Allele | lockdown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 129,451,920 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | C ⇒ T (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Lck | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | lymphocyte protein tyrosine kinase | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Hck-3, p56 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 129,442,142-129,467,415 bp (-) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016] PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_001162432, NM_010693, NM_001162433; MGI:96756 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Cysteine changed to Tyrosine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000066209] [ENSMUSP00000099656] [ENSMUSP00000119263] [ENSMUSP00000125777] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P06240 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000066209 Gene: ENSMUSG00000000409 AA Change: C20Y
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000099656 Gene: ENSMUSG00000000409 AA Change: C20Y
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000119263 Gene: ENSMUSG00000000409 AA Change: C20Y
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000125777 Gene: ENSMUSG00000000409 AA Change: C31Y
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.9413 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All mutations/alleles(24) : Chemically induced (ENU)(2) Gene trapped(15) Targeted(7) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | gDNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 038165-MU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:46 PM by Katherine Timer | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2015-01-22 2:51 PM by Tao Yue | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2015-02-12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The lockdown phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1013, some of which showed an increase in the B:T cell ratio (Figure 1), a decrease in the CD4+ to CD8+ T cell ratio (Figure 2) caused by a diminished frequency of CD4+ T cells (Figure 3) and CD4+ T cells in CD3+ T cells (Figure 4) coupled with an increased frequency of CD8+ T cells in CD3+ cells (Figure 5), all in the peripheral blood. Some mice also had an increase in the CD44 mean fluorescence intensity on total T cells (Figure 6) and on CD8+ T cells (Figure 7) in the peripheral blood. |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 35 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Lck: a G to A transition at base pair 129,558,127 (v38) on chromosome 4, or base pair 15,515 in the GenBank genomic region NC_000070 encoding Lck. The strongest association was found with a recessive model of linkage to the normalized CD44+ MFI on peripheral CD8+ T cells, wherein five variant homozygotes departed phenotypically from five homozygous reference mice and 11 heterozygous mice with a P value of 5.847 x 10-6 (Figure 8). The mutation corresponds to residue 149 in the NM_001162432 mRNA sequence in exon 2 of 13 total exons, or at position 191 bp of the NM_001162433 mRNA sequence in exon 2 of 13 total exons, or at position 1,050 of the NM_010693 mRNA sequence in exon 1 of 12 total exons.
Genomic numbering corresponds to NC_000070. The mutated nucleotide is indicated in red lettering and results in a cysteine to tyrosine substitution at position 31 (C31Y) in the Lck protein isoform encoded by NM_001162432 and a cysteine to tyrosine substitution at position 25 (C25Y) in the Lck protein isoforms encoded by NM_001162433 and NM_010693. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Lck encodes lymphocyte protein tyrosine kinase (Lck), a member of the Src family of nonreceptor tyrosine kinases (Figure 9). Lck is a protein of 56 kDa [also known as p56(lck)], and consists of 509 amino acids. Lck contains tandem Src-homology (SH) 3 and SH2 domains, which are separated by a short linker segment from a C-terminal tyrosine kinase domain terminating in a short C-terminal tail. The kinase domain of Src family kinases (amino acids 238-496 in Lck) consists of two lobes, designated the N- and C-lobes, linked by a flexible hinge. Unique to each Src family kinase is a 60-80 amino acid sequence at the extreme N-terminus, the structure of which is unknown. In Lck, the unique region (amino acids 1-62) functions to target the protein to the plasma membrane and/or lipid rafts through the attachment of fatty acid chains to select residues. The lockdown mutation lies within the unique domain. The effect of the mutation on kinase activity, expression level, or localization has not been tested. Please see the record iconoclast for information about Lck. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | Lck functions in one of the first steps in T cell receptor (TCR) signaling, in which it phosphorylates the immunoreceptor tyrosine-based activation motifs (ITAMS) present on the CD3 heterodimer (CD3εγ or CD3εδ) and CD3ζ chains of the TCR. Recruitment of Lck to the TCR complex depends on association with CD4, which recognizes MHC class II, or CD8, which recognizes MHC class I (1). This event is necessary for the propagation of signals from the TCR. In animal models that are Lck-deficient or are transgenic for a dominant-negative form of Lck, severe combined immunodeficiency (SCID)-like phenotypes are observed. These animals demonstrate severe T cell developmental defects with pronounced thymic deficiency and a dramatic reduction in DP thymocytes, indicating a significant although incomplete block at the DN3 stage of development where pre-TCR signaling is required for further differentiation (2;3). Mature single-positive thymocytes are absent and peripheral T cells are much reduced. The lockdown mutation affects a cysteine residue in the unique domain and results in reduced protein function. However, some function may be retained, as the mature single-positive T cells in the periphery are not completely depleted. Fyn, another Src kinase may compensate to maintain T cell survival at the periphery (4). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer lockdown_pcr_F: GGAGTGCTGCTATTTTCCAGAGCC lockdown_pcr_R: GGAACCCAGTCAGGAGCTTGAATC Sequencing Primer lockdown_seq_F: CCAGAGCCTTTAGTTATGGTCC lockdown_seq_R: TCAGGAGCTTGAATCCCACG |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 464 nucleotides is amplified (chromosome 4, - strand): 1 ggaacccagt caggagcttg aatcccacga ttcagcgctt ctgtctgcgg ccaatggggg Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Peter Jurek | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Tao Yue, Duanwu Zhang, Bruce Beutler |