Phenotypic Mutation 'necro'

• Allele: necro
• Mutation Type: intron
• Chromosome: 8
• Coordinate: 112,038,732 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Mlkl
• Gene Name: mixed lineage kinase domain-like
• Synonym(s): 9130019I15Rik
• Chromosomal Location: 112,038,429-112,064,809 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: This gene belongs to the protein kinase superfamily. The encoded protein contains a protein kinase-like domain; however, is thought to lack protein kinase activity. This protein plays a critical role in tumor necrosis factor (TNF)-induced necroptosis, a programmed cell death process, via interaction with receptor-interacting protein 3 (Rip3), which is a key signaling molecule in necroptosis pathway. Knockout of this gene in mice showed that it is essential for necroptosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit imapired macrophage and mouse embryonic fibroblast necroptosis. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000055521] [ENSMUSP00000113718]
• AlphaFold: Q9D2Y4
• PDB Structure: Structure of MLKL [X-RAY DIFFRACTION] ; Crystal structure of the mouse MLKL kinase-like domain [X-RAY DIFFRACTION] ; Crystal structure of the mouse RIP3-MLKL complex [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000055521; Gene: ENSMUSG00000012519

Domain	Start	End	E-Value	Type
low complexity region	109	115	N/A	INTRINSIC
Pfam:Pkinase_Tyr	195	448	2.7e-41	PFAM
Pfam:Pkinase	200	450	2.1e-30	PFAM
Pfam:Kinase-like	270	438	1.6e-7	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000113718; Gene: ENSMUSG00000012519

Domain	Start	End	E-Value	Type
low complexity region	109	115	N/A	INTRINSIC
Pfam:Pkinase_Tyr	195	453	3.3e-42	PFAM
Pfam:Pkinase	196	453	1.4e-33	PFAM
Pfam:Kinase-like	270	438	8.9e-8	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.0898
• Is this an essential gene?: Probably nonessential (E-score: 0.087)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• MMRRC Submission: 038227-MU
• Last Updated: 2019-02-05 1:00 PM by Diantha La Vine
• Record Created: 2015-01-18 6:43 PM by Ying Wang
• Record Posted: 2015-12-17
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Ying Wang, Hexin Shi, Zhao Zhang, Lei Sun, Doan Dao and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001310613 (isoform 1) NM_029005 (isoform 2); MGI:1921818

Alleles Listed at MGI

All mutations/alleles(3) : Endonuclease-mediated(1) Gene trapped(1) Targeted(1)

Phenotypic Description

Figure 1. Necro mice exhibited resistance to LPS-induced necroptosis. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The necro phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1911, some of which exhibited resistance to lipopolysaccharide (LPS)-induced necroptosis (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the necroptosis resistance after LPS stimulation using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 103 mutations (X-axis) identified in the G1 male of pedigree R1911. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 103 mutations. The necroptosis phenotype was linked by continuous variable mapping to a mutation in Mlkl:  an A to G transition at base pair 111,312,100 (v38) on chromosome 8, or base pair 26,350 in the GenBank genomic region NC_000074.  Linkage was found with a recessive model of inheritance, wherein five variant homozygotes departed phenotypically from nine homozygous reference mice and 13 heterozygous mice with a P value of 9.769 x 10^-19 (Figure 2).  A substantial semidominant effect was observed, but the mutation is preponderantly recessive. 

The necro mutation is within intron 10, 22 base pairs away from exon 11 (out of 11 total exons). The effect of the necro mutation on the mRNA sequence and MLKL^necro protein expression is unknown. In the event of the use of a cryptic site within intron 10, the aberrant transcript would contain a 72 base pair insertion, leading to an in-frame protein product beginning after amino acid 456 of the MLKL protein, and termination after the inclusion of 40 aberrant amino acids in canonical isoform 1 of the protein.

<--exon 10                    <--intron 10-->                         <--exon 11--> 23470 ……CGGCCCTCTGTGGACG gtaggagtctttctggcagagaacg……tcaccttcttttcgttcattcatag GAATCTTGGAG……AAGAAGGTGTAA…… 26414 443   ……-R--P--S--V--D--                                                      G--I--L--E-……-K--K--V--*-   472 (isoform 1; NP_083281) 443   ……-R--P--S--V--D--                                                      G--I--L--E-……-K--K--V--*-   464 (isoform 2; NP_001297542)

Genomic numbering corresponds to NC_000074. The mutated nucleotide is indicated in red, the splice donor site is in green, and the splice acceptor site is in blue. 

Protein Prediction

Figure 3. Domain organization of MLKL. MLKL has an N-terminal four-helical bundle (amino acids 1-130) followed by a two-helix linker (termed brace; amino acids 131-170) that tethers the N-terminus to a pseudokinase domain (amino acids 171-464). The necro mutation is within intron 10. This image is interactive. Other MLKL mutations are noted in red. Click on each mutation for more information.

Figure 4. Crystal structure of mouse MLKL. MLKL has an N-terminal four-helical bundle (amino acids 1-130) followed by a two-helix linker (termed brace; amino acids 131-170) that tethers the N-terminus to a pseudokinase domain (amino acids 171-464). The figure was generated by UCSF Chimera and is based on PDB:4BTF.

Mlkl encodes mixed lineage kinase domain-like (MLKL), a pseudokinase and member of the protein kinase superfamily. MLKL has a protein kinase-like domain, but does not exhibit kinase activity (Figure 3). Pseudokinases have similar topologies as protein kinases, but pseudokinases do not have one of three essential catalytic residues found in kinases: the lysine in the VAIK (Val-Ala-Ile-Lys) motif, which positions the α- and β-phosphates of ATP during phosphoryl transfer; the aspartic acid catalytic residue in the HRD (His-Arg-Asp) motif within the catalytic loop; and/or the aspartic acid in the DFG (Asp-Phe-Gly) motif within the activation loop, which binds divalent cations needed for catalysis (1). MLKL has a VAIK motif, but does not have a catalytic loop or an activation loop. Mutation of Lys219 within the MLKL VAIK motif results in constitutive activation of MLKL and necroptosis (2).

The structure of mouse MLKL has been solved [Figure 4; PDB:4BTF; (2)]. MLKL has an N-terminal four-helical bundle (amino acids 1-130) followed by a two-helix linker (termed brace; amino acids 131-170) that tethers the N-terminus to a pseudokinase domain (amino acids 171-464) (2). The pseudokinase domain has a kinase fold with N- and C-lobes (2-4). The N-lobe has an antiparallel, five-stranded β-sheet and an α-helix (helix αC), whereas the C-lobe contains seven α-helices and a pair of β-strands (5).

MLKL interacts with the kinase receptor-interacting protein 3 (RIP3) during necroptosis. The kinase domain of RIP3 (amino acids 1-318) forms a 1:1 complex with the MLKL pseudokinase domain [PDB:4M69; (5)]. RIP3 and MLKL are aligned parallel with the N- and C-lobes of the kinase domain of RIP3 and the pseudokinase domain of MLKL interacting with each other. The N-lobe of RIP3 has an antiparallel, five-stranded β-sheet and an activation helix (i.e., the αC helix). The C-lobe of the RIP3 kinase domain has eight α-helices and a pair of β-strands. Two contact areas serve as the interface between RIP3 and MLKL: β1/β5 of RIP3 and α1/β4 of MLKL as well as α7-α8 of RIP3 and α4-α6 of MLKL (5). RIP3 binding to MLKL leads to MLKL phosphorylation on Thr357 and Ser358 (3;6). Mutation of Thr357 and Ser358 to alanines (T357A/S358A) prevents necrosome formation and subsequent necropototic signaling (6;7). Upon binding to RIP3, MLKL undergoes conformational changes in the α1 and α4 helices corresponding the αC helix and activation loop in a canonical kinase. The conformational change of the α1 and α4 helices leads to rearrangement of Ser228, Val229, Phe234, Thr235, and Ser360, subsequently facilitating the interaction between RIP3 and MLKL.

During TNF-induced necroptosis, MLKL forms heterotrimers; RIP1 and RIP3 are required for the formation of MLKL heterotrimers (8;9). The four-helix bundle domain of MLKL (amino acids 1-130) is essential for heterotrimerization (8). The four-helix bundle of MLKL is sufficient to trigger necroptosis independent of caspase and RIP1 kinase activities or the presence of RIP3 (9-11). Within the four-helix bundle, Cys18, Cys24, Cys28, Lys22, Arg30, Arg63, Asp65, Lys80, Lys81, His98, Glu99, Glu102, Lys103, Arg105, Asp106, Glu109, Glu110 were essential residues for MLKL function. The residues are proposed to facilitate the orientation of the proteins within the RIP1/RIP3/MLKL complex and/or in binding to downstream effectors to induce necroptosis, although they are not predicted to alter the structure of the four-helix bundle (10). The MLKL pseudokinase domain inhibits the necroptotic function of the four-helix bundle until activation by RIP3-mediated phosphorylation (10).

Expression/Localization

MLKL is expressed in all mouse tissues tested with the exception of brain (2).  In healthy cells, MLKL is evenly distributed throughout the cytoplasm. During TNF-induced necroptosis, MLKL oligomerizes and localizes to the plasma membrane (8;9;12).

Background

Figure 5. RIP3 regulation of necroptosis. Upon TNF binding TNFR1 recruits TRADD, TRAF2, RIP1 and cIAP1/2 (complex 1). The E3 ubiquitin ligase activity of cIAP1/2 and LUBAC results in RIP1 ubiquitylation and prevents RIP1 binding to caspase-8. De-ubiquitylation of RIP1 by CYLD, reduction in the levels of caspase-8 inhibitor c-FLIP, or the inhibition of IAPs promotes formation of complex IIa (or the ripoptosome), where FADD complexes with RIP1 via homotypic DD (yellow) interactions to recruit and activate caspase-8. Under normal circumstances, caspase-8 cleavage of RIP1, RIP3 or CYLD inhibits necroptotic signaling. However, upon IAP loss or reduced levels of caspase-8 function, TNFR or TLR ligation can induce the formation of the necrosome (complex IIb) comprising RIP1, RIP3 and MLKL. Necroptosis can also be activated when DAI senses virus or dsDNA and via its RHIM domains binds and activates RIP3. IFNs can also activate necroptosis when FADD is absent or caspase-8 is inhibited. In this scenario IFN induced JAK/STAT transcriptional activation of PKR prompts PKR mediated RIP1–RIP3 necrosome formation and cell death.

Necroptosis, a pro-inflammatory form of cell death regulated by the kinases RIP1 and RIP3, occurs after stimulation of the DNA receptor, DNA-dependent activator of interferon regulatory factors (DAI), or the activation of death receptors [e.g., TNF receptor 1 (TNFR1; see the record PanR1 for information about TNF) and Fas (see the record for cherry)], Toll-like receptors [TLRs; e.g., TLR3 (see the record for Rakshasa) and TLR4 (see the record for lps3)], T-cell antigen receptor (TCR), or interferon receptor [IFNAR1 (see the record for macro-1) and IFNAR2 (see the record for macro-2)] signaling (Figure 5). Necroptosis results in the release of damage-associated molecular patterns (DAMPs) from target cells, including high-mobility group box 1 (HMGB1), interleukin-1α (IL-1α), ATP and mitochondrial DNA. These innate immune molecules induce signaling through TLRs and NOD-like receptors (NLRs), subsequently promoting pro-inflammatory cytokine and chemokine production.  In contrast to apoptotic cell death, necroptosis does not induce caspase activation. Necroptosis is marked by organelle swelling, an increase in cytosolic calcium, mitochondrial dysfunction, increased reactive oxygen species (ROS), intracellular acidification, depletion of ATP, and subsequent rupture of the plasma membrane. Necroptosis is prevalent in several inflammatory-associated diseases including liver disease, retinal degeneration, chronic intestinal inflammation, and atherosclerosis [reviewed in (13)]. Necroptosis protects hosts from vaccinia virus and murine cytomegalovirus infections by preventing virus duplication (14).

In TNFR-associated signaling, ligand binding to TNFR promotes TNFR binding to TNFR-associated death domain (TRADD) protein, which in turn recruits TNF receptor-associated factor 2 (TRAF2) and/or TRAF5, RIP1, and cellular inhibitor of apoptosis protein (cIAP)1/2. These interactions may occur in the context of lipid rafts, after which TNFR1 and RIP are ubiquitinated, resulting in their degradation by the proteasome pathway (15).  Subsequently, activation of the TAB2/TAK1 complex activates the IKK complex to phosphorylate IκB, resulting in release of NF-κB for translocation to the nucleus and activation of gene expression. TNFR1 activates JNK through sequential recruitment of TRAF2, MEKK1 and MKK7. MAPK activation involves signaling through TRADD, RIP and MKK3. TRADD recruitment to TNFR1 also leads to the induction of apoptosis through FAS-associated death domain (FADD) protein, caspase-8 and caspase-3. TNFR2 signals via the same pathways as TNFR1, but does not signal through FADD and caspases to mediate apoptosis.

RIP1 is de-ubiquitinated by CYLD, which leads to reduced levels of the caspase 8 inhibitor c-FLIP. Inhibition of IAPs promotes the formation of the ripoptosome in which FADD complexes with RIP1 to recruit and activate caspase-8. Under normal conditions, caspase 8-induced cleavage of RIP1 or RIP3 inhibits necroptosis. During necroptosis, RIP3 binds RIP1 through their respective RIP homotypic interaction motif domains, forming the necroptosome. RIP1 and RIP3 can be cleaved by caspase-8, resulting in blockade of necroptosis (16;17). Upon the loss of IAP or reduced caspase-8 function, TNFR or TLR ligation induces the formation of the necroptosome. Necroptosis induction upon DAI recognition of virus or dsDNA stimulates RIP3 activation. IFNs activate necroptosis when FADD is not present or caspase-8 is inhibited through the induction of JAK/STAT-induced activation of PKR, subsequently promoting the PKR-mediated RIP1/RIP3 necroptosome formation. RIP1 and RIP3 phosphorylation in the necroptosome leads to the recruitment of MLKL (6;7). MLKL is essential for necroptosis (3;5-7). Inhibition of MLKL function using necrosulfonamide prevents necroptosome formation and subsequent necropototic signaling (6;7). 

Necroptosis-associated signaling downstream of MLKL is unclear. Mitochondrial proteins phosphoglycerate mutase family member 5 (PGAM5) and dynamin-related protein 1 (Drp1) are activated by MLKL (18). Upon RIP3-induced necroptosis, PGAM5 dephosphorylates and subsequently activates Drp1, which subsequently promotes Drp1-mediated mitochondrial fission (18). PGAM5 is proposed to function in mitochondrial fragmentation during ionophore-, ROS-, and TNF-induced necroptosis (18). Drp1 is a factor essential for Fas-associated apoptosis (19). Additional studies determined that Drp1 is not required for Bax/Bak-dependent apoptosis (20) or RIP3-induced necroptosis (21;22). The non-voltage-sensitive channel TRPM7 is a downstream target of MLKL, which mediates calcium influx and TNF-induced necroptosis (8). ROS generation occurs downstream of MLKL (7). ROS may mediate necroptosis by inactivating MAPKs and promoting subsequent sustained JNK activation (23). MLKL is required for late-phase JNK activation (7). However, MLKL-associated TNF-induced necroptosis is independent of JNK activation and ROS generation (7). Phosphorylated MLKL forms an oligomer that binds phosphatidylinositol lipids and cardiolipin, a component of the inner mitochondrial membrane, subsequently disrupting membrane integrity. Upon MLKL translocation to the plasma membrane, the intracellular concentration of sodium increases, leading to cell lysis due to increased osmotic pressure and water intake (9). The mechanism by which MLKL promotes sodium influx in necroptotic cells is unknown. Studies have shown that MLKL induces leakage of phosphatidylinositol phosphate (PIP)-containing liposomes, indicating that MLKL functions in necroptosis by directly permeabilizing the plasma membrane (11).

Putative Mechanism

Mlkl-deficient (Mlkl^-/-) mice are viable and fertile (2;24). However, mouse dermal fibroblasts (MDFs), mouse embryonic fibroblasts (MEFs), and bone-marrow-derived macrophages (BMDMs) derived from the Mlkl^-/- mice were resistant to TNF-induced necroptotic cell death (2). Cells from Mlkl^-/- mice are resistant to cell death when treated with TNF, IAP antaonist, and a caspase inhibitor (zVAD-fmk) (2;24).

The necro mice exhibit resistance to LPS-induced necroptosis. LPS is a ligand for TLR4. In the TICAM-dependent pathway stimulated by TLR3 or 4 activation, TICAM recruits polyubiquitinated RIP1 and RIP3, which interacts with the TRAF6/TAK1 complex and leads to NF-κB activation and proinflammatory cytokine induction. In some cell types (e.g., fibroblasts), TLR3 or TLR4 can signal RIP3-dependent necroptosis independent of RIP1 in a TRIF-RIP3-MLKL signaling axis (25). Necroptosis downstream of TNF has not been examined in the necro mice. The phenotype of the necro mice indicates loss of MLKL^necro function.

Primers

PCR Primer
necro_pcr_F: TTCAGGGGCTACATGGTGAG
necro_pcr_R: ACAAGCTGCTGATCCAGGTC

Sequencing Primer
necro_seq_F: GCTACATGGTGAGATCCCATC
necro_seq_R: GGTTATAGGCACGTACCATCATGC

Genotyping

Necro genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.
 

Primer ID: R19110101

PCR Primers

Necro(F): 5’- TTCAGGGGCTACATGGTGAG-3’

Necro(R): 5’- ACAAGCTGCTGATCCAGGTC-3’

Sequencing Primer

Necro_seq(F): 5’- GCTACATGGTGAGATCCCATC-3’
 

Necro_seq(R): 5’- GGTTATAGGCACGTACCATCATGC-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 542 nucleotides is amplified (Chr.8: 111311884-111312425, GRCm38; NC_000074):

ttcaggggct acatggtgag atcccatctc aagtaaaaga aagaaaaaaa gcaagcaagc       

aagggagaaa gaagctattt gctcccagca ataagttgat gctgctaaca gatatgaagg      

acaaatgtcc actttgtcct cttacacctt cttgtccgtg gattcttcaa ccgcagacag      

tctctccaag attcctatga atgaacgaaa agaaggtgag acaagagcgg gttcccgaca      

cagccaagct gggaacacga agacgcctgc agtagatgag gcacaggaac ggtgtttgcc      

gggtctgcct gctccctaaa ccatcctcac acaggactct aacttgtcaa tctttgaaaa      

cccaaatctc aaatgaggca tgatggtacg tgcctataac cctggcacac gtgtaaaccc      

aactctgagg gggttctgag acaaaagggg ctaccagtct agctgagaaa atgaagccct      

caggttcaag aacagaccct gcctcaaaaa gaacaagtgg atgacctgga tcagcagctt      

gt

FASTA sequence

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (T>C, Chr. (+) strand; A>G, sense strand).

References

  1. Boudeau, J., Miranda-Saavedra, D., Barton, G. J., and Alessi, D. R. (2006) Emerging Roles of Pseudokinases. Trends Cell Biol. 16, 443-452.

  2. Murphy, J. M., Czabotar, P. E., Hildebrand, J. M., Lucet, I. S., Zhang, J. G., Alvarez-Diaz, S., Lewis, R., Lalaoui, N., Metcalf, D., Webb, A. I., Young, S. N., Varghese, L. N., Tannahill, G. M., Hatchell, E. C., Majewski, I. J., Okamoto, T., Dobson, R. C., Hilton, D. J., Babon, J. J., Nicola, N. A., Strasser, A., Silke, J., and Alexander, W. S. (2013) The Pseudokinase MLKL Mediates Necroptosis Via a Molecular Switch Mechanism. Immunity. 39, 443-453.

  3. Chen, W., Zhou, Z., Li, L., Zhong, C. Q., Zheng, X., Wu, X., Zhang, Y., Ma, H., Huang, D., Li, W., Xia, Z., and Han, J. (2013) Diverse Sequence Determinants Control Human and Mouse Receptor Interacting Protein 3 (RIP3) and Mixed Lineage Kinase Domain-Like (MLKL) Interaction in Necroptotic Signaling. J Biol Chem. 288, 16247-16261.

  4. Murphy, J. M., Lucet, I. S., Hildebrand, J. M., Tanzer, M. C., Young, S. N., Sharma, P., Lessene, G., Alexander, W. S., Babon, J. J., Silke, J., and Czabotar, P. E. (2014) Insights into the Evolution of Divergent Nucleotide-Binding Mechanisms among Pseudokinases Revealed by Crystal Structures of Human and Mouse MLKL. Biochem J. 457, 369-377.

  5. Xie, T., Peng, W., Yan, C., Wu, J., Gong, X., and Shi, Y. (2013) Structural Insights into RIP3-Mediated Necroptotic Signaling. Cell Rep. 5, 70-78.

  6. Sun, L., Wang, H., Wang, Z., He, S., Chen, S., Liao, D., Wang, L., Yan, J., Liu, W., Lei, X., and Wang, X. (2012) Mixed Lineage Kinase Domain-Like Protein Mediates Necrosis Signaling Downstream of RIP3 Kinase. Cell. 148, 213-227.

  7. Zhao, J., Jitkaew, S., Cai, Z., Choksi, S., Li, Q., Luo, J., and Liu, Z. G. (2012) Mixed Lineage Kinase Domain-Like is a Key Receptor Interacting Protein 3 Downstream Component of TNF-Induced Necrosis. Proc Natl Acad Sci U S A. 109, 5322-5327.

  8. Cai, Z., Jitkaew, S., Zhao, J., Chiang, H. C., Choksi, S., Liu, J., Ward, Y., Wu, L. G., and Liu, Z. G. (2014) Plasma Membrane Translocation of Trimerized MLKL Protein is Required for TNF-Induced Necroptosis. Nat Cell Biol. 16, 55-65.

  9. Chen, X., Li, W., Ren, J., Huang, D., He, W. T., Song, Y., Yang, C., Li, W., Zheng, X., Chen, P., and Han, J. (2014) Translocation of Mixed Lineage Kinase Domain-Like Protein to Plasma Membrane Leads to Necrotic Cell Death. Cell Res. 24, 105-121.

  10. Hildebrand, J. M., Tanzer, M. C., Lucet, I. S., Young, S. N., Spall, S. K., Sharma, P., Pierotti, C., Garnier, J. M., Dobson, R. C., Webb, A. I., Tripaydonis, A., Babon, J. J., Mulcair, M. D., Scanlon, M. J., Alexander, W. S., Wilks, A. F., Czabotar, P. E., Lessene, G., Murphy, J. M., and Silke, J. (2014) Activation of the Pseudokinase MLKL Unleashes the Four-Helix Bundle Domain to Induce Membrane Localization and Necroptotic Cell Death. Proc Natl Acad Sci U S A. 111, 15072-15077.

  11. Dondelinger, Y., Declercq, W., Montessuit, S., Roelandt, R., Goncalves, A., Bruggeman, I., Hulpiau, P., Weber, K., Sehon, C. A., Marquis, R. W., Bertin, J., Gough, P. J., Savvides, S., Martinou, J. C., Bertrand, M. J., and Vandenabeele, P. (2014) MLKL Compromises Plasma Membrane Integrity by Binding to Phosphatidylinositol Phosphates. Cell Rep. 7, 971-981.

  12. Wang, H., Sun, L., Su, L., Rizo, J., Liu, L., Wang, L. F., Wang, F. S., and Wang, X. (2014) Mixed Lineage Kinase Domain-Like Protein MLKL Causes Necrotic Membrane Disruption upon Phosphorylation by RIP3. Mol Cell. 54, 133-146.

  13. Khan, N., Lawlor, K. E., Murphy, J. M., and Vince, J. E. (2014) More to Life than Death: Molecular Determinants of Necroptotic and Non-Necroptotic RIP3 Kinase Signaling. Curr Opin Immunol. 26, 76-89.

  14. Cho, Y. S., Challa, S., Moquin, D., Genga, R., Ray, T. D., Guildford, M., and Chan, F. K. (2009) Phosphorylation-Driven Assembly of the RIP1-RIP3 Complex Regulates Programmed Necrosis and Virus-Induced Inflammation. Cell. 137, 1112-1123.

  15. Legler, D. F., Micheau, O., Doucey, M. A., Tschopp, J., and Bron, C. (2003) Recruitment of TNF Receptor 1 to Lipid Rafts is Essential for TNFalpha-Mediated NF-kappaB Activation. Immunity. 18, 655-664.

  16. Feng, S., Yang, Y., Mei, Y., Ma, L., Zhu, D. E., Hoti, N., Castanares, M., and Wu, M. (2007) Cleavage of RIP3 Inactivates its Caspase-Independent Apoptosis Pathway by Removal of Kinase Domain. Cell Signal. 19, 2056-2067.

  17. Lin, Y., Devin, A., Rodriguez, Y., and Liu, Z. G. (1999) Cleavage of the Death Domain Kinase RIP by Caspase-8 Prompts TNF-Induced Apoptosis. Genes Dev. 13, 2514-2526.

  18. Wang, Z., Jiang, H., Chen, S., Du, F., and Wang, X. (2012) The Mitochondrial Phosphatase PGAM5 Functions at the Convergence Point of Multiple Necrotic Death Pathways. Cell. 148, 228-243.

  19. Frank, S., Gaume, B., Bergmann-Leitner, E. S., Leitner, W. W., Robert, E. G., Catez, F., Smith, C. L., and Youle, R. J. (2001) The Role of Dynamin-Related Protein 1, a Mediator of Mitochondrial Fission, in Apoptosis. Dev Cell. 1, 515-525.

  20. Parone, P. A., James, D. I., Da Cruz, S., Mattenberger, Y., Donze, O., Barja, F., and Martinou, J. C. (2006) Inhibiting the Mitochondrial Fission Machinery does Not Prevent Bax/Bak-Dependent Apoptosis. Mol Cell Biol. 26, 7397-7408.

  21. Moujalled, D. M., Cook, W. D., Murphy, J. M., and Vaux, D. L. (2014) Necroptosis Induced by RIPK3 Requires MLKL but Not Drp1. Cell Death Dis. 5, e1086.

  22. Remijsen, Q., Goossens, V., Grootjans, S., Van den Haute, C., Vanlangenakker, N., Dondelinger, Y., Roelandt, R., Bruggeman, I., Goncalves, A., Bertrand, M. J., Baekelandt, V., Takahashi, N., Berghe, T. V., and Vandenabeele, P. (2014) Depletion of RIPK3 Or MLKL Blocks TNF-Driven Necroptosis and Switches Towards a Delayed RIPK1 Kinase-Dependent Apoptosis. Cell Death Dis. 5, e1004.

  23. Kamata, H., Honda, S., Maeda, S., Chang, L., Hirata, H., and Karin, M. (2005) Reactive Oxygen Species Promote TNFalpha-Induced Death and Sustained JNK Activation by Inhibiting MAP Kinase Phosphatases. Cell. 120, 649-661.

  24. Wu, J., Huang, Z., Ren, J., Zhang, Z., He, P., Li, Y., Ma, J., Chen, W., Zhang, Y., Zhou, X., Yang, Z., Wu, S. Q., Chen, L., and Han, J. (2013) Mlkl Knockout Mice Demonstrate the Indispensable Role of Mlkl in Necroptosis. Cell Res. 23, 994-1006.

  25. Kaiser, W. J., Sridharan, H., Huang, C., Mandal, P., Upton, J. W., Gough, P. J., Sehon, C. A., Marquis, R. W., Bertin, J., and Mocarski, E. S. (2013) Toll-Like Receptor 3-Mediated Necrosis Via TRIF, RIP3, and MLKL. J Biol Chem. 288, 31268-31279.