Phenotypic Mutation 'Applecrisp' (pdf version)
List |< first << previous [record 20 of 511] next >> last >|
AlleleApplecrisp
Mutation Type missense
Chromosome8
Coordinate10,031,534 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Tnfsf13b
Gene Name tumor necrosis factor (ligand) superfamily, member 13b
Synonym(s) D8Ertd387e, BAFF, BLyS, TALL-1, zTNF4
Chromosomal Location 10,006,843-10,035,441 bp (+)
MGI Phenotype Homozygous null mice have reduced number of B cells and reduced levels of immunoglobulins.
Accession Number

NCBI RefSeq: NM_033622; MGI:1344376

Mapped Yes 
Amino Acid Change Methionine changed to Threonine
Institutional SourceBeutler Lab
Gene Model predicted sequence gene model
SMART Domains Protein: ENSMUSP00000033892
Gene: ENSMUSG00000031497
AA Change: M232T

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
TNF 169 308 1.88e-2 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000033892)
Phenotypic Category decrease in B:T cells, T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance  
Alleles Listed at MGI

All mutations/alleles(7) : Chemically induced (ENU)(1) Targeted(5) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Tnfsf13b APN 8 10031612 missense probably benign 0.06
IGL01383:Tnfsf13b APN 8 10031528 missense probably benign 0.34
IGL01650:Tnfsf13b APN 8 10031411 missense probably benign 0.36
Frozen UTSW 8 10031661 splice donor site probably null
F5493:Tnfsf13b UTSW 8 10006916 missense probably damaging 1.00
R0610:Tnfsf13b UTSW 8 10031661 splice donor site probably null
R0723:Tnfsf13b UTSW 8 10007166 splice donor site probably null
R1435:Tnfsf13b UTSW 8 10035358 missense probably benign 0.06
R1648:Tnfsf13b UTSW 8 10031534 missense probably damaging 1.00
R1744:Tnfsf13b UTSW 8 10031661 splice donor site probably null
R2266:Tnfsf13b UTSW 8 10007306 missense probably benign 0.01
R3723:Tnfsf13b UTSW 8 10031545 missense possibly damaging 0.48
R5230:Tnfsf13b UTSW 8 10031608 missense possibly damaging 0.80
R5913:Tnfsf13b UTSW 8 10006988 missense probably damaging 1.00
Mode of Inheritance Autosomal Semidominant
Local Stock Sperm
MMRRC Submission
Last Updated 12/08/2016 10:16 AM by Katherine Timer
Record Created 01/18/2015 8:59 AM by Kuan-Wen Wang
Record Posted 04/07/2015
Phenotypic Description

Figure 1. Applecrisp mice exhibit a decreased B:T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Applecrisp mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Applecrisp phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1648, some of which showed a reduced B:T cell ratio in the peripheral blood (Figure 1) as well as a diminished T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 2). 

Nature of Mutation

Figure 3. Linkage mapping of the reduced T-dependent antibody response to rSFV-β-gal using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 76 mutations (X-axis) identified in the G1 male of pedigree R1648.  Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 76 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Tnfsf13b:  a T to C transition at base pair 10,031,534 (v38) on chromosome 8, or base pair 25,342 in the GenBank genomic region NC_000074 encoding Tnfsf13b.  The strongest association was found with a recessive model of linkage to the normalized T-dependent antibody response to rSFV-β-gal, wherein one variant homozygote departed phenotypically from 4 homozygous reference mice and 9 heterozygous mice with a P value of 1.487 x 10-6 (Figure 3).  A substantial semidominant effect was observed in the B:T cell ratio assay.  The mutation corresponds to residue 911 in the mRNA sequence NM_033622 within exon 6 of 7 total exons.

 

895 GACCCCATCTTTGCTATGGGTCATGTCATCCAG

227 -D--P--I--F--A--M--G--H--V--I--Q-

 

The mutated nucleotide is indicated in red.  The mutation results in a methionine (M) to threonine (T) substitution at position 232 (M232T) in the BAFF protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00).

Protein Prediction

Figure 4. Domain structure of BAFF. The applecrisp mutation is shown. Abbreviations: CYTO, cytoplasmic domain; TM, transmembrane domain; ECD, extracellular domain; THD, TNF homology domain. TNF is cleaved by furin-like proteases to produce soluble BAFF. See text for more details.

Tnfsf13b encodes B cell activating factor (BAFF; alternatively, BLyS, TALL-1, zTNF-4, THANK, or TNFSF13), a member of the tumor necrosis factor (TNF) family (Figure 4). BAFF is a type II transmembrane protein that undergoes cleavage between Arg126 and Ala127 by furin-like proteases to generate a soluble form of BAFF (1-3). BAFF contains a single transmembrane domain at amino acids 48-68 and a TNF homology domain (THD) at amino acids 169-308. The applecrisp mutation (M232T) is within the THD. Alteration of the THD may result in aberrant association of BAFFApplecrisp with its receptors BCMA, TACI (transmembrane activator and calcium modulator ligand (CAML) interactor), and BAFFR.

 

Please see the Frozen entry for more information about Tnfsf13b.

Putative Mechanism

BAFF/BAFFR activates the alternative NF-κB (NF-κB2) signaling pathway (see the record for xander) to mediate the survival and maturation of splenic B cells (4;5). BAFF/BAFFR-induced NF-κB2 signaling promotes B cell survival by upregulating integrins that retains autoreactive B cells in the splenic marginal zone (6). In addition, ERK activation is sustained and there is an increased turnover of Bim, a proapoptotic protein (4;5;7). BAFF activates the classical NF-κB (NF-κB1) signaling pathway (see the record for Finlay) to regulate immunoglobulin class switching through an induction of activation induced deaminase (AID) and to generate antibodies (6). BAFF also induces the protein kinase Cδ (PKCδ)-mediated nuclear signaling pathway and the Akt/mTOR signaling pathway to regulate B-cell survival (7-10). BAFF is required for the maintenance, but not initiation, of the germinal center (GC) reaction (11). In Tnfsf13b -deficient (Tnfsf13b-/-) mice, total numbers of cells in the thymus, bone marrow, and PEC were comparable to wild-type mice (12;13); however, the number of B cells in the spleen and lymph nodes were reduced in Tnfsf13b-/- mice compared to wild-type mice (12;14). The percentage of peripheral B1 B cells in the Tnfsf13b-/- mice was comparable to that in wild-type mice; however, the B2 (B220+, CD23hi) B cell percentage in the periphery was reduced compared to wild-type mice (12;13). T-dependent and T-independent humoral responses were diminished in BAFF-deficient (Tnfsf13b-/-) mice (12-17). Similar to the Tnfsf13b-/- mice, the T-dependent antibody response was diminished in the Applecrisp mice; however the Applecrisp mice do not exhibit a significant reduction in the frequency of peripheral B cells. Taken together, this indicates that in BAFFApplecrisp may retain some function, but it exhibits loss of function in the T-dependent antibody response.

Primers PCR Primer
Applecrisp(F):5'- TGTTTGGCAGATAGCCCAATGGAG -3'
Applecrisp(R):5'- CAGCACAGTCTATGGCAGAAGGTC -3'

Sequencing Primer
Applecrisp_seq(F):5'- ccttctcctcctcctcctc -3'
Applecrisp_seq(R):5'- CCAAAGCAGCACTTTTGGG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsKuan-Wen Wang, Jin Huk Choi, Apiruck Watthanasurorot, Bruce Beutler
List |< first << previous [record 20 of 511] next >> last >|