Phenotypic Mutation 'medea'

• Allele: medea
• Mutation Type: nonsense
• Chromosome: 17
• Coordinate: 88,287,651 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Msh6
• Gene Name: mutS homolog 6
• Synonym(s): Gtmbp, GTBP, Msh6
• Chromosomal Location: 88,282,490-88,298,320 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death and are predisposed to tumor formation. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tryptophan changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000005503]
• AlphaFold: P54276
• SMART Domains: Protein: ENSMUSP00000005503; Gene: ENSMUSG00000005370; AA Change: W97*

Domain	Start	End	E-Value	Type
low complexity region	23	46	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
PWWP	90	152	9.01e-30	SMART
low complexity region	198	212	N/A	INTRINSIC
low complexity region	216	230	N/A	INTRINSIC
low complexity region	239	264	N/A	INTRINSIC
low complexity region	273	291	N/A	INTRINSIC
low complexity region	373	389	N/A	INTRINSIC
Pfam:MutS_I	406	525	4.7e-35	PFAM
Pfam:MutS_II	536	700	1.4e-10	PFAM
MUTSd	750	1100	4.56e-86	SMART
MUTSac	1125	1319	1.68e-116	SMART

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: gDNA
• Last Updated: 2019-05-22 4:44 PM by Diantha La Vine
• Record Created: 2015-02-11 6:39 PM by Tao Yue
• Record Posted: 2017-01-11
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Tao Yue, Bruce Beutler

Accession Number

NCBI RefSeq: NM_010830; MGI:1343961

Alleles Listed at MGI

All mutations/alleles(45) : Gene trapped(39) Targeted(6)

Phenotypic Description

Figure 1. Homozygous medea mice exhibit an reduced serum IgE levels. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The medea phenotype was identified among G3 mice of the pedigree R1770, some of which showed reduced levels of total IgE in the serum (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased OVA-specific IgE to total IgE ratio after OVA immunization using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 72 mutations (X-axis) identified in the G1 male of pedigree R1770. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 72 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Msh6:  a G to A transition at base pair 87,980,223 (v38) on chromosome 17, or base pair 5,174 in the GenBank genomic region NC_000083 encoding Msh6. The strongest association was found with a recessive model of linkage to the normalized OVA-specific IgE to total IgE ratio, wherein three variant homozygotes departed phenotypically from nine homozygous reference mice and nine heterozygous mice with a P value of 2.495 x 10^-20 (Figure 2). 

The mutation corresponds to residue 389 in the mRNA sequence NM_010830 within exon 2 of 10 total exons.

373 CCAGGTGATTTGGTTTGGGCTAAGATGGAAGGT 92  -P--G--D--L--V--W--A--K--M--E--G-

The mutated nucleotide is indicated in red.  The mutation results in substitution of tryptophan (W) 97 for a premature stop codon (W97*) in the MSH6 protein.

Protein Prediction

Figure 3. Domain organization of MSH6. MSH6 has a PIP motif, a PWWP sequence, a DNA-mismatch-binding domain, a connector, a core, a clamp, an ATPase domain, and a helix-turn-helix (HTH). The location of the medea mutation results in a tryptophan to stop codon substitution at position 97. See the text for more details. This image is interactive. Other mutations found in MSH6 are noted in red. Click on each allele for more information.

Figure 4. Crystal structure of the human MutSα complex with a DNA substrate. The structure is comprised of full-length MSH2 and a MSH6 fragment that lacks the first 340 amino acids. Figure was generated by UCSF chimera and is modeled after PDB:2OBF.

Msh6 encodes MSH6 (alternatively, G/T mismatch-binding protein, GTBP), a member of the highly conserved MutS family of DNA mismatch repair (MMR) enzymes (1).  MSH6 has an N-terminal disordered domain that has several basic amino acids that provide electrostatic attractions to DNA (2). The N-terminus of MSH6 has a conserved PIP motif (QXX(L/I)XXFF; amino acids 4-11) that mediates an interaction with PCNA, a PWWP sequence (amino acids 90-152) that mediates interactions with chromatin-associated proteins such as chromatin assembly factor −1 (CAF-1) (3), a DNA replication clamp necessary for MMR (4;5), three canonical nuclear localization sequences (6), and a putative non-classical nuclear import Ser-Pro-Ser sequence (amino acids 781-783) (7). The MutS proteins have similar domain organization after the N-terminus: a DNA mismatch-binding domain (domain 1), a connector domain (alternatively, linker domain; domain 2), a core (alternatively, lever) domain that is composed of two separate subdomains that join together to form a helical bundle (domain 3), a clamp region between the two subdomains of the core domain (domain 4), and an adenosine binding and hydrolysis (ATPase) domain (domain 5) that has two ATPase sites (ATP binding and hydrolysis are necessary for MMR), and a HTH (helix-turn-helix) domain (domain 6) involved in dimer contacts (Figure 3). A Phe-X-Glu motif within domain 1 confers mismatch binding affinity. MutS complexes have intrinsic ATPase activity through an adenine nucleotide binding cassette (ABC) motif (8-10).

MSH6 heterodimerizes with MSH2, another member of the MutS family, to form a mismatch recognition complex (MutSα) that mediates exchange of ADP and ATP as DNA mismatches are bound and dissociated (11-13). The structure of the human MutSα complex with a DNA substrate has been solved [Figure 4; PDB:2OBF; (14)]. The structure is comprised of full-length MSH2 and a MSH6 fragment that lacks the first 340 amino acids. MutSα forms an asymmetric oval disc with two channels. The two ATPase domains (one from each subunit) are located at the end of the oval. The DNA substrate is bound to the larger of the two channels. Only the MSH6 subunit makes contact with the mispaired bases. The MSH6 and MSH2 are pseudosymmetric and share similar domains, but they differ in length. Domain 1 (the DNA mismatch-binding domain) is a mixed α/β structure. In MSH2, domain 1 is rotated up and away from the DNA backbone and makes only one contact with the DNA. Domain 1 is connected to domain 2 by an extended strand. Domain 2 (the connector domain) also is a mixed α/β structure. Domain 2 packs into a cleft formed by domains 5 and 3. There are three surface loops (amino acids 545–555, 602–612, and 650–675 in MSH6) in domain 2 that may mediate protein-protein interactions. Domain 3 (the core domain) has an approximate 60 amino acid α helix that spans the entire distance between domains 4 and 5. One loop in domain 3 is highly conserved (amino acids 757-782 in MSH6), and is putatively involved in signal transduction between the ATPase and DNA binding domains. Domain 4 (the clamp region) is small, and is largely composed of β strand domains that are inserted between the two halves of domain 3. Domain 4 makes significant nonspecific DNA contacts. Domain 5 (the ATPase domain) is highly conserved, and is a bilobed mixed α β structure. The C-terminus of each domain 5 forms a helix-turn-helix motif that interacts with domain 5 of the opposed protomer.

The medea mutation results in substitution of tryptophan 97 for a stop codon; residue 97 is within the PWWP sequence.

Expression/Localization

Msh6 is expressed in mouse heart, brain, spleen, lung, liver, skeletal muscle, kidney, and testis (15). MSH6 is predominantly localized to the nucleus (13).

Background

Figure 5. Model for mammalian DNA mismatch repair (MMR). The MutSα complex recognizes single nucleotide mismatches and 1-bp insertion/deletion loops. MutSα binds to DNA as a sliding clamp. MutLα then binds to hMutSα to guide an exonuclease to remove several bases from the newly synthesized DNA strand, with subsequent re-synthesis of DNA with the correct base pairing.When the MutS complexes bind DNA, they exchange ADP for ATP. For the MMR proteins to be released from DNA, ATP is hydrolyzed to ADP. Figure and legend are adapted from Jang and Chung, 2010 .

The DNA MMR pathway removes base mismatches and insertion/deletion mispairs that occur during DNA replication and recombination (Figure 5). During MMR, a MutS heterodimer [MutSα or MSH2–MSH3 (MutSβ)] binds to DNA mismatches (2). MutSα preferentially recognizes single base (G/T) mismatches and one- or two-nucleotide insertion/deletion mispairs (5), while MutSβ preferentially recognizes insertion/deletion mispairs that contain two or more extra bases. Upon binding, the MutS undergoes an ADP to ATP exchange and a conformational change, followed by recruitment of the MutL heterodimer [MLH1–PMS2 (MutLα), MLH1–PMS1 (MutLβ), or MLH1–MLH3 (MutLγ)], which cleaves the defective strand near the mismatch site. The MutS-MutL complex then recruits an exonuclease, subsequently leading to strand-specific excision. PCNA coordinates with the exonuclease to excise the mismatch-containing region. The removed DNA fragment is resynthesized by DNA polymerase δ and the repair process is completed by DNA ligase.

MutSα also functions at sites of base excision repair, transcription-coupled repair, and double strand break repair (16). MutSα recognizes several types of lesions including O(6)methylguanine (O⁶meG), complex pyrimidine dimers, halogenated pyrimidines, bulky adducts (e.g., benzo[c]phenanthrene dihydrodiol epoxide), and cisplatin adducts (17;18).

MSH6 is required for MMR of activation-induced cytidine deaminase (AID)-generated dU:G mispairs in somatic hypermutation of A:T nucleotides and class switch recombination (CSR) in B cells (19-22). MSH6 functions in both the induction and repair of DNA double strand breaks in switch regions (23). In humans, MSH6 primarily introduces mutations in Sμ regions during Ig CSR (23). In MSH6-deficient patients, somatic hypermutation in the Ig V regions was impaired and Ig CSR was slightly defective (23). As a result, the levels of serum IgM levels were elevated, and IgG (IgG1, IgG2, and IgG4) levels were reduced (23). CSR toward IgE and IgA were also defective (23). The number of IgM⁻IgD⁻CD19⁺CD27⁺ B cells in the MSH6-deficient patients was reduced compared to normal levels (23). In MSH6 deficiency, S junction repair preferentially involves the c-NHEJ–independent pathway (23). B cells from Msh6-deficient (Msh6^-/-) mice exhibited reduced IgG switching to IgG3 and IgG1 upon induction with lipopolysaccharide (19).

MSH6 has additional DNA DSB-associated functions. MSH6 interacts with Ku70, a double strand repair protein within the non-homologous end-joining (NHEJ) pathway, enhancing NHEJ (24). MutSα can disassemble nucleosomes by binding to nucleosome DNA that contains a mismatch (25). MutSα forms a complex with the DNA helicase BLM, p53, and RAD51 at Holliday junctions during homologous recombination (26). MutSα and p53 regulate the binding ability of BLM at Holliday junctions. The amount of BLM-p53-RAD51 complexes increased upon knockdown of MSH2 or MSH6 expression (26).

Msh6^-/- mice are viable, but cells from Msh6^-/- mice exhibit defects in single base pair DNA nucleotide mismatch repair; one, two, and four nucleotide insertion/deletion mismatch repair was unaffected (15). Msh6^-/- mice have a reduced life span (10 month median survival time) and are more susceptible to late-onset cancer including B- and T-cell lymphomas (non-Hodgkin’s lymphoma) and/or epithelial tumors of the skin, liver, lung, uterus, and intestine (15;27;28). Homozygous mice with a missense mutation in Msh6 (Msh6^{T1217D/T1217D}) are viable and fertile, but exhibited slightly reduced survival compared to heterozygous (Msh6^T1217D/+) mice. The homozygous mice all died by 20 months of age due to increased cancer (mostly B or T cell non-Hodgkin's lymphoma, intestinal tumors, and skin cancer) susceptibility (29). Mouse embryonic fibroblasts (MEFs) from the Msh6^{T1217D/T1217D} mice exhibited normal G/T mismatch binding activity, but the G/T mismatch binding activity was resistant to ATP-dependent mismatch release (29). MEFs from Msh6^{T1217D/T1217D} mice also exhibited defects in repairing substrates with G/G mismatches, single-base insertion, or two-base insertion mismatches, indicating that the MSH6^T1217D protein interferes with the function of Msh2-Msh3 complexes in dinucleotide insertion/deletion mutation repair.

Mutations in MSH6 are associated with hereditary nonpolyposis colorectal cancer type 5 (HNPCC; alternatively, Lynch syndrome; OMIM: #614350) (30-32), endometrial cancer (OMIM: #608089) (33), and mismatch repair cancer syndrome (alternatively, Turcot syndrome; OMIM: #276300) (34-36). Patients with HNPCC often develop colonic, endometrial, and ovarian tumors as well as tumors at other sites. Turcot syndrome is a rare childhood syndrome marked by four main tumor types: hematologic malignancies, brain/central nervous system tumors, colorectal tumors, and other malignancies. In chicken DT40 B cell lymphoma cells, Msh6 deficiency resulted in impaired growth and abnormal morphology due to cell cycle defects and genomic re-replication (37).

Putative Mechanism

Medea mice exhibit diminished IgE levels similar to MSH6-deficient patients in which CSR toward IgE and IgA were defective (23), indicating that MSH6^medea exhibits loss-of-function.

Primers

PCR Primer
medea_pcr_F: TTGCCAGAAGCCTCCAAAGGAGTC
medea_pcr_R: GTGCTCTGATGTGAAACGCAGC

Sequencing Primer
medea_seq_F: GAAGCCTCCAAAGGAGTCTTAATAC
medea_seq_R: GCCTCTTTAGCATGTGAGAAC

Genotyping

Medea genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

R17700074 (F): 5’- TTGCCAGAAGCCTCCAAAGGAGTC-3’

R17700074 (R): 5’- GTGCTCTGATGTGAAACGCAGC-3’

Sequencing Primers

R17700074_seq(F): 5’- GAAGCCTCCAAAGGAGTCTTAATAC-3’
 

R17700074_seq(R): 5’- GCCTCTTTAGCATGTGAGAAC-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 781 nucleotides is amplified (Chr.17: 87980050-87980830, GRCm38; NCBI RefSeq:NC_000083):

ttgccagaag cctccaaagg agtcttaata ctttgttaaa actgtttatc tgtgggtaat

tgccattgag gtaaggtagc caaatactaa ctggctttta tatatatgtg tttttgtttt

ttgatttttc ttttgcaaca gttcttgtga cttctcacca ggtgatttgg tttgggctaa

gatggaaggt tacccctggt ggccttgcct agtttataat catccctttg atggaacgtt

catccggaag aaagggaaat ctgtccgtgt tcatgtacag ttctttgatg acagcccaac

aaggggctgg gttagcaaaa ggatgttaaa gccatataca ggtaagaggt aaatggggat

gggggtgatt catgatattg tgatgtgtgt gtgtgtgttt ccttagcaaa ttgcaggaat

agcagttgta aaagttctca catgctaaag aggcaagaca cagctggttt tagctacttt

gttttgtatg gaaattttat ttttgtaagt cctttgactt acagcagtta aagcccttta

agaaaaagtg gtctcttgat tgggagttag gtaactgtgc tatgaaagtg agacatgaga

agtgtagagt taatagctct attttgaagt aaatatgtag gtaatgtaag caggataagt

agcatggatt atatatatat tatatattat agagtgacat tctctataac agatgcagat

ctcatagcct ccaaaattgt gacctatgac tatatttgag ctgcgtttca catcagagca

c

FASTA sequence

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated G (G>A) is shown in red text.

References

  1. Palombo, F., Gallinari, P., Iaccarino, I., Lettieri, T., Hughes, M., D'Arrigo, A., Truong, O., Hsuan, J. J., and Jiricny, J. (1995) GTBP, a 160-Kilodalton Protein Essential for Mismatch-Binding Activity in Human Cells. Science. 268, 1912-1914.

  2. Clark, A. B., Deterding, L., Tomer, K. B., and Kunkel, T. A. (2007) Multiple Functions for the N-Terminal Region of Msh6. Nucleic Acids Res. 35, 4114-4123.

  3. Laguri, C., Duband-Goulet, I., Friedrich, N., Axt, M., Belin, P., Callebaut, I., Gilquin, B., Zinn-Justin, S., and Couprie, J. (2008) Human Mismatch Repair Protein MSH6 Contains a PWWP Domain that Targets Double Stranded DNA. Biochemistry. 47, 6199-6207.

  4. Lau, P. J., and Kolodner, R. D. (2003) Transfer of the MSH2.MSH6 Complex from Proliferating Cell Nuclear Antigen to Mispaired Bases in DNA. J Biol Chem. 278, 14-17.

  5. Flores-Rozas, H., Clark, D., and Kolodner, R. D. (2000) Proliferating Cell Nuclear Antigen and Msh2p-Msh6p Interact to Form an Active Mispair Recognition Complex. Nat Genet. 26, 375-378.

  6. Gassman, N. R., Clodfelter, J. E., McCauley, A. K., Bonin, K., Salsbury, F. R.,Jr, and Scarpinato, K. D. (2011) Cooperative Nuclear Localization Sequences Lend a Novel Role to the N-Terminal Region of MSH6. PLoS One. 6, e17907.

  7. Knudsen, N. O., Andersen, S. D., Lutzen, A., Nielsen, F. C., and Rasmussen, L. J. (2009) Nuclear Translocation Contributes to Regulation of DNA Excision Repair Activities. DNA Repair (Amst). 8, 682-689.

  8. Gradia, S., Acharya, S., and Fishel, R. (1997) The Human Mismatch Recognition Complex hMSH2-hMSH6 Functions as a Novel Molecular Switch. Cell. 91, 995-1005.

  9. Hughes, M. J., and Jiricny, J. (1992) The Purification of a Human Mismatch-Binding Protein and Identification of its Associated ATPase and Helicase Activities. J Biol Chem. 267, 23876-23882.

  10. Blackwell, L. J., Martik, D., Bjornson, K. P., Bjornson, E. S., and Modrich, P. (1998) Nucleotide-Promoted Release of hMutSalpha from Heteroduplex DNA is Consistent with an ATP-Dependent Translocation Mechanism. J Biol Chem. 273, 32055-32062.

  11. Acharya, S., Wilson, T., Gradia, S., Kane, M. F., Guerrette, S., Marsischky, G. T., Kolodner, R., and Fishel, R. (1996) HMSH2 Forms Specific Mispair-Binding Complexes with hMSH3 and hMSH6. Proc Natl Acad Sci U S A. 93, 13629-13634.

  12. Mazur, D. J., Mendillo, M. L., and Kolodner, R. D. (2006) Inhibition of Msh6 ATPase Activity by Mispaired DNA Induces a Msh2(ATP)-Msh6(ATP) State Capable of Hydrolysis-Independent Movement Along DNA. Mol Cell. 22, 39-49.

  13. Antony, E., and Hingorani, M. M. (2003) Mismatch Recognition-Coupled Stabilization of Msh2-Msh6 in an ATP-Bound State at the Initiation of DNA Repair. Biochemistry. 42, 7682-7693.

  14. Warren, J. J., Pohlhaus, T. J., Changela, A., Iyer, R. R., Modrich, P. L., and Beese, L. S. (2007) Structure of the Human MutSalpha DNA Lesion Recognition Complex. Mol Cell. 26, 579-592.

  15. Edelmann, W., Yang, K., Umar, A., Heyer, J., Lau, K., Fan, K., Liedtke, W., Cohen, P. E., Kane, M. F., Lipford, J. R., Yu, N., Crouse, G. F., Pollard, J. W., Kunkel, T., Lipkin, M., Kolodner, R., and Kucherlapati, R. (1997) Mutation in the Mismatch Repair Gene Msh6 Causes Cancer Susceptibility. Cell. 91, 467-477.

  16. Edelbrock, M. A., Kaliyaperumal, S., and Williams, K. J. (2013) Structural, Molecular and Cellular Functions of MSH2 and MSH6 during DNA Mismatch Repair, Damage Signaling and Other Noncanonical Activities. Mutat Res. 743-744, 53-66.

  17. Duckett, D. R., Drummond, J. T., Murchie, A. I., Reardon, J. T., Sancar, A., Lilley, D. M., and Modrich, P. (1996) Human MutSalpha Recognizes Damaged DNA Base Pairs Containing O6-Methylguanine, O4-Methylthymine, Or the Cisplatin-d(GpG) Adduct. Proc Natl Acad Sci U S A. 93, 6443-6447.

  18. York, S. J., and Modrich, P. (2006) Mismatch Repair-Dependent Iterative Excision at Irreparable O6-Methylguanine Lesions in Human Nuclear Extracts. J Biol Chem. 281, 22674-22683.

  19. Martomo, S. A., Yang, W. W., and Gearhart, P. J. (2004) A Role for Msh6 but Not Msh3 in Somatic Hypermutation and Class Switch Recombination. J Exp Med. 200, 61-68.

  20. Li, Z., Scherer, S. J., Ronai, D., Iglesias-Ussel, M. D., Peled, J. U., Bardwell, P. D., Zhuang, M., Lee, K., Martin, A., Edelmann, W., and Scharff, M. D. (2004) Examination of Msh6- and Msh3-Deficient Mice in Class Switching Reveals Overlapping and Distinct Roles of MutS Homologues in Antibody Diversification. J Exp Med. 200, 47-59.

  21. Wiesendanger, M., Kneitz, B., Edelmann, W., and Scharff, M. D. (2000) Somatic Hypermutation in MutS Homologue (MSH)3-, MSH6-, and MSH3/MSH6-Deficient Mice Reveals a Role for the MSH2-MSH6 Heterodimer in Modulating the Base Substitution Pattern. J Exp Med. 191, 579-584.

  22. Roa, S., Li, Z., Peled, J. U., Zhao, C., Edelmann, W., and Scharff, M. D. (2010) MSH2/MSH6 Complex Promotes Error-Free Repair of AID-Induced dU:G Mispairs as Well as Error-Prone Hypermutation of A:T Sites. PLoS One. 5, e11182.

  23. Gardes, P., Forveille, M., Alyanakian, M. A., Aucouturier, P., Ilencikova, D., Leroux, D., Rahner, N., Mazerolles, F., Fischer, A., Kracker, S., and Durandy, A. (2012) Human MSH6 Deficiency is Associated with Impaired Antibody Maturation. J Immunol. 188, 2023-2029.

  24. Shahi, A., Lee, J. H., Kang, Y., Lee, S. H., Hyun, J. W., Chang, I. Y., Jun, J. Y., and You, H. J. (2011) Mismatch-Repair Protein MSH6 is Associated with Ku70 and Regulates DNA Double-Strand Break Repair. Nucleic Acids Res. 39, 2130-2143.

  25. Javaid, S., Manohar, M., Punja, N., Mooney, A., Ottesen, J. J., Poirier, M. G., and Fishel, R. (2009) Nucleosome Remodeling by hMSH2-hMSH6. Mol Cell. 36, 1086-1094.

  26. Yang, Q., Zhang, R., Wang, X. W., Linke, S. P., Sengupta, S., Hickson, I. D., Pedrazzi, G., Perrera, C., Stagljar, I., Littman, S. J., Modrich, P., and Harris, C. C. (2004) The Mismatch DNA Repair Heterodimer, hMSH2/6, Regulates BLM Helicase. Oncogene. 23, 3749-3756.

  27. de Wind, N., Dekker, M., Claij, N., Jansen, L., van Klink, Y., Radman, M., Riggins, G., van der Valk, M., van't Wout, K., and te Riele, H. (1999) HNPCC-Like Cancer Predisposition in Mice through Simultaneous Loss of Msh3 and Msh6 Mismatch-Repair Protein Functions. Nat Genet. 23, 359-362.

  28. Peled, J. U., Sellers, R. S., Iglesias-Ussel, M. D., Shin, D. M., Montagna, C., Zhao, C., Li, Z., Edelmann, W., Morse, H. C.,3rd, and Scharff, M. D. (2010) Msh6 Protects Mature B Cells from Lymphoma by Preserving Genomic Stability. Am J Pathol. 177, 2597-2608.

  29. Yang, G., Scherer, S. J., Shell, S. S., Yang, K., Kim, M., Lipkin, M., Kucherlapati, R., Kolodner, R. D., and Edelmann, W. (2004) Dominant Effects of an Msh6 Missense Mutation on DNA Repair and Cancer Susceptibility. Cancer Cell. 6, 139-150.

  30. Berends, M. J., Wu, Y., Sijmons, R. H., Mensink, R. G., van der Sluis, T., Hordijk-Hos, J. M., de Vries, E. G., Hollema, H., Karrenbeld, A., Buys, C. H., van der Zee, A. G., Hofstra, R. M., and Kleibeuker, J. H. (2002) Molecular and Clinical Characteristics of MSH6 Variants: An Analysis of 25 Index Carriers of a Germline Variant. Am J Hum Genet. 70, 26-37.

  31. Buttin, B. M., Powell, M. A., Mutch, D. G., Babb, S. A., Huettner, P. C., Edmonston, T. B., Herzog, T. J., Rader, J. S., Gibb, R. K., Whelan, A. J., and Goodfellow, P. J. (2004) Penetrance and Expressivity of MSH6 Germline Mutations in Seven Kindreds Not Ascertained by Family History. Am J Hum Genet. 74, 1262-1269.

  32. Cyr, J. L., and Heinen, C. D. (2008) Hereditary Cancer-Associated Missense Mutations in hMSH6 Uncouple ATP Hydrolysis from DNA Mismatch Binding. J Biol Chem. 283, 31641-31648.

  33. Goodfellow, P. J., Buttin, B. M., Herzog, T. J., Rader, J. S., Gibb, R. K., Swisher, E., Look, K., Walls, K. C., Fan, M. Y., and Mutch, D. G. (2003) Prevalence of Defective DNA Mismatch Repair and MSH6 Mutation in an Unselected Series of Endometrial Cancers. Proc Natl Acad Sci U S A. 100, 5908-5913.

  34. Hegde, M. R., Chong, B., Blazo, M. E., Chin, L. H., Ward, P. A., Chintagumpala, M. M., Kim, J. Y., Plon, S. E., and Richards, C. S. (2005) A Homozygous Mutation in MSH6 Causes Turcot Syndrome. Clin Cancer Res. 11, 4689-4693.

  35. Rahner, N., Hoefler, G., Hogenauer, C., Lackner, C., Steinke, V., Sengteller, M., Friedl, W., Aretz, S., Propping, P., Mangold, E., and Walldorf, C. (2008) Compound Heterozygosity for Two MSH6 Mutations in a Patient with Early Onset Colorectal Cancer, Vitiligo and Systemic Lupus Erythematosus. Am J Med Genet A. 146A, 1314-1319.

  36. Ostergaard, J. R., Sunde, L., and Okkels, H. (2005) Neurofibromatosis Von Recklinghausen Type I Phenotype and Early Onset of Cancers in Siblings Compound Heterozygous for Mutations in MSH6. Am J Med Genet A. 139A, 96-105; discussion 96.

  37. Campo, V. A., Patenaude, A. M., Kaden, S., Horb, L., Firka, D., Jiricny, J., and Di Noia, J. M. (2013) MSH6- Or PMS2-Deficiency Causes Re-Replication in DT40 B Cells, but it has Little Effect on Immunoglobulin Gene Conversion Or on Repair of AID-Generated Uracils. Nucleic Acids Res. 41, 3032-3046.