Phenotypic Mutation 'lockdown'

• Allele: lockdown
• Mutation Type: missense
• Chromosome: 4
• Coordinate: 129,451,920 bp (GRCm39)
• Base Change: C ⇒ T (forward strand)
• Gene: Lck
• Gene Name: lymphocyte protein tyrosine kinase
• Synonym(s): Hck-3, p56
• Chromosomal Location: 129,442,142-129,467,415 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016] ; PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Tyrosine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000066209] [ENSMUSP00000099656] [ENSMUSP00000119263] [ENSMUSP00000125777]
• AlphaFold: P06240
• SMART Domains: Protein: ENSMUSP00000066209; Gene: ENSMUSG00000000409; AA Change: C20Y

Domain	Start	End	E-Value	Type
SH3	64	120	3.53e-17	SMART
SH2	125	215	2.07e-34	SMART
TyrKc	245	494	2.66e-133	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000067240)
• SMART Domains: Protein: ENSMUSP00000099656; Gene: ENSMUSG00000000409; AA Change: C20Y

Domain	Start	End	E-Value	Type
SH3	64	120	3.53e-17	SMART
SH2	125	215	2.07e-34	SMART
TyrKc	245	494	2.66e-133	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000102596)
• SMART Domains: Protein: ENSMUSP00000119263; Gene: ENSMUSG00000000409; AA Change: C20Y

Domain	Start	End	E-Value	Type
PDB:1Q69|B	7	33	9e-12	PDB
SCOP:d1awj__	45	92	2e-8	SMART
PDB:1LCK|A	53	92	3e-20	PDB
Blast:SH3	64	92	4e-13	BLAST

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000134336)
• SMART Domains: Protein: ENSMUSP00000125777; Gene: ENSMUSG00000000409; AA Change: C31Y

Domain	Start	End	E-Value	Type
SH3	75	131	3.53e-17	SMART
SH2	136	226	2.07e-34	SMART
TyrKc	256	505	2.66e-133	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000167288)
• Meta Mutation Damage Score: 0.9413
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: gDNA
• MMRRC Submission: 038165-MU
• Last Updated: 2019-09-04 9:46 PM by Katherine Timer
• Record Created: 2015-01-22 2:51 PM by Tao Yue
• Record Posted: 2015-02-12
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Tao Yue, Duanwu Zhang, Bruce Beutler

Accession Number

NCBI RefSeq: NM_001162432, NM_010693, NM_001162433; MGI:96756

Alleles Listed at MGI

All mutations/alleles(24) : Chemically induced (ENU)(2) Gene trapped(15) Targeted(7)

Phenotypic Description

Figure 1. Lockdown mice exhibit an increase in the B:T cell ratio in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine T and B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Lockdown mice exhibit an decrease in the CD4 + to CD8 + T cell ratio in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine CD4 + and CD8 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Lockdown mice exhibit decreased frequencies of peripheral CD4 + T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD4 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Lockdown mice exhibit decreased frequencies of peripheral CD4 + T cells in CD3 + T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD4 + T cell in CD3 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Lockdown mice exhibit increased frequencies of peripheral CD8 + T cells in CD3 + T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8 + T cell in CD3 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Lockdown mice exhibit increased CD44 mean fluorescence intensity (MFI) on total T cells in the periphery. Flow cytometric analysis of peripheral blood was utilized to CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Lockdown mice exhibit increased CD44 mean fluorescence intensity (MFI) on CD8 + T cells in the periphery. Flow cytometric analysis of peripheral blood was utilized to CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The lockdown phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1013, some of which showed an increase in the B:T cell ratio (Figure 1), a decrease in the CD4⁺ to CD8⁺ T cell ratio (Figure 2) caused by a diminished frequency of CD4⁺ T cells (Figure 3) and CD4⁺ T cells in CD3⁺ T cells (Figure 4) coupled with an increased frequency of CD8⁺ T cells in CD3⁺ cells (Figure 5), all in the peripheral blood. Some mice also had an increase in the CD44 mean fluorescence intensity on total T cells (Figure 6) and on CD8⁺ T cells (Figure 7) in the peripheral blood.

Nature of Mutation

Figure 8. Linkage mapping of the normalized CD44 + MFI on peripheral CD8 + T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 35 mutations (X-axis) identified in the G1 male of pedigree R1013. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 35 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Lck:  a G to A transition at base pair 129,558,127 (v38) on chromosome 4, or base pair 15,515 in the GenBank genomic region NC_000070 encoding Lck. The strongest association was found with a recessive model of linkage to the normalized CD44⁺ MFI on peripheral CD8⁺ T cells, wherein five variant homozygotes departed phenotypically from five homozygous reference mice and 11 heterozygous mice with a P value of 5.847 x 10^-6 (Figure 8). The mutation corresponds to residue 149 in the NM_001162432 mRNA sequence in exon 2 of 13 total exons, or at position 191 bp of the NM_001162433 mRNA sequence in exon 2 of 13 total exons, or at position 1,050 of the NM_010693 mRNA sequence in exon 1 of 12 total exons.

15499 GAGAACATTGACGTGTGTGAAAACTGCCACTAT 26    -E--N--I--D--V--C--E--N--C--H--Y- NP_001155904 20    -E--N--I--D--V--C--E--N--C--H--Y- NP_001155905 20    -E--N--I--D--V--C--E--N--C--H--Y- NP_034823

Genomic numbering corresponds to NC_000070. The mutated nucleotide is indicated in red lettering and results in a cysteine to tyrosine substitution at position 31 (C31Y) in the Lck protein isoform encoded by NM_001162432 and a cysteine to tyrosine substitution at position 25 (C25Y) in the Lck protein isoforms encoded by NM_001162433 and NM_010693.

Protein Prediction

Figure 9. The structure of Lck. A, Domain structure of Lck. The position of the lockdown mutation is indicated. B, 3D structure of inactive Src. The unique domain is not part of this structure. Image is interactive; click to see other Lck mutations. UCSF Chimera structure is based on PDB:2SRC, Xu et al, Mol. Cell 3, 629-638 (1999). Click on the 3D structure to view it rotate.

Lck encodes lymphocyte protein tyrosine kinase (Lck), a member of the Src family of nonreceptor tyrosine kinases (Figure 9). Lck is a protein of 56 kDa [also known as p56(lck)], and consists of 509 amino acids. Lck contains tandem Src-homology (SH) 3 and SH2 domains, which are separated by a short linker segment from a C-terminal tyrosine kinase domain terminating in a short C-terminal tail. The kinase domain of Src family kinases (amino acids 238-496 in Lck) consists of two lobes, designated the N- and C-lobes, linked by a flexible hinge. Unique to each Src family kinase is a 60-80 amino acid sequence at the extreme N-terminus, the structure of which is unknown. In Lck, the unique region (amino acids 1-62) functions to target the protein to the plasma membrane and/or lipid rafts through the attachment of fatty acid chains to select residues. The lockdown mutation lies within the unique domain. The effect of the mutation on kinase activity, expression level, or localization has not been tested.

Please see the record iconoclast for information about Lck.

Putative Mechanism

Lck functions in one of the first steps in T cell receptor (TCR) signaling, in which it phosphorylates the immunoreceptor tyrosine-based activation motifs (ITAMS) present on the CD3 heterodimer (CD3εγ or CD3εδ) and CD3ζ chains of the TCR. Recruitment of Lck to the TCR complex depends on association with CD4, which recognizes MHC class II, or CD8, which recognizes MHC class I (1). This event is necessary for the propagation of signals from the TCR. In animal models that are Lck-deficient or are transgenic for a dominant-negative form of Lck, severe combined immunodeficiency (SCID)-like phenotypes are observed. These animals demonstrate severe T cell developmental defects with pronounced thymic deficiency and a dramatic reduction in DP thymocytes, indicating a significant although incomplete block at the DN3 stage of development where pre-TCR signaling is required for further differentiation (2;3). Mature single-positive thymocytes are absent and peripheral T cells are much reduced. The lockdown mutation affects a cysteine residue in the unique domain and results in reduced protein function. However, some function may be retained, as the mature single-positive T cells in the periphery are not completely depleted. Fyn, another Src kinase may compensate to maintain T cell survival at the periphery (4).

Primers

PCR Primer
lockdown_pcr_F: GGAGTGCTGCTATTTTCCAGAGCC
lockdown_pcr_R: GGAACCCAGTCAGGAGCTTGAATC

Sequencing Primer
lockdown_seq_F: CCAGAGCCTTTAGTTATGGTCC
lockdown_seq_R: TCAGGAGCTTGAATCCCACG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 464 nucleotides is amplified (chromosome 4, - strand):

1   ggaacccagt caggagcttg aatcccacga ttcagcgctt ctgtctgcgg ccaatggggg
61  cctctgagct gacgatctcg ggtacttttt gtaacttcca gaacagggct ctaggatgtc
121 tgatgttggg gcgagtggct taggggcagc tccttcaggc ctctctacat tccttcaggg
181 atcatgggct gtgtctgcag ctcaaaccct gaagatgact ggatggagaa cattgacgtg
241 tgtgaaaact gccactatcc catagtccca ctggacagca agatctcggt aagaggaaga
301 tgggattagt gaagggatgg gggccaggag ataggattgg tggagggatg ggggcggagg
361 acataagatt ggtgaaggga tggcatgggg ttgaaaggtt gtgtatccag gagaaaaaac
421 ctaaatggac cataactaaa ggctctggaa aatagcagca ctcc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Turner, J. M., Brodsky, M. H., Irving, B. A., Levin, S. D., Perlmutter, R. M., and Littman, D. R. (1990) Interaction of the Unique N-Terminal Region of Tyrosine Kinase p56lck with Cytoplasmic Domains of CD4 and CD8 is Mediated by Cysteine Motifs. Cell. 60, 755-765.

  2. Molina, T. J., Kishihara, K., Siderovski, D. P., van Ewijk, W., Narendran, A., Timms, E., Wakeham, A., Paige, C. J., Hartmann, K. U., and Veillette, A. (1992) Profound Block in Thymocyte Development in Mice Lacking p56lck. Nature. 357, 161-164.

  3. Levin, S. D., Anderson, S. J., Forbush, K. A., and Perlmutter, R. M. (1993) A Dominant-Negative Transgene Defines a Role for p56lck in Thymopoiesis. EMBO J. 12, 1671-1680.

  4. Seddon, B., and Zamoyska, R. (2002) TCR Signals Mediated by Src Family Kinases are Essential for the Survival of Naive T Cells. J Immunol. 169, 2997-3005.