the GCK-B isoforms within the 16 N-terminal amino acids; the functional significance of the N-terminus of all of the isoforms is unknown. The crystal structure of amino acids 11-465 of the active/closed form (GK(Δ1-11); PDB:1V4S) and amino acids 15-465 of the inactive/super-open form (GK(Δ1-15); PDB:1V4T) of human GCK-L1 have been solved [Figure 4; (6)]. The crystal of GK(Δ1-11) in complex with glucose and compound A, an activator, folded into a large and small subdomain corresponding to amino acids 67-203 and 204-443 in mouse GCK, respectively (6). The large and small subdomains are separated by a deep cleft which forms the active site (6). The glucose binding site within the cleft is composed of residues Glu256 and Glu290 of the large subdomain and Thr168 and Lys169 of the small subdomain (6). Ser65 through Gly72 in GK(Δ1-11) comprises connecting region I, which is a flexible structure exposed to the solvent (6). The allosteric site is surrounded by connecting region I, the large subdomain (β1 strand and α5 helix), and the small subdomain (α13 helix) (6). The GK(Δ1-15) crystal was similar to GK(Δ1-11) in overall conformation. However, the spatial relationship of the small subdomains was significantly different between the proteins. Upon glucose binding, the inactive form undergoes a conformational change to the active form. After transition to the open form, the enzymatic reaction is carried out by changing to the closed form in the presence of ATP (6). After the reaction is complete, GCK returns to the open form in order to release glucose-6-phosphate and ADP (6).

The Grahamcracker mutation results in an asparagine (N) to lysine (K) substitution at position 391. N391 is within the GK large subdomain, but is not predicted to be involved in either ATP or glucose binding.

Expression/Localization

GCK is expressed in the liver (the L1 isoform), pancreatic α-, β-, and δ-cells (the B1 and B2 isoforms), the intestine, pituitary, and the hypothalamus (2;5;7-9).

GCK expression and activity are regulated by several factors in both the liver and pancreas. GCK enzyme activity and expression is reduced after 48 hours of starvation in both hepatocytes and pancreatic beta cells (10;11). After refeeding, the GCK enzyme activity and gene expression was restored. In both the liver and pancreas, GK is activated by the enzyme PFK2/fructose-2,6-bisphosphatase-2 (FBPase-2) (12;13). In hepatocytes, Gck expression is induced in the liver by insulin and glucose (3;4;14;15). Insulin stimulates NO production, subsequently leading to S-nitrosylation of GCK (16). Glucagon-like peptide 1 (GLP-1), a factor that potentiates glucose-stimulated insulin secretion in beta cells, increased GCK activity and enhanced GCK S-nitrosylation in βTC3 insulinoma cells (17) .In addition, GCK-B1/B2 is SUMOylated, which subsequently increases its enzymatic activity (18). Insulin receptor substrate-2 (IRS-2)-associated signaling is essential for maintaining the GCK-L1 activity (19). Gck expression is inhibited by glucagon (20). GCK activity in the liver is inhibited by the nuclear protein glucokinase regulatory protein (GRP), which binds GCK to inactivate GCK during starvation (21). After refeeding, GCK is released from GRP in the nucleus and is returned to an active form in the cytosol (21). GCK is also repressed by cAMP in the liver (3;20). In pancreatic beta cells, GCK is regulated by ubiquitination and proteins that have ubiquitin-like domains (e.g., midnolin and parkin) (22;23). Association of GCK with secretory granules in beta cells is regulated by nitric oxide (NO) (16).

Background

Figure 5. The steps in glycolysis. Glycolysis converts glucose to pyruvate in a 10-step process. Each of the steps are numbered. Enzymes and products from each step within the glycolysis cascade are indicated. Step 1, glucose is broken down by hexokinase and is phosphorylated by ATP to form glucose-6-phosphate (G6P). Step 2, isomerization of the G6P by phosphylglucose isomerase to form fructose-6-phosphosphate (Fru-6-P). Step 3, Fru-6-P is phosphorylated by ATP to form fructose 1,6-bisphosphate (Fru-1,6-P 2 ); the enzyme phosphofructokinase controls the entry of sugars into glycolysis. Step 4, Fru-1,6-P 2 is cleaved by aldolase to produce dihydroxyacetone phosphate (DHAP) and glyceraldehyde 3-phosphate (G3P). Step 5, the DHAP is isomerized to form G3P. Step 6, the G3P generated from steps 4 and 5 is oxidized by G3P dehydrogenase (GPDH) to form 1,3-biphosphoglycerate (1,3-BPG). Step 7, the phosphate group on 1,3-BPG is transferred to ADP by phosphoglycerate kinase (PGK) to form 3-phosphoglycerate. Step 8, the phosphate ester linkage in 3-phosphoglycerate is moved from carbon 3 to carbon 2 by phosphoglycerate mutase to form 2-phosphoglycerate. Step 9, water is removed from 2-phosphoglycerate by enolase to form phosphoenolpyruvate. Step 10, the phosphate group generated in step 9 is transferred to ADP by pyruvate kinase to form pyruvate and ATP. See the text for more details.

Glycolysis is a 10-step process that occurs in all life forms in which glucose (C₆H₁₂O₆) or glycogen (a glucose polymer) is broken down into pyruvate (CH₃COCOO⁻ + H⁺) to generate energy for the cells (Figure 5). Each enzymatic step of glycolysis produces a different sugar intermediate. In the first step of glycolysis, glucose is broken down by hexokinase and is phosphorylated by two ATP (adenosine triphosphate) molecules to form glucose-6-phosphate (G6P). In the second step, isomerization of the G6P moves the carbonyl oxygen from carbon 1 to carbon 2, forming fructose-6-phosphosphate (Fru-6-P). In step 3, the hydroxyl group on carbon 1 of Fru-6-P is phosphorylated by ATP to form fructose 1,6-bisphosphate (Fru-1,6-P₂); the enzyme phosphofructokinase regulates sugar entry into glycolysis at this step. In step 4, Fru-1,6-P₂ is cleaved by aldolase to produce two three-carbon molecules, dihydroxyacetone phosphate (DHAP) and glyceraldehyde 3-phosphate (G3P). In step 5, the DHAP is isomerized to form G3P. In step 6, the G3P generated from steps 4 and 5 is oxidized by G3P dehydrogenase (GPDH) to form 1,3-biphosphoglycerate (1,3-BPG), producing two NADH (nicotinamide adenine dinucleotide) molecules. In step 7, the high-energy phosphate group on 1,3-BPG is transferred to ADP by phosphoglycerate kinase (PGK) to form 3-phosphoglycerate. In step 8, the phosphate ester linkage in 3-phosphoglycerate is moved from carbon 3 to carbon 2 by phosphoglycerate mutase to form 2-phosphoglycerate. In step 9, water is removed from 2-phosphoglycerate by enolase to form phosphoenolpyruvate. In the final step, the phosphate group generated in step 9 is transferred to ADP by pyruvate kinase to form pyruvate and ATP. In total, two ATP and two NADH molecules are released as energy during glycolysis. The pyruvate generated from glycolysis can subsequently enter the Krebs (alternatively, citric acid or tricaboxylic acid) cycle to generate energy in the form of ATP, amino acid precursors, and the reducing agent NADH that is used in other biochemical pathways (e.g., electron transport pathway).

GCK is one of four members of the hexokinase family. The functional significance of GCK in the gut and hypothalamic nuclei in the brain is unknown. In the gut, GCK may promote the secretion of enteroincretins, which are hormones that stimulate a decrease in blood glucose levels (e.g., GLP-1) (24). In the brain, GCK may assist in the regulation of feeding behavior and counter regulatory responses by functioning as a glucose sensor (8;24). In the liver and pancreas, GCK is a component of the ‘glucose sensor’ that regulates plasma glucose levels. Glucose metabolism results in the closure of ATP-sensitive potassium (K_ATP) channels in the beta-cell plasma membrane and subsequent beta-cell depolarization, activation of voltage-dependent calcium channels, increased calcium influx, and induction of insulin secretion (25-28). Beta cell-specific Gck heterozygous (β-Gck^+/-) mice exhibit moderate hyperglycemia and defective insulin secretion in response to glucose (27;28). Pancreatic beta cells from the β-Gck^+/- mice exhibited impaired glucose sensitivity that worsened with age (29). β-Gck^+/- mice fed a high-fat diet exhibited reduced beta cell replication and beta cell hyperplasia compared to wild-type mice (30). In addition, islets from the β-Gck^+/- mice had diminished expression of IRS-2 compared to that in wild-type mice (30). In the liver, GCK function mediates hepatic glucose uptake, the synthesis and subsequent storage of glycogen in the liver, and the regulation of glucose-responsive genes (27;31). Hepatocyte-specific conditional Gck knockout (Liver-Gck^-/- ) mice were mildly hyperglycemic, but exhibited defects in glycogen synthesis, glucose turnover rates during hyperglycemic clamp, and impaired insulin secretion in response to glucose (27;32;33). Hepatocyte-specific Gck knockdown in obesity-prone mice attenuated weight gain with a concomitant increase in adaptive thermogenesis (34).

Mutations in GCK are linked to gestational diabetes mellitus [OMIM: #125851; (35)], reduced birth rate (36), late onset noninsulin-dependent diabetes mellitus [OMIM: #125853; (37)], permanent neonatal diabetes mellitus [OMIM: #606176; (38-40)], familial hyperinsulinemic hypoglycemia 3 [OMIM: #602485; (41;42)], and type II maturity-onset diabetes of the young [MODY 2 (alternatively, GCK-MODY); OMIM: #125851; (39;43-45)]. All of the above-mentioned conditions are the result of variable degrees of glucose intolerance due to impaired glucose-responsive insulin secretion.

Putative Mechanism

Gck knockout (Gck^-/-) mice are not viable and die from approximately embryonic day (E) 9 until shortly before birth from severe hyperglycemia (27;46;47). Gck heterozygous (Gck^+/-) mice survive, but exhibit reduced islet GCK activity and subsequent elevation in fasting blood glucose levels (46-48). After hyperglycemic clamp, the Gck^+/- mice exhibited reduced glucose tolerance and defective liver glucose metabolism (46;48). In addition, Gck^+/- mice exhibited reduced fertility, increased levels of plasma corticosterone, increased food intake, and hypothalamic gene expression (e.g., increased hypothalamic neuropeptide Y mRNA and reduced hypothalamic proopiomelanocortin mRNA) (31). ENU-induced mutations in Gck resulted in variable reduced viability, reduced GCK activity, and subsequent impaired glucose-responsive insulin secretion (7;49-51). Several homozygote ENU-induced models (Gck^{GENA348/GENA348} and Gck^{D217VD217V/D217V}) exhibited increased viability (e.g., 5-12 weeks of age) compared to the Gck^-/- mice (49;52). However, the ENU-induced mutant Munich Gck^M210R/M210R mice exhibited growth retardation and perinatal lethality (51). All heterozygote ENU-induced models exhibited elevated plasma glucose levels, impaired glucose tolerance, and reduced glucose-induced insulin secretion compared to wild-type mice (49;51;52). Similar to other ENU-induced mutants, the Grahamcracker mice exhibit impaired glucose tolerance. In addition, the low numbers of homozygous Grahamcracker mice indicates that the mutation may result in almost complete loss of GCK^{Grahamcracker} function.

Primers

PCR Primer
Grahamcracker_pcr_F: GCTCACAAAAGCCTGGAGTTG
Grahamcracker_pcr_R: TGGCATTGTCATCCTCACG

Sequencing Primer
Grahamcracker_seq_F: CTCACAAAAGCCTGGAGTTGAAAGC
Grahamcracker_seq_R: GCATTGTCATCCTCACGACAGAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 444 nucleotides is amplified (chromosome 11, - strand):

1   tggcattgtc atcctcacga cagagaaaac ccgggggctg accaaaggac tgctgggcag
61  ggcagggcat tcccattccc ccaggaccct cagtgacttc cctccctaat accgcccgca
121 gcgactctgg ggaccgaagg cagatcctta acatcctgag cactctgggc cttcgaccct
181 ctgtcgccga ctgcgacatt gtgcgccgtg cctgtgaaag cgtgtccact cgcgccgccc
241 acatgtgctc agcaggacta gcgggggtca taaatcgcat gcgcgaaagc cgcagtgagg
301 acgtgatgcg catcacggtg ggcgtggatg gctccgtgta caagctgcac ccgaggtcag
361 cctccacctt cgctcgcgct ccaacctccc gggctccaag ggaggctcca agggcgcggc
421 tttcaactcc aggcttttgt gagc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. Iynedjian, P. B., Pilot, P. R., Nouspikel, T., Milburn, J. L., Quaade, C., Hughes, S., Ucla, C., and Newgard, C. B. (1989) Differential Expression and Regulation of the Glucokinase Gene in Liver and Islets of Langerhans. Proc Natl Acad Sci U S A. 86, 7838-7842.

  3. Magnuson, M. A. (1990) Glucokinase Gene Structure. Functional Implications of Molecular Genetic Studies. Diabetes. 39, 523-527.

  4. Matschinsky, F. M. (1990) Glucokinase as Glucose Sensor and Metabolic Signal Generator in Pancreatic Beta-Cells and Hepatocytes. Diabetes. 39, 647-652.

  5. Tanizawa, Y., Koranyi, L. I., Welling, C. M., and Permutt, M. A. (1991) Human Liver Glucokinase Gene: Cloning and Sequence Determination of Two Alternatively Spliced cDNAs. Proc Natl Acad Sci U S A. 88, 7294-7297.

  6. Kamata, K., Mitsuya, M., Nishimura, T., Eiki, J., and Nagata, Y. (2004) Structural Basis for Allosteric Regulation of the Monomeric Allosteric Enzyme Human Glucokinase. Structure. 12, 429-438.

  7. Fenner, D., Odili, S., Hong, H. K., Kobayashi, Y., Kohsaka, A., Siepka, S. M., Vitaterna, M. H., Chen, P., Zelent, B., Grimsby, J., Takahashi, J. S., Matschinsky, F. M., and Bass, J. (2011) Generation of N-Ethyl-N-Nitrosourea (ENU) Diabetes Models in Mice Demonstrates Genotype-Specific Action of Glucokinase Activators. J Biol Chem. 286, 39560-39572.

  8. Zelent, D., Golson, M. L., Koeberlein, B., Quintens, R., van Lommel, L., Buettger, C., Weik-Collins, H., Taub, R., Grimsby, J., Schuit, F., Kaestner, K. H., and Matschinsky, F. M. (2006) A Glucose Sensor Role for Glucokinase in Anterior Pituitary Cells. Diabetes. 55, 1923-1929.

  9. Heimberg, H., De Vos, A., Moens, K., Quartier, E., Bouwens, L., Pipeleers, D., Van Schaftingen, E., Madsen, O., and Schuit, F. (1996) The Glucose Sensor Protein Glucokinase is Expressed in Glucagon-Producing Alpha-Cells. Proc Natl Acad Sci U S A. 93, 7036-7041.

  10. Tiedge, M., and Lenzen, S. (1995) Effects of Glucose Refeeding and Glibenclamide Treatment on Glucokinase and GLUT2 Gene Expression in Pancreatic B-Cells and Liver from Rats. Biochem J. 308 ( Pt 1), 139-144.

  11. Tiedge, M., and Lenzen, S. (1991) Regulation of Glucokinase and GLUT-2 Glucose-Transporter Gene Expression in Pancreatic B-Cells. Biochem J. 279 ( Pt 3), 899-901.

  12. Massa, L., Baltrusch, S., Okar, D. A., Lange, A. J., Lenzen, S., and Tiedge, M. (2004) Interaction of 6-Phosphofructo-2-kinase/fructose-2,6-Bisphosphatase (PFK-2/FBPase-2) with Glucokinase Activates Glucose Phosphorylation and Glucose Metabolism in Insulin-Producing Cells. Diabetes. 53, 1020-1029.

  13. Baltrusch, S., Lenzen, S., Okar, D. A., Lange, A. J., and Tiedge, M. (2001) Characterization of Glucokinase-Binding Protein Epitopes by a Phage-Displayed Peptide Library. Identification of 6-Phosphofructo-2-kinase/fructose-2,6-Bisphosphatase as a Novel Interaction Partner. J Biol Chem. 276, 43915-43923.

  14. Bedoya, F. J., Matschinsky, F. M., Shimizu, T., O'Neil, J. J., and Appel, M. C. (1986) Differential Regulation of Glucokinase Activity in Pancreatic Islets and Liver of the Rat. J Biol Chem. 261, 10760-10764.

  15. Magnuson, M. A., Andreone, T. L., Printz, R. L., Koch, S., and Granner, D. K. (1989) Rat Glucokinase Gene: Structure and Regulation by Insulin. Proc Natl Acad Sci U S A. 86, 4838-4842.

  16. Rizzo, M. A., and Piston, D. W. (2003) Regulation of Beta Cell Glucokinase by S-Nitrosylation and Association with Nitric Oxide Synthase. J Cell Biol. 161, 243-248.

  17. Ding, S. Y., Nkobena, A., Kraft, C. A., Markwardt, M. L., and Rizzo, M. A. (2011) Glucagon-Like Peptide 1 Stimulates Post-Translational Activation of Glucokinase in Pancreatic Beta Cells. J Biol Chem. 286, 16768-16774.

  18. Aukrust, I., Bjorkhaug, L., Negahdar, M., Molnes, J., Johansson, B. B., Muller, Y., Haas, W., Gygi, S. P., Sovik, O., Flatmark, T., Kulkarni, R. N., and Njolstad, P. R. (2013) SUMOylation of Pancreatic Glucokinase Regulates its Cellular Stability and Activity. J Biol Chem. 288, 5951-5962.

  19. Roncero, I., Alvarez, E., Acosta, C., Sanz, C., Barrio, P., Hurtado-Carneiro, V., Burks, D., and Blazquez, E. (2013) Insulin-Receptor Substrate-2 (Irs-2) is Required for Maintaining Glucokinase and Glucokinase Regulatory Protein Expression in Mouse Liver. PLoS One. 8, e58797.

  20. Sibrowski, W., and Seitz, H. J. (1984) Rapid Action of Insulin and Cyclic AMP in the Regulation of Functional Messenger RNA Coding for Glucokinase in Rat Liver. J Biol Chem. 259, 343-346.

  21. van Schaftingen, E., Vandercammen, A., Detheux, M., and Davies, D. R. (1992) The Regulatory Protein of Liver Glucokinase. Adv Enzyme Regul. 32, 133-148.

  22. Hofmeister-Brix, A., Kollmann, K., Langer, S., Schultz, J., Lenzen, S., and Baltrusch, S. (2013) Identification of the Ubiquitin-Like Domain of Midnolin as a New Glucokinase Interaction Partner. J Biol Chem. 288, 35824-35839.

  23. Hofmeister-Brix, A., Lenzen, S., and Baltrusch, S. (2013) The Ubiquitin-Proteasome System Regulates the Stability and Activity of the Glucose Sensor Glucokinase in Pancreatic Beta-Cells. Biochem J. 456, 173-184.

  24. Jetton, T. L., Liang, Y., Pettepher, C. C., Zimmerman, E. C., Cox, F. G., Horvath, K., Matschinsky, F. M., and Magnuson, M. A. (1994) Analysis of Upstream Glucokinase Promoter Activity in Transgenic Mice and Identification of Glucokinase in Rare Neuroendocrine Cells in the Brain and Gut. J Biol Chem. 269, 3641-3654.

  25. Ashcroft, F. M., and Rorsman, P. (1989) Electrophysiology of the Pancreatic Beta-Cell. Prog Biophys Mol Biol. 54, 87-143.

  26. Matschinsky, F., Liang, Y., Kesavan, P., Wang, L., Froguel, P., Velho, G., Cohen, D., Permutt, M. A., Tanizawa, Y., and Jetton, T. L. (1993) Glucokinase as Pancreatic Beta Cell Glucose Sensor and Diabetes Gene. J Clin Invest. 92, 2092-2098.

  27. Postic, C., Shiota, M., Niswender, K. D., Jetton, T. L., Chen, Y., Moates, J. M., Shelton, K. D., Lindner, J., Cherrington, A. D., and Magnuson, M. A. (1999) Dual Roles for Glucokinase in Glucose Homeostasis as Determined by Liver and Pancreatic Beta Cell-Specific Gene Knock-Outs using Cre Recombinase. J Biol Chem. 274, 305-315.

  28. Terauchi, Y., Sakura, H., Yasuda, K., Iwamoto, K., Takahashi, N., Ito, K., Kasai, H., Suzuki, H., Ueda, O., and Kamada, N. (1995) Pancreatic Beta-Cell-Specific Targeted Disruption of Glucokinase Gene. Diabetes Mellitus due to Defective Insulin Secretion to Glucose. J Biol Chem. 270, 30253-30256.

  29. Aizawa, T., Asanuma, N., Terauchi, Y., Suzuki, N., Komatsu, M., Itoh, N., Nakabayashi, T., Hidaka, H., Ohnota, H., Yamauchi, K., Yasuda, K., Yazaki, Y., Kadowaki, T., and Hashizume, K. (1996) Analysis of the Pancreatic Beta Cell in the Mouse with Targeted Disruption of the Pancreatic Beta Cell-Specific Glucokinase Gene. Biochem Biophys Res Commun. 229, 460-465.

  30. Terauchi, Y., Takamoto, I., Kubota, N., Matsui, J., Suzuki, R., Komeda, K., Hara, A., Toyoda, Y., Miwa, I., Aizawa, S., Tsutsumi, S., Tsubamoto, Y., Hashimoto, S., Eto, K., Nakamura, A., Noda, M., Tobe, K., Aburatani, H., Nagai, R., and Kadowaki, T. (2007) Glucokinase and IRS-2 are Required for Compensatory Beta Cell Hyperplasia in Response to High-Fat Diet-Induced Insulin Resistance. J Clin Invest. 117, 246-257.

  31. Yang, X. J., Mastaitis, J., Mizuno, T., and Mobbs, C. V. (2007) Glucokinase Regulates Reproductive Function, Glucocorticoid Secretion, Food Intake, and Hypothalamic Gene Expression. Endocrinology. 148, 1928-1932.

  32. Zhang, Y. L., Tan, X. H., Xiao, M. F., Li, H., Mao, Y. Q., Yang, X., and Tan, H. R. (2004) Establishment of Liver Specific Glucokinase Gene Knockout Mice: A New Animal Model for Screening Anti-Diabetic Drugs. Acta Pharmacol Sin. 25, 1659-1665.

  33. Wang, R., Gao, H., Xu, W., Li, H., Mao, Y., Wang, Y., Guo, T., Wang, X., Song, R., Li, Z., Irwin, D. M., Niu, G., and Tan, H. (2013) Differential Expression of Genes and Changes in Glucose Metabolism in the Liver of Liver-Specific Glucokinase Gene Knockout Mice. Gene. 516, 248-254.

  34. Tsukita, S., Yamada, T., Uno, K., Takahashi, K., Kaneko, K., Ishigaki, Y., Imai, J., Hasegawa, Y., Sawada, S., Ishihara, H., Oka, Y., and Katagiri, H. (2012) Hepatic Glucokinase Modulates Obesity Predisposition by Regulating BAT Thermogenesis Via Neural Signals. Cell Metab. 16, 825-832.

  35. Stoffel, M., Bell, K. L., Blackburn, C. L., Powell, K. L., Seo, T. S., Takeda, J., Vionnet, N., Xiang, K. S., Gidh-Jain, M., and Pilkis, S. J. (1993) Identification of Glucokinase Mutations in Subjects with Gestational Diabetes Mellitus. Diabetes. 42, 937-940.

  36. Hattersley, A. T., Beards, F., Ballantyne, E., Appleton, M., Harvey, R., and Ellard, S. (1998) Mutations in the Glucokinase Gene of the Fetus Result in Reduced Birth Weight. Nat Genet. 19, 268-270.

  37. Katagiri, H., Asano, T., Ishihara, H., Inukai, K., Anai, M., Miyazaki, J., Tsukuda, K., Kikuchi, M., Yazaki, Y., and Oka, Y. (1992) Nonsense Mutation of Glucokinase Gene in Late-Onset Non-Insulin-Dependent Diabetes Mellitus. Lancet. 340, 1316-1317.

  38. Njolstad, P. R., Sovik, O., Cuesta-Munoz, A., Bjorkhaug, L., Massa, O., Barbetti, F., Undlien, D. E., Shiota, C., Magnuson, M. A., Molven, A., Matschinsky, F. M., and Bell, G. I. (2001) Neonatal Diabetes Mellitus due to Complete Glucokinase Deficiency. N Engl J Med. 344, 1588-1592.

  39. Gloyn, A. L. (2003) Glucokinase (GCK) Mutations in Hyper- and Hypoglycemia: Maturity-Onset Diabetes of the Young, Permanent Neonatal Diabetes, and Hyperinsulinemia of Infancy. Hum Mutat. 22, 353-362.

  40. Rowe, R. E., Wapelhorst, B., Bell, G. I., Risch, N., Spielman, R. S., and Concannon, P. (1995) Linkage and Association between Insulin-Dependent Diabetes Mellitus (IDDM) Susceptibility and Markers Near the Glucokinase Gene on Chromosome 7. Nat Genet. 10, 240-242.

  41. Thornton, P. S., Satin-Smith, M. S., Herold, K., Glaser, B., Chiu, K. C., Nestorowicz, A., Permutt, M. A., Baker, L., and Stanley, C. A. (1998) Familial Hyperinsulinism with Apparent Autosomal Dominant Inheritance: Clinical and Genetic Differences from the Autosomal Recessive Variant. J Pediatr. 132, 9-14.

  42. Glaser, B., Kesavan, P., Heyman, M., Davis, E., Cuesta, A., Buchs, A., Stanley, C. A., Thornton, P. S., Permutt, M. A., Matschinsky, F. M., and Herold, K. C. (1998) Familial Hyperinsulinism Caused by an Activating Glucokinase Mutation. N Engl J Med. 338, 226-230.

  43. Byrne, M. M., Sturis, J., Clement, K., Vionnet, N., Pueyo, M. E., Stoffel, M., Takeda, J., Passa, P., Cohen, D., and Bell, G. I. (1994) Insulin Secretory Abnormalities in Subjects with Hyperglycemia due to Glucokinase Mutations. J Clin Invest. 93, 1120-1130.

  44. Froguel, P., Zouali, H., Vionnet, N., Velho, G., Vaxillaire, M., Sun, F., Lesage, S., Stoffel, M., Takeda, J., and Passa, P. (1993) Familial Hyperglycemia due to Mutations in Glucokinase. Definition of a Subtype of Diabetes Mellitus. N Engl J Med. 328, 697-702.

  45. Froguel, P., Vaxillaire, M., Sun, F., Velho, G., Zouali, H., Butel, M. O., Lesage, S., Vionnet, N., Clement, K., and Fougerousse, F. (1992) Close Linkage of Glucokinase Locus on Chromosome 7p to Early-Onset Non-Insulin-Dependent Diabetes Mellitus. Nature. 356, 162-164.

  46. Bali, D., Svetlanov, A., Lee, H. W., Fusco-DeMane, D., Leiser, M., Li, B., Barzilai, N., Surana, M., Hou, H., and Fleischer, N. (1995) Animal Model for Maturity-Onset Diabetes of the Young Generated by Disruption of the Mouse Glucokinase Gene. J Biol Chem. 270, 21464-21467.

  47. Grupe, A., Hultgren, B., Ryan, A., Ma, Y. H., Bauer, M., and Stewart, T. A. (1995) Transgenic Knockouts Reveal a Critical Requirement for Pancreatic Beta Cell Glucokinase in Maintaining Glucose Homeostasis. Cell. 83, 69-78.

  48. Rossetti, L., Chen, W., Hu, M., Hawkins, M., Barzilai, N., and Efrat, S. (1997) Abnormal Regulation of HGP by Hyperglycemia in Mice with a Disrupted Glucokinase Allele. Am J Physiol. 273, E743-50.

  49. Toye, A. A., Moir, L., Hugill, A., Bentley, L., Quarterman, J., Mijat, V., Hough, T., Goldsworthy, M., Haynes, A., Hunter, A. J., Browne, M., Spurr, N., and Cox, R. D. (2004) A New Mouse Model of Type 2 Diabetes, Produced by N-Ethyl-Nitrosourea Mutagenesis, is the Result of a Missense Mutation in the Glucokinase Gene. Diabetes. 53, 1577-1583.

  50. Inoue, M., Sakuraba, Y., Motegi, H., Kubota, N., Toki, H., Matsui, J., Toyoda, Y., Miwa, I., Terauchi, Y., Kadowaki, T., Shigeyama, Y., Kasuga, M., Adachi, T., Fujimoto, N., Matsumoto, R., Tsuchihashi, K., Kagami, T., Inoue, A., Kaneda, H., Ishijima, J., Masuya, H., Suzuki, T., Wakana, S., Gondo, Y., Minowa, O., Shiroishi, T., and Noda, T. (2004) A Series of Maturity Onset Diabetes of the Young, Type 2 (MODY2) Mouse Models Generated by a Large-Scale ENU Mutagenesis Program. Hum Mol Genet. 13, 1147-1157.

  51. van Burck, L., Blutke, A., Kautz, S., Rathkolb, B., Klaften, M., Wagner, S., Kemter, E., Hrabe de Angelis, M., Wolf, E., Aigner, B., Wanke, R., and Herbach, N. (2010) Phenotypic and Pathomorphological Characteristics of a Novel Mutant Mouse Model for Maturity-Onset Diabetes of the Young Type 2 (MODY 2). Am J Physiol Endocrinol Metab. 298, E512-23.

  52. van Buerck, L., Schuster, M., Rathkolb, B., Sabrautzki, S., Hrabe de Angelis, M., Wolf, E., Aigner, B., Wanke, R., and Herbach, N. (2012) Enhanced Oxidative Stress and Endocrine Pancreas Alterations are Linked to a Novel Glucokinase Missense Mutation in ENU-Derived Munich Gck(D217V) Mutants. Mol Cell Endocrinol. 362, 139-148.