Allele | Houstonian | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 140,843,935 bp (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ C (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Irf7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | interferon regulatory factor 7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 140,843,096-140,846,412 bp (-) (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRF7 encodes interferon regulatory factor 7, a member of the interferon regulatory transcription factor (IRF) family. IRF7 has been shown to play a role in the transcriptional activation of virus-inducible cellular genes, including interferon beta chain genes. Inducible expression of IRF7 is largely restricted to lymphoid tissue. Multiple IRF7 transcript variants have been identified, although the functional consequences of these have not yet been established. [provided by RefSeq, Jul 2008] PHENOTYPE: Homozygous null mice are more vulnerable to viral infection and exhibit decreased serum interferon levels in response to viral infection. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Threonine changed to Alanine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000026571] [ENSMUSP00000095565] [ENSMUSP00000101644] [ENSMUSP00000147529 †] † probably from a misspliced transcript | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P70434 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PDB Structure | Crystal structure of IRF-7 DBD apo form [X-RAY DIFFRACTION] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000026571 Gene: ENSMUSG00000025498 AA Change: T246A
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000095565 Gene: ENSMUSG00000025498 AA Change: T215A
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | possibly damaging
PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000101644 Gene: ENSMUSG00000025498 AA Change: T214A
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | possibly damaging
PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000121026 Gene: ENSMUSG00000025498 AA Change: T82A
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.8884 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Semidominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All mutations/alleles(5) : Chemically induced (ENU)(1) Gene trapped(1) Targeted(3) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Semidominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 038163-MU | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:46 PM by Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2015-01-20 2:02 PM by Doan Dao | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2015-02-11 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The Houstonian phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1442, some of which showed reduced type I interferon (IFN) production by macrophages after stimulation with double stranded (ds) DNA (Figure 1). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 67 mutations. The reduced type I IFN in response to dsDNA was linked by continuous variable mapping to a mutation in Irf7: an A to G transition at base pair 141,264,022 (v38) on chromosome 7, or base pair 2,478 in the GenBank genomic region NC_000073. Linkage was found with a semidominant model of inheritance, wherein 5 variant homozygotes and 23 heterozygotes departed phenotypically from 18 homozygous reference mice with a P value of 1.71 x 10-4 (Figure 2). The mutation corresponds to residue 1,179 in the mRNA sequence NM_016850 within exon 8 of 10 total exons.
The mutated nucleotide is indicated in red. The mutation results in a threonine (T) to alanine (A) substitution at position 246 (T246A) in the IRF7 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.992). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
In mouse and human, the Irf7 gene encodes one of nine members of the interferon regulatory factor (IRF) family of transcription factors, which regulate the transcription of type I interferons (IFN-α/β) and IFN-inducible genes during immune system development, homeostasis and activation by microbes [reviewed by (1;2)]. The N-terminal half of IRF7 (residues 11-122) serves as the DNA binding region (Figure 3). The mouse IRF7 IRF association domain 1 (IAD1) domain occurs at amino acids 240-416 (3), a region that corresponds to an autoinhibitory domain (AID) mapped by deletion constructs (4). The IAD1 domain is mediates interactions with other IRFs, other transcription factors, or homodimerization. These interactions allow the IRFs to modulate their activity and target a variety of genes. A transactivation domain was mapped to amino acids 132-237. Mouse IRF7 also contains a C-terminal regulatory region at residues 423-457 that is phosphorylated upon viral infection and is necessary for dimerization, nuclear localization and transactivation (4;5). The amino acid mutated by the Houstonian mutation (T246A) lies within the IAD1/AID domain. Please see the record inept for more information about Irf7. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | Type I IFNs are a critical class of cytokines that have antiviral, growth-inhibitory and immunomodulatory functions. Type I IFNs can be divided into two groups: immediate-early response genes that can be induced rapidly in response to immune stimuli without the need for ongoing protein synthesis; and a set of genes that display delayed induction. IFN-β and perhaps IFN-α4 are immediate-early response genes, while other IFN-α subtypes are induced more slowly in response to viral infection and require protein synthesis, a process that is completely dependent on IRF7 transcriptional activity and occurs through a two-step amplification in which IFN-β is initially produced in an IRF3-dependent manner from infected cells (6). Binding of IFN-β to the type I IFN receptor (see the records for macro-1 and macro-2) stimulates the Janus activating kinases (JAK)– signal transducer and activator of transcription (STAT) pathway (see the record for domino), resulting in activation of the transcription factor interferon stimulated gene factor 3 (ISGF3) complex composed of STAT1/STAT2 and IRF9. The ISGF3 complex binds to upstream regulatory consensus sequences of hundreds of genes including IRF7, providing the type I IFN system with a positive feedback loop that allows amplification of the type I IFN response (5;7). Along with IRF7, IRF8 is also required for the second, amplifying phase of IFN transcription by binding to the promoters of IFN-α/β genes and regulating their transcription (8). IRF7-dependent amplification of the type I IFN response is essential during the immune response as IRF7-deficient mice and cells display a severe reduction of type I IFN in response to immune stimuli including cytosolic DNA (9-11). Although Houstonian mice exhibit diminished IFN production in response to dsDNA, they do not exhibit defective type I IFN production in response to TLR stimulation, indicating that the Houstonian mutation is a hypomorphic allele and that Houstonian mice retain normal type I IFN responses to certain stimuli. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer Houstonian_pcr_F: AAGCGTCTCTGTGTAGTGCAGC Houstonian_pcr_R: CAGGAGCAAGACCGTGTTTACGAG Sequencing Primer Houstonian_seq_F: GGGCTCTGAAGTTCTTACTGCT Houstonian_seq_R: TGTTTACGAGGAACCCTATGCAG |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 465 nucleotides is amplified (chromosome 7, - strand): 1 caggagcaag accgtgttta cgaggaaccc tatgcagcat ggcaggtgga agctgtcccc Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Peter Jurek | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Doan Dao, Hexin Shi, Zhao Zhang, Ying Wang, Lei Sun, Jianhui Wang, and Bruce A. Beutler. |