Phenotypic Mutation 'paul' (pdf version)
Allele | paul |
Mutation Type |
missense
|
Chromosome | 5 |
Coordinate | 24,577,702 bp (GRCm39) |
Base Change | C ⇒ T (forward strand) |
Gene |
Nos3
|
Gene Name | nitric oxide synthase 3, endothelial cell |
Synonym(s) | 2310065A03Rik, ecNOS, eNOS, Nos-3 |
Chromosomal Location |
24,569,808-24,589,472 bp (+) (GRCm39)
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by nitric oxide synthases. Variations in this gene are associated with susceptibility to coronary spasm. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Oct 2016] PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced survival, hypertension, inhibited basal vasodilation, insulin resistance, fewer mitochondria, reduced heart rate, impaired ovulation and, in some, shortened limbs. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_008713; MGI:97362
|
Mapped | Yes |
Amino Acid Change |
Threonine changed to Isoleucine
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000030834]
[ENSMUSP00000110742]
|
AlphaFold |
P70313 |
SMART Domains |
Protein: ENSMUSP00000030834 Gene: ENSMUSG00000028978 AA Change: T572I
Domain | Start | End | E-Value | Type |
low complexity region
|
11 |
27 |
N/A |
INTRINSIC |
low complexity region
|
31 |
57 |
N/A |
INTRINSIC |
Pfam:NO_synthase
|
118 |
480 |
1.7e-183 |
PFAM |
Pfam:Flavodoxin_1
|
521 |
697 |
4.8e-54 |
PFAM |
Pfam:FAD_binding_1
|
750 |
978 |
2.1e-82 |
PFAM |
Pfam:NAD_binding_1
|
1010 |
1124 |
1.9e-18 |
PFAM |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000030834)
|
SMART Domains |
Protein: ENSMUSP00000110742 Gene: ENSMUSG00000028978 AA Change: T572I
Domain | Start | End | E-Value | Type |
low complexity region
|
11 |
27 |
N/A |
INTRINSIC |
low complexity region
|
31 |
57 |
N/A |
INTRINSIC |
Pfam:NO_synthase
|
114 |
485 |
9e-214 |
PFAM |
Pfam:Flavodoxin_1
|
521 |
697 |
3.8e-54 |
PFAM |
Pfam:FAD_binding_1
|
750 |
978 |
1.6e-79 |
PFAM |
Pfam:NAD_binding_1
|
1010 |
1091 |
5.6e-12 |
PFAM |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000115090)
|
Meta Mutation Damage Score |
0.9556 |
Is this an essential gene? |
Non Essential (E-score: 0.000) |
Phenotypic Category |
Autosomal Recessive |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All mutations/alleles(9) : Gene trapped(1) Targeted(8)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL00903:Nos3
|
APN |
5 |
24574860 |
missense |
probably damaging |
1.00 |
IGL02059:Nos3
|
APN |
5 |
24573996 |
missense |
probably damaging |
1.00 |
IGL02354:Nos3
|
APN |
5 |
24572621 |
missense |
probably damaging |
1.00 |
IGL02361:Nos3
|
APN |
5 |
24572621 |
missense |
probably damaging |
1.00 |
IGL02936:Nos3
|
APN |
5 |
24585991 |
missense |
probably damaging |
0.97 |
IGL03190:Nos3
|
APN |
5 |
24588627 |
missense |
probably damaging |
1.00 |
Peter
|
UTSW |
5 |
24582853 |
missense |
probably damaging |
0.99 |
R0111:Nos3
|
UTSW |
5 |
24577702 |
missense |
probably damaging |
1.00 |
R0387:Nos3
|
UTSW |
5 |
24572583 |
missense |
probably damaging |
1.00 |
R0755:Nos3
|
UTSW |
5 |
24572295 |
missense |
probably damaging |
1.00 |
R1156:Nos3
|
UTSW |
5 |
24582617 |
missense |
probably benign |
0.21 |
R1597:Nos3
|
UTSW |
5 |
24573995 |
missense |
probably damaging |
1.00 |
R1671:Nos3
|
UTSW |
5 |
24588838 |
missense |
probably damaging |
1.00 |
R1743:Nos3
|
UTSW |
5 |
24582310 |
missense |
probably benign |
0.22 |
R1830:Nos3
|
UTSW |
5 |
24575131 |
missense |
probably damaging |
1.00 |
R1882:Nos3
|
UTSW |
5 |
24573818 |
missense |
probably damaging |
1.00 |
R2294:Nos3
|
UTSW |
5 |
24569855 |
missense |
probably damaging |
0.99 |
R3114:Nos3
|
UTSW |
5 |
24577629 |
splice site |
probably benign |
|
R3978:Nos3
|
UTSW |
5 |
24582929 |
missense |
probably damaging |
1.00 |
R3980:Nos3
|
UTSW |
5 |
24582929 |
missense |
probably damaging |
1.00 |
R4016:Nos3
|
UTSW |
5 |
24576714 |
missense |
probably damaging |
1.00 |
R4905:Nos3
|
UTSW |
5 |
24572329 |
missense |
probably benign |
0.01 |
R4947:Nos3
|
UTSW |
5 |
24582853 |
missense |
probably damaging |
0.99 |
R5017:Nos3
|
UTSW |
5 |
24571717 |
intron |
probably benign |
|
R5095:Nos3
|
UTSW |
5 |
24573916 |
splice site |
probably benign |
|
R5096:Nos3
|
UTSW |
5 |
24576955 |
missense |
probably damaging |
1.00 |
R5102:Nos3
|
UTSW |
5 |
24576625 |
missense |
probably damaging |
1.00 |
R5311:Nos3
|
UTSW |
5 |
24582343 |
missense |
probably benign |
0.19 |
R5330:Nos3
|
UTSW |
5 |
24574902 |
missense |
probably damaging |
1.00 |
R5367:Nos3
|
UTSW |
5 |
24576942 |
missense |
probably benign |
0.00 |
R5394:Nos3
|
UTSW |
5 |
24588888 |
missense |
probably benign |
0.00 |
R5574:Nos3
|
UTSW |
5 |
24573859 |
missense |
possibly damaging |
0.80 |
R5889:Nos3
|
UTSW |
5 |
24573775 |
intron |
probably benign |
|
R6032:Nos3
|
UTSW |
5 |
24584809 |
missense |
probably benign |
|
R6032:Nos3
|
UTSW |
5 |
24584809 |
missense |
probably benign |
|
R6401:Nos3
|
UTSW |
5 |
24584809 |
missense |
probably benign |
|
R6517:Nos3
|
UTSW |
5 |
24588622 |
missense |
probably damaging |
1.00 |
R6888:Nos3
|
UTSW |
5 |
24588333 |
missense |
possibly damaging |
0.86 |
R6972:Nos3
|
UTSW |
5 |
24585241 |
missense |
probably benign |
|
R6973:Nos3
|
UTSW |
5 |
24585241 |
missense |
probably benign |
|
R7432:Nos3
|
UTSW |
5 |
24572613 |
missense |
probably damaging |
0.98 |
R7434:Nos3
|
UTSW |
5 |
24587633 |
missense |
probably damaging |
0.99 |
R7507:Nos3
|
UTSW |
5 |
24577642 |
missense |
probably damaging |
1.00 |
R7553:Nos3
|
UTSW |
5 |
24586715 |
missense |
possibly damaging |
0.62 |
R7652:Nos3
|
UTSW |
5 |
24588610 |
missense |
probably damaging |
1.00 |
R8094:Nos3
|
UTSW |
5 |
24572218 |
missense |
probably benign |
0.13 |
R8686:Nos3
|
UTSW |
5 |
24573841 |
missense |
possibly damaging |
0.83 |
R8794:Nos3
|
UTSW |
5 |
24576745 |
missense |
probably damaging |
1.00 |
R9016:Nos3
|
UTSW |
5 |
24588639 |
missense |
probably damaging |
1.00 |
R9192:Nos3
|
UTSW |
5 |
24582611 |
missense |
probably benign |
0.04 |
R9336:Nos3
|
UTSW |
5 |
24584761 |
missense |
probably benign |
|
X0020:Nos3
|
UTSW |
5 |
24575122 |
missense |
probably damaging |
1.00 |
X0061:Nos3
|
UTSW |
5 |
24587633 |
missense |
probably damaging |
0.99 |
Z1176:Nos3
|
UTSW |
5 |
24582652 |
missense |
probably benign |
0.02 |
Z1177:Nos3
|
UTSW |
5 |
24588948 |
missense |
probably benign |
0.00 |
|
Mode of Inheritance |
Autosomal Recessive |
Local Stock | |
MMRRC Submission |
038230-MU
|
Last Updated |
2019-09-04 9:46 PM
by Diantha La Vine
|
Record Created |
2015-02-15 10:29 AM
by Emre Turer
|
Record Posted |
2015-12-11 |
Phenotypic Description |
The paul phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0111 in a screen for mutants susceptible to dextran sulfate sodium (DSS)-induced colitis. The screen uses weight-loss as an indication of colitis. The paul mice were susceptible to low doses of DSS (1%) and showed weight loss seven days after DSS treatment (Figure 1).
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. The susceptibility to DSS-induced colitis phenotype was linked by continuous variable mapping to a mutation in Nos3: a C to T transition at base pair 24,372,704 (v38) on chromosome 5, or base pair 7,886 in the NC_000071 GenBank genomic region. Linkage was found with a recessive model of inheritance (P = 8.33 x 10-4), wherein five variant homozygotes departed phenotypically from five homozygous reference mice and two heterozygous mice (Figure 2). The mutation corresponds to residue 1,734 in the mRNA sequence NM_008713 within exon 13 of 26 total exons.
1718 TTGGTGGTGACCAGCACATTTGGCAATGGGGAT
567 -L--V--V--T--S--T--F--G--N--G--D-
|
The mutated nucleotide is indicated in red. The mutation results in a threonine (T) to isoleucine (I) substitution at position 572 (T572I) in NOS3 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999) (1).
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
Nitric oxide synthase 3 [NOS3; alternatively, endothelial NOS (eNOS)] is one of three nitric oxide synthase (NOS) enzymes. The other two members of the NOS family are NOS1 (alternatively, neuronal NOS (nNOS)] and inducible NOS (iNOS; alternatively, NOS2). NOS1 is constitutively expressed in neuronal cells, while iNOS is produced upon exposure to certain stimuli (e.g., cytokines). The NOS isoforms require five cofactors to function: flavin adenine dinucleotide (FAD), flavin mononucleotide (FMN), heme, BH4 [(1'R, 2'S, 6R)-5,6,7,8-tetrahydrobiopterin], and calmodulin (CaM) (2;3). All of the NOS proteins share similar protein domains including an N-terminal oxygenase domain and a C-terminal reductase domain connected by a CaM-binding region (amino acids 490-509 in mouse NOS3) (Figure 3). Upon calcium-induced binding of CaM, an increased rate of electron transfer from NADPH to the reductase domain flavins and from the reductase domain to the heme center for the oxidation of the L-arginine substrate is induced. The NOS proteins differ in the region N-terminal to the oxygenase domain; that N-terminal peptide has an undefined function in NOS3. The oxygenase domain of NOS3 (amino acids 39-482) has binding sites for heme, L-arginine, and BH4. The crystal structure of the bovine NOS3 heme domain has been solved (PDB:4NSE) (4). The heme domain is a tightly packed dimer and is a member of the α/β protein class. A zinc ion coordinates with Cys residues (Cys 96 and Cys101) from both monomers within a conserved Cys-(X)4-Cys motif. The Cys-(X)4-Cys motif is proposed to maintain the structure of the BH4-binding site. The metal center in NOS3 is located at the bottom of the dimer interface. Val106 forms a direct nonbonded contact with BH4. Without BH4, NO synthesis is reduced and superoxide is generated. The NOS3 reductase domain (amino acids 519-1001) has binding sites for nicotinamide adenine dinucleotide phosphate (NADPH), FMN (amino acids 519-702), and FAD (amino acids 755-1001). The reductase domain is homologous to NADPH:cytochrome P450 reductase and other flavoproteins. NOS3 activity is regulated by several factors including lipid modification (e.g., N-myristoylation at Gly2 and S-palmitoylation at Cys15 and Cys26), phosphorylation, O-linked glycosylation, and S-nitrosylation as well as protein-protein interactions and substrate and cofactor availability (5-7). N-Myristoylation is essential for the proper localization of NOS3 to the plasma membrane (5;6). Palmitoylation regulates the trafficking of NOS3 from the Golgi to the plasma membrane; mutants that are not palmitoylated are membrane-bound, but do not traffic to the plasma membrane (7;8). Association of NOS3 with some agonists [e.g., bradykinin (9), estradiol (10), ceramide (11), and vascular endothelial growth factor (VEGF) (12)] results in depalmitoylation, mediating NOS3 translocation from the plasma membrane to the cytoplasm. S-glutathionylation (i.e., formation of a disulfide bond between the reactive Cys-thiol and reduced glutathione) of NOS3 reduces NOS activity with a concomitant increase in superoxide production (13). NOS3 can be phosphorylated on several serine, threonine, and tyrosine residues including Tyr81, Ser114, Thr495, Ser615, Ser633, Tyr657, and Ser1177 (human NOS3). Src-mediated phosphorylation of Tyr81 occurs upon acetylcholine, angiopoietin, ATP, BK, estrogen, S1P, thapsigargin, and VEGF stimulation, but does not alter the activity of NOS3 (14-16). Ser114 phosphorylation is constitutive and results in reduced NOS3 activity (17;18). Thr495 is consitutively phosphorylated by protein kinase C in response to Ox-LDL and O2, resulting in reduced NOS3 activity (19-22). Ser615 phosphorylation by AMPK, PKA, and/or Akt occurs upon VEGF, hypoxia, and adiponectin stimulation, resulting in increased NOS3 activity (18;23). PKA-mediated Ser633 phosphorylation occurs upon fluid shear stress, VEGF, and bradykinin stimulation, but does not change NOS3 activity (23;24). Pyk2-mediated Tyr657 phosphorylation occurs upon fluid shear stress, insulin, or angiotensin stimulation, resulting in reduced NOS3 activity (14-16). Akt-mediated Ser1177 phosphorylation occurs upon stimulation with VEGF, insulin, or estrogen as well as upon shear stress (22;25;26). Ser1177 can also be phosphorylated by CaMKII upon stimulation with bradykinin (19) and by PKA upon stimulation with fluid shear stress (17;22;25-27) . Phosphorylation of Ser1177 results in increased activity, while loss of phosphorylation in mutant mice results in hypertension, decreased vascular activity, insulin resistance, hyperinsulinemia, adiposity, and increased weight gain. NOS3 is a member of an enzyme complex that consists of a NOS3 dimer, each monomer bound to a CaM, and several adaptor and regulatory proteins (Table 1). Table1. NOS3-interacting proteins
NOS3-associated protein
|
Brief protein description
|
NOS3 regulation
|
References
|
Calmodulin
|
Calcium-binding protein
|
CaM binding to NOS3 is modulated by phosphorylation/dephosphorylation of Thr495; CaM binding aligns the oxygenase and reductase domains, resulting in efficient NO synthesis
|
(19;28)
|
Caveolin-1
|
Scaffold protein
|
Associates with amino acids 350-358 in NOS3 to antagonize CaM binding, subsequently inhibiting enzyme activity, and is essential for the intracellular localization of NOS3 to caveolae
|
(16;29)
|
Hsp90
|
Chaperone
|
Hsp90 association with NOS3 is dependent on phosphorylation of both Hsp90 and NOS3 in conditions of sheer stress; Hsp90 regulates the folding of NOS3 and the insertion of heme into immature protein
|
(30)
|
Platelet-endothelial cell adhesion molecule-1 (PECAM-1)
|
Cell adhesion molecule that regulates
leukocyte transmigration, cell migration, cell adhesion, and angiogenesis
|
Regulates NOS3 activity in response to shear stress. NOS3 regulation by PECAM-1 occurs through STAT3-mediated transcriptional control of NOSTRIN
|
(31-33)
|
Gab1 and SHP2
|
Adaptor protein (Gab1); tyrosine phosphatase (SHP2)
|
NOS3 activation upon fluid shear stress is dependent on association with Gab1 and SHP2
|
(34)
|
Dynamin
|
GTPase in endocytosis
|
Binds the reductase domain of NOS3 to regulate enzyme activity and subcellular localization; increases NO production
|
(35;36)
|
NOSIP
|
NOS3-interacting protein
|
Binds the C-terminus of the oxygenase domain to regulate the localization of NOS3 and calcium-induced activation
|
(37)
|
NOSTRIN
|
NOS3 traffic inducer)
|
(38)
|
Actin
|
Protein that forms microfilaments
|
Polymerization state of actin regulates NOS3 binding to Hsp90; formation of an actin-NOS3-Hsp90 complex leads to increased NOS activity
|
(39)
|
The paul mutation results in a threonine (T) to isoleucine (I) substitution at position 572 (T572I) within the flavodoxin region of the reductase domain.
|
Expression/Localization | NOS3 is constitutively expressed by vascular endothelial cells as well as endothelial cells in the brain, lung, liver, kidney, spleen, gastrointestinal tract, testis, and cervix (40-45). NOS3 is expressed in the embryonic heart of the mouse as early as embryonic day 9.5 (E9.5) (46). After E19.5, the expression level of NOS3 is low and remains low through adulthood primarily in the myocardium. In the kidney, NOS3 is expressed in the outer medulla and the thick ascending limb of the loop of Henle. In the epithelial cells of the lung, NOS3 is localized to the apical membrane in the basal body of the microtubules of the cilia (45). NOS3 is also expressed in hippocampal neurons, platelets, and cardiac myoctyes (47;48). In the brain, NOS3 localizes to the ciliated epithelium of the ependyma (45). NOS3 is predominantly localized to the plasma membrane and in the Golgi. At the plasma membrane, NOS3 is localized to caveolae (49). NOS3 mRNA and protein levels can be regulated by viscous drag of blood flowing over the endothelial cell surface both in cultured endothelial cells and in intact arteries. NOS3 is also regulated by several hormones including estradiol, bradykinin, and VEGF in addition to elevation in cytosolic calcium levels (10;50;51). NOS3 activation by shear stress and isometric vessel contraction is independent of changes in the levels of intracellular calcium (52;53). Tumor necrosis factor-α (TNF-α) activates NOS3 in HeLa and microvascular endothelial cells (54;55).
|
Background |
The NOS proteins catalyze the conversion of L-arginine and oxygen into L-citrulline and nitric oxide (NO) in a NADPH-dependent reaction (Figure 4). The conversion of L-arginine to L-citrulline occurs in a two-step oxidation process. The reaction consumes 1.5 mol of NADPH and 2 mol of oxygen per mol of L-citrulline formed. In the initial reaction, L-arginine is hydroxylated, leading to the formation of NG-hydroxy-l-arginine, an alternative substrate of NOS. The intermediate is subsequently oxidated using one electron from NADPH, forming L-citrulline and NO. NOS can also catalyze the production of superoxide. NO is a signaling molecule that functions in several physiological processes including cell growth, apoptosis, neurotransmission, and immune system regulation. During normoxic cellular conditions, NOS-derived NO is oxidized to nitrite and nitrate. In immune system regulation, NO reduces oxidative stress by inhibiting the recruitment of neutrophils to sites of inflammation. NO also reacts with, and inactivates, superoxide. NO inhibits the function of NADPH oxidase, a superoxide generating system found in phagocytes (56). Endothelial cells found in the microvasculature line blood and lymphatic vessels, regulating vascular supply and immune cell emigration. Upon exposure to cytokines (e.g., IL-6, IL-23, IL-12 and TNF-α) and growth factors, endothelial cells undergo rapid changes. NO reduces leukocyte and platelet adhesion to the endothelium as well as endothelial permeability (57;58) and vasodilation (59). NO-mediated changes to endothelial permeability is due to increased guanylate cyclase and phospholipase C activity leading to increased intracellular calcium as well as activation of the Ras/Raf/PKC/ERK pathway, which leads to increased actin contractility (Figure 4) (57;60;61). NOS3 constitutively produces NO in the vasculature. NOS3-produced NO mediates neovascularization, vessel wall tension, platelet aggregation, vascular permeability and the interaction between leuckocytes and endothelial cells [reviewed in (62)]. NOS3 has several known functions. In the heart, NOS3-derived NO mediates vasodilation, vascular homeostasis, morphogenesis of coronary arteries, myocardial capillary development, and angiogenesis [(59); reviewed in (63)]. NOS3-derived NO regulates voltage-dependent L-type calcium currents in cardiomyocytes as well as cardiomyogenesis during embryonic development (46;64;65). NO is proposed to function in cardiac cells to alter basal contractility by activating the nitrosylation of the ryanodine receptor 2 (RyR2) (66), by directing S-nitrosylatin of the L-type calcium channel (67), by mediating cGMP-independent activation of adenylyl cyclase (68), by mediating a cGMP-dependent increase in cAMP (69), and by assisting in a PKG-mediated activation of the RyR (70). Transgenic mice that overexpress NOS3 in the vascular wall exhibited low blood pressure as well as reduced vascular reactivity compared to wild-type littermates (71). In the kidney, NOS3-produced NO inhibited NaCl and NaHCO3 absorption through the inhibition of transporters including the Na/K/2Cl co-transporter and Na/H exchangers (44;72;73). In the lung, NOS3-produced NO stimulates ciliary beat frequency to regulate the amount and composition of airway surface liquid (47). In the bone marrow, NOS3-derived NO regulates the mobilization of bone marrow-derived hematopoietic stem and progenitor cells (74;75). Inhibition of NO results in increased neutrophil recruitment, increased oxidative stress, mast cell degranulation, and increased microvascular and epithelial permeability (76-79). NOS3 functions during pro-inflammatory reactions in immune cells by regulating iNOS expression in response to endotoxin in an animal model of sepsis through the regulation of nuclear factor κB (NF-κB) (80;81). In Nos3-/- mice, iNOS expression was reduced in the liver, lung, heart, and aorta compared to that in wild-type mice (82). In addition, sepsis-associated systemic hypotension and mortality were reduced in the Nos3-/- mice compared to wild-type mice with experimentally-induced sepsis. Nos3-/- mice exhibit developmental vascular defects in certain organs including heart, aorta, lung, and kidney with a concomitant increased rate of postnatal mortality compared to wild-type mice (83-89). Nos3 deficiency leads to several vascular disorders including vasodilation and hypertension as well as accelerates vascular diseases (87;90-95). Nos3-/- mice exhibited pulmonary congestion with focal alveolar edema as well as congenital atrial and ventricular septal defects (85). Loss of Nos3 expression results in cardiac hypertrophy, congenital septal defects, and postnatal heart failure [85% by postnatal day 7 (P7)] (85). NOS3 also has a role in non-endothelial sites including cardiomyocytes, osteoblasts, adipocytes, renal tubules, and erythrocytes (96-101). Nos3-/- female mice exhibited longer estrous cycles and reduced ovulation rate than wild-type mice (102;103). Nos3-/- mice exhibited less activity than wild-type mice in open field habituation as well as accelaeratued place learning the water maze due to changes in sensorimotor capacities (104). Compared to wild-type mice, the Nos3-/- mice had higher dopamine turnover in the ventral striatum as well as increased concentrations of the serotonin metabolite 5-HIAA in the cerebellum and an accelerated serotonin turnover in the frontal cortex (104). Nos3-/- mice also exhibit defects in lung morphogenesis, leading to respiratory distress and death in most of the animals (83). The lungs of the neonatal animals had thickening of saccular septae and reduced surfactant material as well as regions of capillary hypoperfusion and misalignment of pulmonary veins (83). Loss of Nos3 expression results in increased glomerulosclerosis, mesangiolysis, and tubular damage of the kidney as well as loss of endothelial cells due to reduced endothelial cell proliferation and increased apoptosis. Glomerular and tubulointersitial injury with a loss of glomerular capillaries and peritubular capillaries was also observed upon loss of Nos3 expression (84). Nos3-/- mice exhibit fasting hyperinsulinemia, hyperlipidemia and reduced (by 40%) insulin-stimulated glucose uptake compared to wild-type mice due to impaired NO synthesis (105). In humans, NOS3 deficiency can result in bicuspid aortic valves leading to aortic valve stenosis, endocarditis, aortic aneurysm, and aortic dissection. Loss of NOS3 function inhibits tumor initiation and maintenance (106). NOS3 mediates an increase in the nitrosylation and activation of Ras, a required factor throughout tumorigenesis, indicating that activation of a PI3K-AKT-NOS3-Ras pathway by oncogenic Ras in cancer cells mediates tumor growth. The region of chromosome 7q36 encoding NOS3 is a locus for susceptibility to familial pregnancy-induced hypertension syndrome (OMIM: 189800) (107), susceptibility to late-onset Alzheimer’s disease (OMIM: 104300), susceptibility to coronary artery spasm 1, susceptibility to hypertension (OMIM:145500), and placental abruption. In the German population, the Glu298Asp (894G>T) polymorphism in NOS3 is linked to increased risk of ischemic stroke onset [OMIM:601367; (108)]. The Glu298Asp mutation is common, but is not associated with the occurrence or severity of coronary artery disease, in the Australian (109) and United Kingdom (110) populations. Patients homozygous for the Glu298Asp allele are at a moderately increased risk of ischemic heart disease (111). Homozygosity of the Glu298Asp allele are at higher risk for developing late-onset Alzheimer’s disease (112). In addition, the Glu298Asp variant is common in patients with Fabry disease, a lysosomal storage disease that causes progressive renal failure, cardiac disease, and skin lesions, among other symptoms (113). The Glu298Asp variant has been linked to South African pre-eclamptic patients that are predisposed to developing abruption placentae (114).
|
Putative Mechanism |
During normal conditions, NOS3-derived NO is a scavenger that absorbs O2- and also functions to generate the oxidant peroxynitrite (ONOO-). In inflammatory bowel disease (IBD), NOS3 expression is reduced, leading to reduced endothelium-dependent vasodilation and increased oxidant formation (Figure 5) (115). Loss of Nos3 expression leads to an increased severity of IBD (116;117). Treatment of Nos3-/- mice with 3% DSS led to an increased rate of weight loss, bloody stool, and histopathology including disrupted tissue architecture, edema, and immune cell infiltration compared to DSS-treated wild-type mice (117). The Nos3-/- mice exhibited more gut injury and higher expression levels of the mucosal addressin MAdCAM-1 compared to DSS-treated wild-type mice. Similar to the Nos3-/- mice , homozygous paul mice also exhibit weight loss after treatment with low dose (1.5%) DSS, indicating loss of NOS3 function as the result of the mutation. Exposure of HUVECs to serum from patients with Crohn’s disease led to a reduction in NOS3, while exposure to serum from patients with ulcerative colitis led to an increase in NOS3 expression (118). Chronic administration of NOS inhibitors can cause intestinal inflammation (119;120). Studies using NOS inhibitors N(G)-nitro-L-arginine-methyl ester (L-NAME) and NG-Monomethyl-L-Arginine (L-NMMA) indicated that loss of NO leads to increased mucosal permeability (121). The increased permeability can be reversed by treatment with NO donors, L-arginine, or cGMP donors.
|
Primers |
PCR Primer
paul_pcr_F: ACAAGGATTCAGCGTGCAATCAGG
paul_pcr_R: AGAAGTGCCGTCCCCATATCAAAAG
Sequencing Primer
paul_seq_F: GGCCTTGTCTTGCCTAAGTG
paul_seq_R: TACAGGAATCAAGGTTCCCAG
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 428 nucleotides is amplified (chromosome 5, + strand):
1 acaaggattc agcgtgcaat caggccttgt cttgcctaag tgaggacaga gacaggagga 61 agacaagcgt caacacccat cttctcaccg caggtcctgt gcatggatga gtatgatgtg 121 gtgtccctag agcacgaggc actggtgttg gtggtgacca gcacatttgg caatggggat 181 cctccggaga atggagaggt aaggctttca ggagaaaaga ttcaaaacag ggccagctag 241 acaggtggat gcaaacacac acacacacac tcacacacac actcacatat acacagcagc 301 atggaaagtt aatatgctaa gtagccccac ttcctgatgg ggatgtgaag tgctgggaac 361 cttgattcct gtatccccag ccatctccat tatctgtgca actcttttga tatggggacg 421 gcacttct
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References | 1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.
4. Raman, C. S., Li, H., Martasek, P., Kral, V., Masters, B. S., and Poulos, T. L. (1998) Crystal Structure of Constitutive Endothelial Nitric Oxide Synthase: A Paradigm for Pterin Function Involving a Novel Metal Center. Cell. 95, 939-950.
8. Sowa, G., Liu, J., Papapetropoulos, A., Rex-Haffner, M., Hughes, T. E., and Sessa, W. C. (1999) Trafficking of Endothelial Nitric-Oxide Synthase in Living Cells. Quantitative Evidence Supporting the Role of Palmitoylation as a Kinetic Trapping Mechanism Limiting Membrane Diffusion. J Biol Chem. 274, 22524-22531.
9. Prabhakar, P., Thatte, H. S., Goetz, R. M., Cho, M. R., Golan, D. E., and Michel, T. (1998) Receptor-Regulated Translocation of Endothelial Nitric-Oxide Synthase. J Biol Chem. 273, 27383-27388.
10. Goetz, R. M., Thatte, H. S., Prabhakar, P., Cho, M. R., Michel, T., and Golan, D. E. (1999) Estradiol Induces the Calcium-Dependent Translocation of Endothelial Nitric Oxide Synthase. Proc Natl Acad Sci U S A. 96, 2788-2793.
11. Igarashi, J., Thatte, H. S., Prabhakar, P., Golan, D. E., and Michel, T. (1999) Calcium-Independent Activation of Endothelial Nitric Oxide Synthase by Ceramide. Proc Natl Acad Sci U S A. 96, 12583-12588.
12. Feng, Y., Venema, V. J., Venema, R. C., Tsai, N., and Caldwell, R. B. (1999) VEGF Induces Nuclear Translocation of Flk-1/KDR, Endothelial Nitric Oxide Synthase, and Caveolin-1 in Vascular Endothelial Cells. Biochem Biophys Res Commun. 256, 192-197.
13. Chen, C. A., Wang, T. Y., Varadharaj, S., Reyes, L. A., Hemann, C., Talukder, M. A., Chen, Y. R., Druhan, L. J., and Zweier, J. L. (2010) S-Glutathionylation Uncouples eNOS and Regulates its Cellular and Vascular Function. Nature. 468, 1115-1118.
15. Fisslthaler, B., Dimmeler, S., Hermann, C., Busse, R., and Fleming, I. (2000) Phosphorylation and Activation of the Endothelial Nitric Oxide Synthase by Fluid Shear Stress. Acta Physiol Scand. 168, 81-88.
16. Garcia-Cardena, G., Fan, R., Stern, D. F., Liu, J., and Sessa, W. C. (1996) Endothelial Nitric Oxide Synthase is Regulated by Tyrosine Phosphorylation and Interacts with Caveolin-1. J Biol Chem. 271, 27237-27240.
17. Gallis, B., Corthals, G. L., Goodlett, D. R., Ueba, H., Kim, F., Presnell, S. R., Figeys, D., Harrison, D. G., Berk, B. C., Aebersold, R., and Corson, M. A. (1999) Identification of Flow-Dependent Endothelial Nitric-Oxide Synthase Phosphorylation Sites by Mass Spectrometry and Regulation of Phosphorylation and Nitric Oxide Production by the Phosphatidylinositol 3-Kinase Inhibitor LY294002. J Biol Chem. 274, 30101-30108.
18. Bauer, P. M., Fulton, D., Boo, Y. C., Sorescu, G. P., Kemp, B. E., Jo, H., and Sessa, W. C. (2003) Compensatory Phosphorylation and Protein-Protein Interactions Revealed by Loss of Function and Gain of Function Mutants of Multiple Serine Phosphorylation Sites in Endothelial Nitric-Oxide Synthase. J Biol Chem. 278, 14841-14849.
19. Fleming, I., Fisslthaler, B., Dimmeler, S., Kemp, B. E., and Busse, R. (2001) Phosphorylation of Thr(495) Regulates Ca(2+)/calmodulin-Dependent Endothelial Nitric Oxide Synthase Activity. Circ Res. 88, E68-75.
20. Harris, M. B., Ju, H., Venema, V. J., Liang, H., Zou, R., Michell, B. J., Chen, Z. P., Kemp, B. E., and Venema, R. C. (2001) Reciprocal Phosphorylation and Regulation of Endothelial Nitric-Oxide Synthase in Response to Bradykinin Stimulation. J Biol Chem. 276, 16587-16591.
22. Michell, B. J., Chen, Z., Tiganis, T., Stapleton, D., Katsis, F., Power, D. A., Sim, A. T., and Kemp, B. E. (2001) Coordinated Control of Endothelial Nitric-Oxide Synthase Phosphorylation by Protein Kinase C and the cAMP-Dependent Protein Kinase. J Biol Chem. 276, 17625-17628.
23. Michell, B. J., Harris, M. B., Chen, Z. P., Ju, H., Venema, V. J., Blackstone, M. A., Huang, W., Venema, R. C., and Kemp, B. E. (2002) Identification of Regulatory Sites of Phosphorylation of the Bovine Endothelial Nitric-Oxide Synthase at Serine 617 and Serine 635. J Biol Chem. 277, 42344-42351.
24. Boo, Y. C., Hwang, J., Sykes, M., Michell, B. J., Kemp, B. E., Lum, H., and Jo, H. (2002) Shear Stress Stimulates Phosphorylation of eNOS at Ser(635) by a Protein Kinase A-Dependent Mechanism. Am J Physiol Heart Circ Physiol. 283, H1819-28.
25. Dimmeler, S., Fleming, I., Fisslthaler, B., Hermann, C., Busse, R., and Zeiher, A. M. (1999) Activation of Nitric Oxide Synthase in Endothelial Cells by Akt-Dependent Phosphorylation. Nature. 399, 601-605.
26. Fulton, D., Gratton, J. P., McCabe, T. J., Fontana, J., Fujio, Y., Walsh, K., Franke, T. F., Papapetropoulos, A., and Sessa, W. C. (1999) Regulation of Endothelium-Derived Nitric Oxide Production by the Protein Kinase Akt. Nature. 399, 597-601.
27. Kashiwagi, S., Atochin, D. N., Li, Q., Schleicher, M., Pong, T., Sessa, W. C., and Huang, P. L. (2013) ENOS Phosphorylation on Serine 1176 Affects Insulin Sensitivity and Adiposity. Biochem Biophys Res Commun. 431, 284-290.
29. Garcia-Cardena, G., Martasek, P., Masters, B. S., Skidd, P. M., Couet, J., Li, S., Lisanti, M. P., and Sessa, W. C. (1997) Dissecting the Interaction between Nitric Oxide Synthase (NOS) and Caveolin. Functional Significance of the Nos Caveolin Binding Domain in Vivo. J Biol Chem. 272, 25437-25440.
30. Billecke, S. S., Bender, A. T., Kanelakis, K. C., Murphy, P. J., Lowe, E. R., Kamada, Y., Pratt, W. B., and Osawa, Y. (2002) Hsp90 is Required for Heme Binding and Activation of Apo-Neuronal Nitric-Oxide Synthase: Geldanamycin-Mediated Oxidant Generation is Unrelated to any Action of Hsp90. J Biol Chem. 277, 20504-20509.
31. Dusserre, N., L'Heureux, N., Bell, K. S., Stevens, H. Y., Yeh, J., Otte, L. A., Loufrani, L., and Frangos, J. A. (2004) PECAM-1 Interacts with Nitric Oxide Synthase in Human Endothelial Cells: Implication for Flow-Induced Nitric Oxide Synthase Activation. Arterioscler Thromb Vasc Biol. 24, 1796-1802.
33. McCormick, M. E., Goel, R., Fulton, D., Oess, S., Newman, D., and Tzima, E. (2011) Platelet-Endothelial Cell Adhesion Molecule-1 Regulates Endothelial NO Synthase Activity and Localization through Signal Transducers and Activators of Transcription 3-Dependent NOSTRIN Expression. Arterioscler Thromb Vasc Biol. 31, 643-649.
34. Dixit, M., Loot, A. E., Mohamed, A., Fisslthaler, B., Boulanger, C. M., Ceacareanu, B., Hassid, A., Busse, R., and Fleming, I. (2005) Gab1, SHP2, and Protein Kinase A are Crucial for the Activation of the Endothelial NO Synthase by Fluid Shear Stress. Circ Res. 97, 1236-1244.
35. Cao, S., Yao, J., McCabe, T. J., Yao, Q., Katusic, Z. S., Sessa, W. C., and Shah, V. (2001) Direct Interaction between Endothelial Nitric-Oxide Synthase and Dynamin-2. Implications for Nitric-Oxide Synthase Function. J Biol Chem. 276, 14249-14256.
37. Dedio, J., Konig, P., Wohlfart, P., Schroeder, C., Kummer, W., and Muller-Esterl, W. (2001) NOSIP, a Novel Modulator of Endothelial Nitric Oxide Synthase Activity. FASEB J. 15, 79-89.
38. Zimmermann, K., Opitz, N., Dedio, J., Renne, C., Muller-Esterl, W., and Oess, S. (2002) NOSTRIN: A Protein Modulating Nitric Oxide Release and Subcellular Distribution of Endothelial Nitric Oxide Synthase. Proc Natl Acad Sci U S A. 99, 17167-17172.
39. Ji, Y., Ferracci, G., Warley, A., Ward, M., Leung, K. Y., Samsuddin, S., Leveque, C., Queen, L., Reebye, V., Pal, P., Gkaliagkousi, E., Seager, M., and Ferro, A. (2007) Beta-Actin Regulates Platelet Nitric Oxide Synthase 3 Activity through Interaction with Heat Shock Protein 90. Proc Natl Acad Sci U S A. 104, 8839-8844.
40. Janssens, S. P., Shimouchi, A., Quertermous, T., Bloch, D. B., and Bloch, K. D. (1992) Cloning and Expression of a cDNA Encoding Human Endothelium-Derived Relaxing factor/nitric Oxide Synthase. J Biol Chem. 267, 14519-14522.
41. Zini, A., O'Bryan, M. K., Magid, M. S., and Schlegel, P. N. (1996) Immunohistochemical Localization of Endothelial Nitric Oxide Synthase in Human Testis, Epididymis, and Vas Deferens Suggests a Possible Role for Nitric Oxide in Spermatogenesis, Sperm Maturation, and Programmed Cell Death. Biol Reprod. 55, 935-941.
43. McNaughton, L., Puttagunta, L., Martinez-Cuesta, M. A., Kneteman, N., Mayers, I., Moqbel, R., Hamid, Q., and Radomski, M. W. (2002) Distribution of Nitric Oxide Synthase in Normal and Cirrhotic Human Liver. Proc Natl Acad Sci U S A. 99, 17161-17166.
46. Bloch, W., Fleischmann, B. K., Lorke, D. E., Andressen, C., Hops, B., Hescheler, J., and Addicks, K. (1999) Nitric Oxide Synthase Expression and Role during Cardiomyogenesis. Cardiovasc Res. 43, 675-684.
47. Kim, J. W., Min, Y. G., Rhee, C. S., Lee, C. H., Koh, Y. Y., Rhyoo, C., Kwon, T. Y., and Park, S. W. (2001) Regulation of Mucociliary Motility by Nitric Oxide and Expression of Nitric Oxide Synthase in the Human Sinus Epithelial Cells. Laryngoscope. 111, 246-250.
49. Shaul, P. W., Smart, E. J., Robinson, L. J., German, Z., Yuhanna, I. S., Ying, Y., Anderson, R. G., and Michel, T. (1996) Acylation Targets Emdothelial Nitric-Oxide Synthase to Plasmalemmal Caveolae. J Biol Chem. 271, 6518-6522.
51. Chen, Z., Yuhanna, I. S., Galcheva-Gargova, Z., Karas, R. H., Mendelsohn, M. E., and Shaul, P. W. (1999) Estrogen Receptor Alpha Mediates the Nongenomic Activation of Endothelial Nitric Oxide Synthase by Estrogen. J Clin Invest. 103, 401-406.
52. Ayajiki, K., Kindermann, M., Hecker, M., Fleming, I., and Busse, R. (1996) Intracellular pH and Tyrosine Phosphorylation but Not Calcium Determine Shear Stress-Induced Nitric Oxide Production in Native Endothelial Cells. Circ Res. 78, 750-758.
53. Fleming, I., Bauersachs, J., Schafer, A., Scholz, D., Aldershvile, J., and Busse, R. (1999) Isometric Contraction Induces the Ca2+-Independent Activation of the Endothelial Nitric Oxide Synthase. Proc Natl Acad Sci U S A. 96, 1123-1128.
54. Barsacchi, R., Perrotta, C., Bulotta, S., Moncada, S., Borgese, N., and Clementi, E. (2003) Activation of Endothelial Nitric-Oxide Synthase by Tumor Necrosis Factor-Alpha: A Novel Pathway Involving Sequential Activation of Neutral Sphingomyelinase, Phosphatidylinositol-3' Kinase, and Akt. Mol Pharmacol. 63, 886-895.
55. Kawanaka, H., Jones, M. K., Szabo, I. L., Baatar, D., Pai, R., Tsugawa, K., Sugimachi, K., Sarfeh, I. J., and Tarnawski, A. S. (2002) Activation of eNOS in Rat Portal Hypertensive Gastric Mucosa is Mediated by TNF-Alpha Via the PI 3-Kinase-Akt Signaling Pathway. Hepatology. 35, 393-402.
58. Binion, D. G., Fu, S., Ramanujam, K. S., Chai, Y. C., Dweik, R. A., Drazba, J. A., Wade, J. G., Ziats, N. P., Erzurum, S. C., and Wilson, K. T. (1998) INOS Expression in Human Intestinal Microvascular Endothelial Cells Inhibits Leukocyte Adhesion. Am J Physiol. 275, G592-603.
59. Huang, P. L., Huang, Z., Mashimo, H., Bloch, K. D., Moskowitz, M. A., Bevan, J. A., and Fishman, M. C. (1995) Hypertension in Mice Lacking the Gene for Endothelial Nitric Oxide Synthase. Nature. 377, 239-242.
60. Breslin, J. W., Pappas, P. J., Cerveira, J. J., Hobson, R. W.,2nd, and Duran, W. N. (2003) VEGF Increases Endothelial Permeability by Separate Signaling Pathways Involving ERK-1/2 and Nitric Oxide. Am J Physiol Heart Circ Physiol. 284, H92-H100.
61. Rousseau, S., Houle, F., Kotanides, H., Witte, L., Waltenberger, J., Landry, J., and Huot, J. (2000) Vascular Endothelial Growth Factor (VEGF)-Driven Actin-Based Motility is Mediated by VEGFR2 and Requires Concerted Activation of Stress-Activated Protein Kinase 2 (SAPK2/p38) and Geldanamycin-Sensitive Phosphorylation of Focal Adhesion Kinase. J Biol Chem. 275, 10661-10672.
64. Kanno, S., Kim, P. K., Sallam, K., Lei, J., Billiar, T. R., and Shears, L. L.,2nd. (2004) Nitric Oxide Facilitates Cardiomyogenesis in Mouse Embryonic Stem Cells. Proc Natl Acad Sci U S A. 101, 12277-12281.
65. Ji, G. J., Fleischmann, B. K., Bloch, W., Feelisch, M., Andressen, C., Addicks, K., and Hescheler, J. (1999) Regulation of the L-Type Ca2+ Channel during Cardiomyogenesis: Switch from NO to Adenylyl Cyclase-Mediated Inhibition. FASEB J. 13, 313-324.
68. Vila-Petroff, M. G., Younes, A., Egan, J., Lakatta, E. G., and Sollott, S. J. (1999) Activation of Distinct cAMP-Dependent and cGMP-Dependent Pathways by Nitric Oxide in Cardiac Myocytes. Circ Res. 84, 1020-1031.
69. Mery, P. F., Pavoine, C., Belhassen, L., Pecker, F., and Fischmeister, R. (1993) Nitric Oxide Regulates Cardiac Ca2+ Current. Involvement of cGMP-Inhibited and cGMP-Stimulated Phosphodiesterases through Guanylyl Cyclase Activation. J Biol Chem. 268, 26286-26295.
70. Willmott, N., Sethi, J. K., Walseth, T. F., Lee, H. C., White, A. M., and Galione, A. (1996) Nitric Oxide-Induced Mobilization of Intracellular Calcium Via the Cyclic ADP-Ribose Signaling Pathway. J Biol Chem. 271, 3699-3705.
71. Ohashi, Y., Kawashima, S., Hirata, K., Yamashita, T., Ishida, T., Inoue, N., Sakoda, T., Kurihara, H., Yazaki, Y., and Yokoyama, M. (1998) Hypotension and Reduced Nitric Oxide-Elicited Vasorelaxation in Transgenic Mice Overexpressing Endothelial Nitric Oxide Synthase. J Clin Invest. 102, 2061-2071.
75. Aicher, A., Heeschen, C., Mildner-Rihm, C., Urbich, C., Ihling, C., Technau-Ihling, K., Zeiher, A. M., and Dimmeler, S. (2003) Essential Role of Endothelial Nitric Oxide Synthase for Mobilization of Stem and Progenitor Cells. Nat Med. 9, 1370-1376.
79. Suematsu, M., Tamatani, T., Delano, F. A., Miyasaka, M., Forrest, M., Suzuki, H., and Schmid-Schonbein, G. W. (1994) Microvascular Oxidative Stress Preceding Leukocyte Activation Elicited by in Vivo Nitric Oxide Suppression. Am J Physiol. 266, H2410-5.
80. Connelly, L., Jacobs, A. T., Palacios-Callender, M., Moncada, S., and Hobbs, A. J. (2003) Macrophage Endothelial Nitric-Oxide Synthase Autoregulates Cellular Activation and Pro-Inflammatory Protein Expression. J Biol Chem. 278, 26480-26487.
81. Connelly, L., Palacios-Callender, M., Ameixa, C., Moncada, S., and Hobbs, A. J. (2001) Biphasic Regulation of NF-Kappa B Activity Underlies the Pro- and Anti-Inflammatory Actions of Nitric Oxide. J Immunol. 166, 3873-3881.
83. Han, R. N., Babaei, S., Robb, M., Lee, T., Ridsdale, R., Ackerley, C., Post, M., and Stewart, D. J. (2004) Defective Lung Vascular Development and Fatal Respiratory Distress in Endothelial NO Synthase-Deficient Mice: A Model of Alveolar Capillary Dysplasia? Circ Res. 94, 1115-1123.
84. Nakayama, T., Sato, W., Kosugi, T., Zhang, L., Campbell-Thompson, M., Yoshimura, A., Croker, B. P., Johnson, R. J., and Nakagawa, T. (2009) Endothelial Injury due to eNOS Deficiency Accelerates the Progression of Chronic Renal Disease in the Mouse. Am J Physiol Renal Physiol. 296, F317-27.
85. Feng, Q., Song, W., Lu, X., Hamilton, J. A., Lei, M., Peng, T., and Yee, S. P. (2002) Development of Heart Failure and Congenital Septal Defects in Mice Lacking Endothelial Nitric Oxide Synthase. Circulation. 106, 873-879.
86. Zhao, H. J., Wang, S., Cheng, H., Zhang, M. Z., Takahashi, T., Fogo, A. B., Breyer, M. D., and Harris, R. C. (2006) Endothelial Nitric Oxide Synthase Deficiency Produces Accelerated Nephropathy in Diabetic Mice. J Am Soc Nephrol. 17, 2664-2669.
87. Li, W., Mital, S., Ojaimi, C., Csiszar, A., Kaley, G., and Hintze, T. H. (2004) Premature Death and Age-Related Cardiac Dysfunction in Male eNOS-Knockout Mice. J Mol Cell Cardiol. 37, 671-680.
90. Godecke, A., Decking, U. K., Ding, Z., Hirchenhain, J., Bidmon, H. J., Godecke, S., and Schrader, J. (1998) Coronary Hemodynamics in Endothelial NO Synthase Knockout Mice. Circ Res. 82, 186-194.
91. Shesely, E. G., Maeda, N., Kim, H. S., Desai, K. M., Krege, J. H., Laubach, V. E., Sherman, P. A., Sessa, W. C., and Smithies, O. (1996) Elevated Blood Pressures in Mice Lacking Endothelial Nitric Oxide Synthase. Proc Natl Acad Sci U S A. 93, 13176-13181.
92. Kojda, G., Laursen, J. B., Ramasamy, S., Kent, J. D., Kurz, S., Burchfield, J., Shesely, E. G., and Harrison, D. G. (1999) Protein Expression, Vascular Reactivity and Soluble Guanylate Cyclase Activity in Mice Lacking the Endothelial Cell Nitric Oxide Synthase: Contributions of NOS Isoforms to Blood Pressure and Heart Rate Control. Cardiovasc Res. 42, 206-213.
93. Steudel, W., Scherrer-Crosbie, M., Bloch, K. D., Weimann, J., Huang, P. L., Jones, R. C., Picard, M. H., and Zapol, W. M. (1998) Sustained Pulmonary Hypertension and Right Ventricular Hypertrophy After Chronic Hypoxia in Mice with Congenital Deficiency of Nitric Oxide Synthase 3. J Clin Invest. 101, 2468-2477.
95. Albrecht, E. W., Stegeman, C. A., Heeringa, P., Henning, R. H., and van Goor, H. (2003) Protective Role of Endothelial Nitric Oxide Synthase. J Pathol. 199, 8-17.
96. Nisoli, E., Clementi, E., Paolucci, C., Cozzi, V., Tonello, C., Sciorati, C., Bracale, R., Valerio, A., Francolini, M., Moncada, S., and Carruba, M. O. (2003) Mitochondrial Biogenesis in Mammals: The Role of Endogenous Nitric Oxide. Science. 299, 896-899.
97. Aguirre, J., Buttery, L., O'Shaughnessy, M., Afzal, F., Fernandez de Marticorena, I., Hukkanen, M., Huang, P., MacIntyre, I., and Polak, J. (2001) Endothelial Nitric Oxide Synthase Gene-Deficient Mice Demonstrate Marked Retardation in Postnatal Bone Formation, Reduced Bone Volume, and Defects in Osteoblast Maturation and Activity. Am J Pathol. 158, 247-257.
99. Kleinbongard, P., Schulz, R., Rassaf, T., Lauer, T., Dejam, A., Jax, T., Kumara, I., Gharini, P., Kabanova, S., Ozuyaman, B., Schnurch, H. G., Godecke, A., Weber, A. A., Robenek, M., Robenek, H., Bloch, W., Rosen, P., and Kelm, M. (2006) Red Blood Cells Express a Functional Endothelial Nitric Oxide Synthase. Blood. 107, 2943-2951.
100. Koh, E. H., Kim, M., Ranjan, K. C., Kim, H. S., Park, H. S., Oh, K. S., Park, I. S., Lee, W. J., Kim, M. S., Park, J. Y., Youn, J. H., and Lee, K. U. (2010) ENOS Plays a Major Role in Adiponectin Synthesis in Adipocytes. Am J Physiol Endocrinol Metab. 298, E846-53.
101. Lepic, E., Burger, D., Lu, X., Song, W., and Feng, Q. (2006) Lack of Endothelial Nitric Oxide Synthase Decreases Cardiomyocyte Proliferation and Delays Cardiac Maturation. Am J Physiol Cell Physiol. 291, C1240-6.
102. Jablonka-Shariff, A., Ravi, S., Beltsos, A. N., Murphy, L. L., and Olson, L. M. (1999) Abnormal Estrous Cyclicity After Disruption of Endothelial and Inducible Nitric Oxide Synthase in Mice. Biol Reprod. 61, 171-177.
104. Frisch, C., Dere, E., Silva, M. A., Godecke, A., Schrader, J., and Huston, J. P. (2000) Superior Water Maze Performance and Increase in Fear-Related Behavior in the Endothelial Nitric Oxide Synthase-Deficient Mouse Together with Monoamine Changes in Cerebellum and Ventral Striatum. J Neurosci. 20, 6694-6700.
105. Duplain, H., Burcelin, R., Sartori, C., Cook, S., Egli, M., Lepori, M., Vollenweider, P., Pedrazzini, T., Nicod, P., Thorens, B., and Scherrer, U. (2001) Insulin Resistance, Hyperlipidemia, and Hypertension in Mice Lacking Endothelial Nitric Oxide Synthase. Circulation. 104, 342-345.
107. Arngrimsson, R., Hayward, C., Nadaud, S., Baldursdottir, A., Walker, J. J., Liston, W. A., Bjarnadottir, R. I., Brock, D. J., Geirsson, R. T., Connor, J. M., and Soubrier, F. (1997) Evidence for a Familial Pregnancy-Induced Hypertension Locus in the eNOS-Gene Region. Am J Hum Genet. 61, 354-362.
108. Berger, K., Stogbauer, F., Stoll, M., Wellmann, J., Huge, A., Cheng, S., Kessler, C., John, U., Assmann, G., Ringelstein, E. B., and Funke, H. (2007) The glu298asp Polymorphism in the Nitric Oxide Synthase 3 Gene is Associated with the Risk of Ischemic Stroke in Two Large Independent Case-Control Studies. Hum Genet. 121, 169-178.
110. Hingorani, A. D., Liang, C. F., Fatibene, J., Lyon, A., Monteith, S., Parsons, A., Haydock, S., Hopper, R. V., Stephens, N. G., O'Shaughnessy, K. M., and Brown, M. J. (1999) A Common Variant of the Endothelial Nitric Oxide Synthase (Glu298-->Asp) is a Major Risk Factor for Coronary Artery Disease in the UK. Circulation. 100, 1515-1520.
112. Dahiyat, M., Cumming, A., Harrington, C., Wischik, C., Xuereb, J., Corrigan, F., Breen, G., Shaw, D., and St Clair, D. (1999) Association between Alzheimer's Disease and the NOS3 Gene. Ann Neurol. 46, 664-667.
113. Heltianu, C., Costache, G., Azibi, K., Poenaru, L., and Simionescu, M. (2002) Endothelial Nitric Oxide Synthase Gene Polymorphisms in Fabry's Disease. Clin Genet. 61, 423-429.
116. Palatka, K., Serfozo, Z., Vereb, Z., Hargitay, Z., Lontay, B., Erdodi, F., Banfalvi, G., Nemes, Z., Udvardy, M., and Altorjay, I. (2005) Changes in the Expression and Distribution of the Inducible and Endothelial Nitric Oxide Synthase in Mucosal Biopsy Specimens of Inflammatory Bowel Disease. Scand J Gastroenterol. 40, 670-680.
117. Sasaki, M., Bharwani, S., Jordan, P., Elrod, J. W., Grisham, M. B., Jackson, T. H., Lefer, D. J., and Alexander, J. S. (2003) Increased Disease Activity in eNOS-Deficient Mice in Experimental Colitis. Free Radic Biol Med. 35, 1679-1687.
118. Palatka, K., Serfozo, Z., Vereb, Z., Batori, R., Lontay, B., Hargitay, Z., Nemes, Z., Udvardy, M., Erdodi, F., and Altorjay, I. (2006) Effect of IBD Sera on Expression of Inducible and Endothelial Nitric Oxide Synthase in Human Umbilical Vein Endothelial Cells. World J Gastroenterol. 12, 1730-1738.
119. Miller, M. J., Chotinaruemol, S., Sadowska-Krowicka, H., Kakkis, J. L., Munshi, U. K., Zhang, X. J., and Clark, D. A. (1993) Nitric Oxide: The Jekyll and Hyde of Gut Inflammation. Agents Actions. 39 Spec No, C180-2.
120. Miller, M. J., Munshi, U. K., Sadowska-Krowicka, H., Kakkis, J. L., Zhang, X. J., Eloby-Childress, S., and Clark, D. A. (1994) Inhibition of Calcium-Dependent Nitric Oxide Synthase Causes Ileitis and Leukocytosis in Guinea Pigs. Dig Dis Sci. 39, 1185-1192.
|
Science Writers | Anne Murray |
Illustrators | Peter Jurek |
Authors | Emre Turer and Bruce Beutler |