Phenotypic Mutation 'patriot' (pdf version)
Allelepatriot
Mutation Type missense
Chromosome11
Coordinate60,778,032 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Smcr8
Gene Name Smith-Magenis syndrome chromosome region, candidate 8 homolog (human)
Synonym(s) 2310076G09Rik, D030073L15Rik
Chromosomal Location 60,777,524-60,788,287 bp (+)
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts homozygous for a knock-out allele show impaired autophagy induction, a reduced autophagic flux, and abnormal expression of lysosomal enzymes. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001085440, NM_175491; MGI:2444720

Mapped Yes 
Amino Acid Change Isoleucine changed to Threonine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000055926] [ENSMUSP00000099728]
SMART Domains Protein: ENSMUSP00000055926
Gene: ENSMUSG00000049323
AA Change: I2T

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:Folliculin 78 262 5e-12 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000056907)
SMART Domains Protein: ENSMUSP00000099728
Gene: ENSMUSG00000049323
AA Change: I2T

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:Folliculin 87 255 8e-10 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000102667)
Meta Mutation Damage Score 0.708 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
DSS: sensitive day 10
DSS: sensitive day 7
FACS B1a cells in B1 cells - increased
FACS B1b cells - increased
FACS B220 MFI - increased
FACS CD11c+ DCs - increased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD4 T cells - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ CD8 T cells - increased
FACS CD44+ T cells - increased
FACS CD44+ T MFI - increased
FACS CD8a+ DCs (gated in CD11c+ cells) - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS macrophages - increased
FACS naive CD8 T cells in CD8 T cells - decreased
TLR signaling defect: hypersensitivity to CpG + IFNg
TLR signaling defect: hypersensitivity to R848
TLR signaling defect: TNF production by macrophages
Candidate Explorer Status CE: excellent candidate; human score: 2.5; ML prob: 0.964
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (other)(1) Gene trapped(5) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Smcr8 APN 11 60778632 unclassified probably null
IGL00514:Smcr8 APN 11 60778367 nonsense probably null
IGL01563:Smcr8 APN 11 60783845 missense possibly damaging 0.55
IGL01650:Smcr8 APN 11 60778184 missense probably damaging 1.00
IGL02390:Smcr8 APN 11 60779722 missense probably benign 0.03
IGL02582:Smcr8 APN 11 60778895 missense probably benign 0.00
IGL03008:Smcr8 APN 11 60778461 missense probably damaging 1.00
IGL03286:Smcr8 APN 11 60778027 unclassified probably benign
chauvenist UTSW 11 60778598 missense probably damaging 1.00
patriot2 UTSW 11 60778028 start codon destroyed probably null 1.00
patriot3 UTSW 11 60779870 nonsense probably null
R0022:Smcr8 UTSW 11 60780359 missense probably damaging 1.00
R0022:Smcr8 UTSW 11 60780359 missense probably damaging 1.00
R0197:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R0333:Smcr8 UTSW 11 60780222 missense possibly damaging 0.96
R0346:Smcr8 UTSW 11 60779750 missense probably benign 0.00
R0701:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R0720:Smcr8 UTSW 11 60778443 missense probably damaging 1.00
R0883:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R1178:Smcr8 UTSW 11 60779532 missense probably damaging 1.00
R1418:Smcr8 UTSW 11 60778032 missense probably damaging 1.00
R2012:Smcr8 UTSW 11 60778184 missense probably damaging 1.00
R3690:Smcr8 UTSW 11 60778028 start codon destroyed probably null 1.00
R3767:Smcr8 UTSW 11 60779504 missense probably benign 0.30
R4801:Smcr8 UTSW 11 60778610 unclassified probably null
R4802:Smcr8 UTSW 11 60778610 unclassified probably null
R4862:Smcr8 UTSW 11 60778071 missense probably benign 0.01
R5108:Smcr8 UTSW 11 60779870 nonsense probably null
R5361:Smcr8 UTSW 11 60778292 missense probably damaging 1.00
R5745:Smcr8 UTSW 11 60784151 missense probably benign 0.00
R5806:Smcr8 UTSW 11 60780382 critical splice donor site probably null
R6041:Smcr8 UTSW 11 60779568 missense probably damaging 1.00
R6277:Smcr8 UTSW 11 60778809 missense probably benign 0.07
R6289:Smcr8 UTSW 11 60778598 missense probably damaging 1.00
R6445:Smcr8 UTSW 11 60779015 missense possibly damaging 0.95
R6826:Smcr8 UTSW 11 60778862 missense possibly damaging 0.85
R7062:Smcr8 UTSW 11 60780354 missense probably damaging 1.00
R7176:Smcr8 UTSW 11 60778946 missense probably damaging 1.00
R7516:Smcr8 UTSW 11 60779988 missense probably benign 0.01
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 2019-10-10 4:44 PM by External Program
Record Created 2015-02-02 1:17 PM by Emre Turer
Record Posted 2019-01-07
Phenotypic Description
Figure 1. Patriot mice showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 days after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Patriot mice showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 10 days after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Patriot mice exhibit increased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Patriot mice exhibit increased frequencies of peripheral CD11c+ DCs. Flow cytometric analysis of peripheral blood was utilized to determine DC frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Patriot mice exhibit increased frequencies of peripheral macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Patriot mice exhibited increased TNFα secretion in response to TLR9 ligand, CpG. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The patriot phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1418, some of which showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 (Figure 1) and 10 days (Figure 2) after DSS exposure (1); weight loss is used to measure DSS susceptibility. Some mice also showed increased frequencies of B1b cells (Figure 3), CD11c+ dendritic cells (Figure 4), and macrophages (Figure 5), all in the peripheral blood. Increased TNF production in response to the TLR9 ligand CpG was observed using gene-based superpedigree analysis of pedigrees R1418 and R3960 (Figure 6) (1).

Nature of Mutation
Figure 7. Linkage mapping of increased B1b cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 93 mutations (X-axis) identified in the G1 male of pedigree R1418. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.
Figure 8. CRISPR-Smcr8 replacement mice showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 days after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 93 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Smcr8: a T to C transition at base pair 60,778,032 (v38) on chromosome 11, or base pair 508 in the GenBank genomic region NC_000077 encoding Smcr8. The strongest association was found with a recessive model of inheritance to the B1b cell frequency, wherein three variant homozygotes departed phenotypically from 11 homozygous reference mice and 15 heterozygous mice with a P value of 7.998 x 10-8 (Figure 7).  

 

The mutation corresponds to residue 508 in the mRNA sequence NM_001085440 within exon 1 of 2 total exons.

 

492 ATTTCAGGAAATATGATCAGCGCCCCTGATGTG

1               -M--I--S--A--P--D--V-

 

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine (I) to threonine (T) substitution at position 2 (I2T) in the SMCR8 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

 

The causative mutation in Smcr8 for the DSS day 7 phenotype was validated by CRISPR-mediated replacement of the Smcr8patriot allele (Figure 8; [DSS Day 7; P = 7.353 x 10-8]). The B1 cell, DC, and macrophage phenotypes failed to validate.

Protein Prediction
Figure 9. Domain organization of SMCR8. The patriot mutation results in an isoleucine to threonine substitution at position 2. This image is interactive. Other mutations found in SMCR8 are noted in red. Click on each mutation for more information.

Smcr8 encodes SMCR8 (Smith-Magenis syndrome chromosome region, candidate 8). SMCR8 is a homolog of the DENN module, which is GDP-GTP exchange factor for Rab GTPases (2). The DENN module and SMCR8 both have an N-terminal longin (alternatively, u-DENN) domain, a DENN domain, and a d-DENN domain (Figure 9). The longin domain mediates interaction with GTPases (3) and has a PAS domain-like fold similar to ligand-binding domains (4). The central DENN domain has an α/β three-layered sandwich domain with a central sheet of 5-strands and β−α units arranged similar to the topology of a minimal version of the P-loop NTPase α/β domain (2). The d-DENN domain is an all-α helical domain.

 

TANK-Binding Kinase 1 (TBK1; see the record for pioneer)-mediated SMCR8 phosphorylation at Ser402 and Thr796 activates SMCR8, putatively increasing the GDP exchange rate toward the small GTPase RAB39B (5). SMCR8 is also putatively phosphorylated by AMPK, mTORC1, and ULK1 (5-7); the functional significance of AMPK-, mTORC1-, and ULK1-mediated SMCR8 phosphorylation is unknown.

 

Smcr8 generates a 935-amino acid and a 785-amino acid protein isoform (8). The first exon of Smcr8 is similar between the two variants, with exon 1 encompassing the entire shorter protein isoform and 84% of the longer protein isoform. The function of the shorter SMCR8 isoform is unknown.

 

The patriot mutation results in an isoleucine (I) to threonine (T) substitution at position 2 (I2T) in the SMCR8 protein; amino acid 2 is within an undefined region of the canonical SMCR8 protein.

Expression/Localization

The SMCR8 gene is expressed in all human and mouse tissues (9). SMCR8 localizes to the nucleus, cytosol, and on lysosomes (5;10-12).

Background
Figure 10. Role of SMCR8 in the autophagy. During autophagy, cytoplasmic proteins or organelles are engulfed into double-membrane vesicles called autophagosomes. The autophagosomes subsequently fuse with lysosomes to form autolysosomes, which are primed for degradation. SMCR8 regulates phagophore formation, autophagosome maturation, and lysosomal function. SMCR8 interacts with C9ORF72 and WDR41 to form the SWC (SMCR8-WDR41-C9ORF72) tripartite complex. After TBK1-mediated phosphorylation of SMCR8, the SWC complex promotes GDP exchange for RAB39B and subsequent interaction with the ULK1 autophagy initiation complex (ULK1/FIP200/autophagy-related protein 13 [ATG13]/ATG101). The SWC-ULK1 interaction mediates trafficking of the ULK1 complex to the phagophore. The interaction with RAB39B also putatively promotes the delivery of poly-ubiquitinated misfolded protein aggregates to the autophagosome. This image is interactive. Click on the image to view other mutations found in the pathway. Click on each mutation for more information.

Autophagy is a intracellular recycling and degradation process in which cytoplasmic proteins or organelles are engulfed into double-membrane vesicles called autophagosomes (Figure 10). The autophagosomes subsequently fuse with lysosomes to form autolysosomes, which are primed for degradation. Autophagy removes aggregates of misfolded proteins and defective organelles as well as provides energy and recycles cell components.

 

SMCR8 interacts with C9ORF72 and WDR41 (see the record for gogi) to form the SWC (SMCR8-WDR41-C9ORF72) tripartite complex, which functions as a GDP-GTP exchange factor for the small GTPases RAB8A and RAB39B that function in vesicle trafficking and autophagy (Figure 10) (10-14). After TBK1-mediated phosphorylation of SMCR8, the SWC complex interacts with the ULK1 autophagy initiation complex (ULK1/FIP200/autophagy-related protein 13 [ATG13]/ATG101) via C9ORF72 binding (11;13;14). The interaction between the SWC complex and the ULK1 complex regulates the expression and activity of ULK1 (11;12). CRISPR/Cas9-mediated knockout of SMCR8 or C9ORF72 in HeLa cells resulted in enlarged lysosome vesicles in the knockout cells, while SMCR8 knockout alone showed accumulation of lysosomes and lysosomal enzymes as well as impaired autophagy induction (10;11;13-15). Mouse embryonic fibroblasts from Smcr8-deficient mice exhibited abnormal autophagy as well as a block in lysosomal degradation (MGI; accessed August 17, 2017).

 

The mTOR-associated signaling pathway regulates cell growth, size, metabolism, and growth factor signaling by stimulating protein synthesis (16). When there are sufficient nutrients, mTOR signaling is active allowing for protein synthesis and an increase in cell size (17-19). In contrast, when nutrient levels decrease or in conditions of cell stress, protein synthesis is inhibited with a concomitant decrease in cell size and cell proliferation (17;18). mTOR can be incorporated into both the mTORC1 and mTORC2 complex. mTORC1 signaling in response to changes in amino acid availability is a lysosome-dependent process. When mTORC1 is activated upon raptor binding to mTOR, it phosphorylates several targets, including S6 kinase 1 (S6K1) and 4E-binding protein 1 (4E-BP1) (20;21). S6K1, in addition to S6K2, is a kinase that phosphorylates S6, a component of the small (40S) ribosomal subunit (19). Autophagy is initiated upon inhibition of mTORC1, resulting in formation of an active ULK1 complex (22). SMCR8-deficient cells showed increased phosphorylation of S6, indicating that SMCR8 negatively regulates mTORC1 signaling (10).

 

SMCR8 can also modulate the expression of several autophagic and lysosomal genes (e.g., ULK1 and WIPI2) independent of the SWC complex (12). SMCR8 is a putative STRaND (shuttling transcriptional regulators and non-DNA binding) protein. STRaND proteins translocate from the cytoplasm to the nucleus to control gene expression through association with transcription factors (23). The method by which SMCR8 translocates to the nucleus, and the transcription factors SMCR8 putatively associates with, are unknown.

 

Smith-Magenis syndrome is caused (in 90% of cases) by a 3.7-Mb interstitial deletion in chromosome 17p11.2; SMCR8 is within the 17p11.2 region that is deleted (24;25). Patients with Smith-Magenis syndrome exhibit several phenotypes, including brachycephaly, prognathism, growth retardation, behavioral problems, mental retardation, hypotonia, speech delay, small ears, conductive hearing loss, esotropia, dental enamel dysplasia, and prominent premaxilla (24;26).

 

Similar to patriot mice (see “Phenotypic Description”), Smcr8-/- and SMCR8-mutant (Smcr8I2T/I2T) showed increased TNF production in response to the TLR9 ligand CpG (1). The Smcr8-/- and Smcr8I2T/I2T mice also showed increased TNF responses and IL-6 production in response to stimulation with TLR7 and TLR3 ligands; TNF production was normal in response to TLR2 or TLR4 stimulation. Smcr8-/- and Smcr8I2T/I2T mice also showed splenomegaly and lymphadenopathy at 9 and 12 months of age (1). The mice showed normal numbers of macrophages, monocytes, neutrophils, B cells, and T cells in the peripheral blood; however, the percentages of naïve CD4+ and CD8+ T cells was reduced and the percentages of activated CD4+ and CD8+ T cells was increased (1). The mice also showed increased plasma levels of the cytokine IL-12p40 compared to wild-type mice (1). Smcr8-/- macrophages showed an accumulation of putative lysosomes. The Smcr8-/- and Smcr8I2T/I2T mice also showed susceptibility to DSS treatment (1). Another Smcr8-/- mouse model exhibited autoimmunity and increased lysosomal exocytosis in macrophages (8).

Putative Mechanism

Figure 11.  Overview of endosomal Toll-like receptor (TLR) signaling pathways. TLR3, 7, and 9 are localized in the endosome. Once TLR complexes recognize their ligands, they recruit combinations of adaptor proteins (MyD88, TICAM, TRAM, TIRAP) via homophilic TIR domain interactions. Signaling events downstream of TLR activation ultimately lead to the induction of thousands of genes including TNF and type I IFN. 

 

In the MyD88-dependent pathway, MyD88 (lime green) recruits IRAK kinases. TRAF6 and IRF5 are also recruited to this complex. Phosphorylation of IRAK1 by IRAK4 allows dissociation of IRAK1 and TRAF6. K63 ubiquitination (small light blue circles) of TRAF6 recruits TAK1 and the TAK1 binding proteins, TAB1 and TAB2. Activation of TAK1 leads to activation of the IKK complex. NEMO polyubiquitination by TRAF6 is necessary for IKK complex function. The IKK complex phosphorylates IκB, resulting in IκB ubiquitination and degradation (small pink circles), releasing NF-κB into the nucleus. Activation of TLR7 and 9 recruits MyD88 and IRAK4, which then interact with TRAF6, TRAF3, IRAK1, IKKα, osteopontin (OPN), and IRF7. IRAK-1 and IKKα phosphorylate and activate IRF7, leading to transcription of interferon-inducible genes and production of large amounts of type I IFN.

 

In the TICAM-dependent pathway stimulated by TLR3 or 4 activation, TICAM (bright yellow) recruits polyubiquitinated RIP1, which interacts with the TRAF6/TAK1 complex and leads to NF-κB activation and proinflammatory cytokine induction. TICAM signaling also leads to type I IFN production through phosphorylation and activation of IRF3 by a complex containing TRAF3, TBK1 and IKKe; RIP1 is not required for TICAM-dependent activation of IRF3.

Toll-like receptors (TLRs) play an essential role in the innate immune response as key sensors of invading microorganisms by recognizing conserved molecular motifs found in many different pathogens, including bacteria, fungi, protozoa and viruses. TLR signaling initiates a cascade of signaling events involving various kinases, adaptors and ubiquitin ligases, ultimately leading to transcriptional activation of cytokine and other genes through the transcription factors NF-κB, AP-1, interferon responsive factor (IRF)-3, and IRF-7. The endosomal TLRs recognize exogenous nucleic acids:  double-stranded DNA unmethylated at CpG motifs (TLR9), single-stranded (ss) RNA viruses (TLR7 and TLR8) and double-stranded RNA (dsRNA; TLR3) (Figure 11). Plasmacytoid dendritic cell recognition of some ssRNA viruses via TLR7 requires the transport of cytosolic viral replication intermediates into lysosomes by autophagy (27), a process by which cells engulf parts of their own cytoplasm to eliminate foreign material or recycle various molecules. Proteolytic cleavage of TLR7 and TLR9 within their respective ectodomains occurs in the endolysosome (28;29). Although full length and cleaved forms of TLR9 are capable of binding ligand, only the cleaved form can recruit MyD88 and lead to signaling. The cleavage mechanism has been postulated to restrict receptor activation to endolysosomal compartments and prevent responses to self-nucleic acids (28).
Once activated, TLR9 signaling requires the adapter MyD88 and, like other MyD88-dependent TLRs, recruits IL-1R-associated kinase 1 (IRAK1), IRAK4 and tumor necrosis factor receptor-associated factor 6 (TRAF6), leading to NF-κB and MAP kinase activation (30). MyD88, together with TRAF6 and IRAK4, has also been shown to bind interferon regulatory factor 7 (IRF7) directly in order to stimulate IFN-α production (31;32).

 

Loss of SMCR8 function results in aberrant activation of endosomal TLRs. The defects in TLR9-associated signaling observed in the patriot mice is proposed to be caused by defects in the SWC complex due to loss of SMCR8-assocated function (1). Loss of SWC complex function causes defects in lysosome and phagosome maturation, resulting in protracted TLR stimulation. The colitis phenotype observed in the patriot mice is putatively caused by defects in endosomal TLR signaling; the endosomal TLRs are required for protection in colitis.

Primers PCR Primer
patriot_pcr_F: AGGTCCCAAACCTTGAGAGTCTGC
patriot_pcr_R: CTGGTAATCCACCGACATAATCCGC

Sequencing Primer
patriot_seq_F: AGAGTCTGCGGCAATTCG
patriot_seq_R: ACCTGCTCAGAGAACTCGG
Genotyping

Patriot genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

R14180061_PCR_F: 5’- AGGTCCCAAACCTTGAGAGTCTGC-3’

R14180061_PCR_R: 5’- CTGGTAATCCACCGACATAATCCGC-3’

 

Sequencing Primers

R14180061_SEQ_F: 5’- AGAGTCTGCGGCAATTCG-3’
 

R14180061_SEQ_R: 5’- ACCTGCTCAGAGAACTCGG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 489 nucleotides is amplified (NCBI RefSeq: NC_000077, chromosome 11):

 

aggtcccaaa ccttgagagt ctgcggcaat tcgagttctt cgttgtgtga cagggcagtt       

taggatcccc ggaagtgcaa agaaggccgc aagaacttcg ttttcgcatc cagaggcctg      

actctccctc cgaccaaccc tacattattt tccatttcct ctcaatgtgc ttgccatatt      

tcaggaaata tgatcagcgc ccctgatgtg gtggccttca ccaaggaaga tgaatacgag      

gaagaacctt acaatgagcc cgctttgcct gaggagtact cagtccctct ctttccttat      

gccagccagg gggcaaaccc ctggtctaaa ctgtctgggg ccaagttctc cagggacttc      

atcctcattt ccgagttctc tgagcaggtg ggaccccagc ccttgcttac catccccaat      

gacaccaaag tttttggcac ttttgatctt aattacttct ctttgcggat tatgtcggtg      

gattaccag

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated T is shown in red text (Chr. + strand, T>C).

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsWilliam McAlpine, Emre Turer, and Bruce Beutler