Phenotypic Mutation 'arum' (pdf version)
List |< first << previous [record 24 of 511] next >> last >|
Allelearum
Mutation Type critical splice donor site (2 bp from exon)
Chromosome8
Coordinate3,688,796 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Fcer2a
Gene Name Fc receptor, IgE, low affinity II, alpha polypeptide
Synonym(s) Ly-42, FC epsilon RII, CD23, Fce2, low-affinity IgE receptor
Chromosomal Location 3,681,737-3,694,174 bp (-)
MGI Phenotype Mice homozygous for mutations in this gene are essentially normal although IgE levels or IgE mediated responses may be abnormal.
Accession Number

NCBI RefSeq: NM_013517, NM_001253737, NM_001253739, NM_001253743, NM_001253745, NM_001253746, NM_001253747; MGI:95497

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000005678]
PDB Structure
[]
SMART Domains Protein: ENSMUSP00000005678
Gene: ENSMUSG00000005540

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
coiled coil region 80 150 N/A INTRINSIC
CLECT 186 306 2.11e-41 SMART
Predicted Effect probably null
Phenotypic Category decrease in B cells, decrease in IgD+ B cells, decrease in IgM+ B cells, increase in CD11c+ DCs, increase in neutrophils
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(8) : Chemically induced (ENU)(1) Spontaneous(1) Targeted(4) Transgenic(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Fcer2a APN 8 3688842 missense possibly damaging 0.85
IGL01458:Fcer2a APN 8 3688151 missense probably benign 0.01
IGL01545:Fcer2a APN 8 3683598 nonsense probably null
IGL01994:Fcer2a APN 8 3688302 missense possibly damaging 0.61
IGL03340:Fcer2a APN 8 3688310 missense probably benign 0.02
anemone UTSW 8 3688796 critical splice donor site
R0058:Fcer2a UTSW 8 3688111 splice donor site probably benign
R0058:Fcer2a UTSW 8 3688111 splice donor site probably benign
R0241:Fcer2a UTSW 8 3688796 critical splice donor site probably null
R0241:Fcer2a UTSW 8 3688796 critical splice donor site probably null
R0276:Fcer2a UTSW 8 3689811 missense probably benign 0.04
R1530:Fcer2a UTSW 8 3682976 missense probably benign 0.30
R2167:Fcer2a UTSW 8 3688018 splice acceptor site probably benign
R2202:Fcer2a UTSW 8 3688557 missense probably benign 0.00
R4133:Fcer2a UTSW 8 3691130 missense possibly damaging 0.60
R4249:Fcer2a UTSW 8 3688831 missense probably benign
R4273:Fcer2a UTSW 8 3682848 missense probably benign 0.00
R4506:Fcer2a UTSW 8 3688603 unclassified probably null
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 11/08/2016 10:13 AM by Anne Murray
Record Created 02/18/2015 6:43 PM by Jin Huk Choi
Record Posted 11/08/2016
Phenotypic Description

Figure 1. Arum mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Arum mice exhibited a decreased percentage of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Arum mice exhibit decreased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Arum mice exhibit increased frequencies of peripheral CD11c+ dendritic cells. Flow cytometric analysis of peripheral blood was utilized to determine DC cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Arum mice exhibit increased frequencies of peripheral neutrophils. Flow cytometric analysis of peripheral blood was utilized to determine neutrophil cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The arum phenotype was identified among G3 mice of the pedigree R0241, some of which showed a diminished frequency of B cells (Figure 1), a decreased percentage of IgD+ B cells (Figure 2), a decreased frequency of IgM+ B cells (Figure 3), an increased frequency of CD11c+ dendritic cells (Figure 4), and an increased frequency of neutrophils (Figure 5), all in the peripheral blood.

Nature of Mutation

Figure 6. Linkage mapping of the reduced frequency of IgM+ B cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 69 mutations (X-axis) identified in the G1 male of pedigree R0241. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 69 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Fcer2a: a T to C transition at base pair 3,688,796 (v38) on chromosome 8, or base pair 5,379 in the GenBank genomic region NC_000074 within the donor splice site of intron 5, two base pairs from exon 5. The strongest association was found with a recessive model of linkage to the normalized frequency of IgM+ B cells, wherein two variant homozygotes departed phenotypically from four homozygous reference mice and seven heterozygous mice with a P value of 5.912 x 10-7 (Figure 6).  

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 63-nucleotide exon 5 (out of 12 total exons), resulting in an in-frame deletion of 21 amino acids beginning after amino acid 66 of the encoded protein.

 
              <--exon 4          <--exon 5 intron 5-->    exon 6-->      <--exon 12
4383 ……ACTGCAATTCAGAATG ……GCCCAGAAGTCCCAGG gtgagccagcca…… TTGTTCAGATG……AGTGAACCCTGA…… 11354
61   ……-T--A--I--Q--N-- ……-A--Q--K--S--Q--                V--V--Q--M-……-S--E--P--*-

                       correct                                deleted                                                                    correct

 

Genomic numbering corresponds to NC_000074. The donor splice site of intron 5, which is destroyed by the arum mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction
Figure 7. Domain organization of CD23. The location of the arum muation is indicated. CD23 is a type II transmembrane protein with cytoplasmic N-terminus and an extracellular C-terminal domain that contains a C-type (Ca2+-dependent) leptin domain.

Fcer2a encodes CD23 (alternatively, FcεRII), the low-affinity receptor for immunoglobulin (Ig) E (Figure 7). CD23 is a type II transmembrane protein that has a short cytoplasmic N-terminus (amino acids 1-23) and a large extracellular C-terminal domain (amino acids 50-331) that contains a domain similar to that in C-type (Ca2+-dependent) leptins (amino acids 185-298). A stalk region has several repeats that function as a leucine zipper and that mediate CD23 oligomerization.

 

The use of two transcription initiation start sites and alternative splicing yield two CD23 isoforms: CD23a and CD23b (1). The isoforms differ by six or seven amino acids in the N-terminal domain in both human and mouse. Pax5 is a regulator of the B cell-restricted expression of Cd23a (2). CD23a undergoes constitutive clathrin-dependent internalization, and CD23b is stable at the plasma membrane (3). Mouse intestinal epithelial cells express a splice variant of CD23b, CD23bΔ5, which lacks sequences encoded by exon 5. The sequence deleted in the CD23bΔ5 variant is located in the coiled-coil stalk region of CD23 (4). Mouse intestinal epithelial cells also express low levels of transcripts that lack exons 6, 5 and 6, and 5, 6, and 7. These mutants, the CD23bΔ5 variant, and CD23a, are constitutively internalized; full-length CD23 is not.

Figure 8. Crystal structure of the human IgE-Fc/sFcεRIα complex. sFcεRIα is colored in turquoise (amino acids 26-201), IgE-Fc chain A in purple and chain B in pink (amino acids 104-427). The images was generated by UCSF Chimera, and is based on PDB:2Y7Q. The image is interactive; click to rotate.

CD23 can be cleaved from cell surfaces to form soluble forms of CD23 (sCD23) of 37 kDa, 33 kDa, 25 kDa, and 16 kDa. Each of the sCD23 forms can bind IgE and can function similar to a cytokine. Full-length CD23 can be sorted in an ADAM10-dependent manner into exosomes, whereby it is then cleaved by ADAM10 before being released from the cell (5). ADAM10 cleaves CD23 at the C-terminal side of either Ala80 (to generate the 37 kDa sCD23) or Arg101 (to generate the 33 kDa sCD23) (6;7). ADAM10-mediated CD23 cleavage on leukocytes occurs upon ATP-stimulated activation of the P2X7 receptor (8). The der p1 protease in the feces of the house dust mite Dermatophagoides pterronysinus cleaves between Ser155/Ser156 and Glu298/Ser299 to yield the 16 kDa derCD23 fragment (9;10). IL-4 and IFN-gamma stimulate sCD23 production in B cells and monocytes, while IFN-alpha inhibits sCD23 synthesis in response to IFN-gamma or IL-4 (11).

 

The C-type lectin-like domain folds similar to C-type lectins. It has eight β strands, two α-helices, and contains two calcium-binding sites. The IgE binding surface is on the surface of the lectin-like domain and is mediated by Trp184, Arg188, Tyr189, Ala190, Leu198, His202, Ile221, Gly222, Arg224, Asn225, Leu226, Trp234, Val235, Ala271, Cys273, Asp274, Lys276, and Ala270 (12). Another CD23 ligand, CD21, contacts four residues at the C-terminus of derCD23: Glu294, Gly295, Ser296, and Glu298 (13). The residues for CD21 binding are absent in mouse CD23. The αv integrin binding sites are located on a loop between the β0 and β1 strands of the lectin-like domain; Arg172, Lys173, and Cys174 are essential CD23 residues for binding (14). The MHCII binding is mediated by residues Glu48 to Lys59 within the stalk region of CD23 (15).

Expression/Localization

CD23 is expressed in T and B cells (16;17), monocytes/macrophages (18;19), follicular dendritic cells (20), intestinal epithelial cells (21), polymorphonuclear leukocytes (neutrophils, eosinophils, and basophils) (18;22;23), and bone marrow stromal cells (24).

 

CD23a is constitutively expressed in B cells, while CD23b is expressed in T cells, B cells, monocytic cells, and polymorphonuclear leukocytes. CD23b expression is upregulated after Epstein—Barr Virus infection (25), stimulation by IL-4 in B cells (26) or monocytes (19), or by engagement of CD40 on B cells (27). CD23a is principally localized at the basolateral pole of intestinal epithelial cells, while CD23b is at the apical face of the cells.

Background

CD23 has several ligands, including IgE, CD21, and several integrins, including αMβ2, αvβ3, αvβ5, and αXβ2 (Table 1). The principal ligand is IgE, which binds both the membrane-bound and soluble forms of CD23. CD23 can also interact with major histocompatibility complex class II proteins (15). The interaction with the MHCII proteins is proposed to facilitate antigen processing and presentation by antigen—IgE complexes captured by CD23 (28).

 

Table 1. CD23 ligands.

CD23 ligand

 

Function

References

IgE (see the record for allegra)

Binds with low affinity to CD23

CD23—IgE binding prevents IgE binding to FcεRI

 

CD21 (CR2) (see the record for pillar)

Human sCD23 and CD23

 

(29)

MHC II proteins

 

Facilitates antigen processing and presentiation by antigen—IgE complexes captured by CD23

(28)

αMβ2 (CD11b/CD18) see the record for invisible)

 

Leukocyte integrin; mediate monocyte responses to CD23

(30;31)

αvβ3 (vitronectin receptor)

Human sCD23

Cytokine release in monocytic cells

(32)

αvβ5

Human sCD23

Mediates growth and survival of human B cell precurosors

(14)

αXβ2 (CD11c/CD18; see the record for Adendritic)

 

Leukocyte integrin; mediate monocyte responses to CD23

(30)

 

In B cells, sCD23 maintains the growth of activated mature B cells (33-35), promotes differentiation of germinal center centroblasts towards the plasma cell pool (36), and assists B cell precursors in evading apoptosis (37). In other cells, sCD23 promotes the differentiation of myeloid precursors (38), thymocytes (39), and bone marrow CD4+ T cells (40) as well as promotes cytokine release by monocytic cells (32).  sCD23 can also promote nitric oxide production and cyclic adenosine-5′-monophosphate (cAMP) synthesis and cytokine release from monocytic cells (41). sCD23 upregulates IgE after class switch recombination (42;43)

 

Figure 9. IgE-associated signaling. After FcεRI aggregation by antigen-crosslinked immunoglobulin E, LYN is activated and phosphorylates immunoreceptor tyrosine-based activation motifs (ITAMs) in the FcεRI; LYN and SYK are recruited to the receptor and activated, and then phosphorylate many downstream signalling proteins. After activation, phosphatidylinositol 3-kinase (PI3K) catalyses the synthesis of phosphatidylinositol-3,4,5-trisphosphate (PtdInsP3) and phosphatidylinositol-3,4,-bisphosphate. PtdInsP3 recruits phospholipase Cγ (PLCγ), BTK and AKT to the plasma membrane. AKT has a crucial role in cell survival and the transcriptional regulation of cytokine genes. Through interactions with the adaptor protein linker for activation of T cells (LAT) and PtdInsP3, PLCγ becomes a target of BTK. Phosphorylated PLCγ generates diacylglycerol (DAG) and inositol-1,4,5-trisphosphate (InsP3) from phosphatidylinositol-4,5-bisphosphate (PtdInsP2). DAG activates many isoforms of protein kinase C (PKC), and InsP3 recruits Ca2+ from intracellular stores. Cellular Ca2+ responses consist of the initial release of Ca2+ from the endoplasmic reticulum and a BTK-dependent sustained Ca2+ influx, which promotes degranulation and the release of granule-associated products. Active SYK, through the phosphorylation of substrates such as LAT, SLP76 and VAV, activates pathways that result in degranulation, the synthesis and release of lipid mediators derived from arachidonic acid and synthesis and secretion of cytokines. ERK, extracellular-signal-regulated kinase; MEK, mitogen-activated protein kinase kinase; PLA2, phospholipase A2. Figure and legend adapted from Kawakami & Galli, 2002. This image is interactive; click to view mutations associated with this pathway.

The CD23-associated signaling pathways differ between B cells and monocytes (44). In B cells, ERK1/2 activation leads to the activation of the tyrosine kinase Fyn and Akt; Fyn and Akt activation are not observed in monoyctes (Figure 9). In B cells, CD23 activation promotes both inositol lipid hydrolysis and calcium mobilization (45) and delayed cAMP accumulation (46). CD23 stimulation in monocytic cells produces only cAMP accumulation and no lipid signaling. In addition, NO production following CD23 ligation appears to be restricted to monocytes (47). CD23a putatively associates with the Fyn tyrosine kinase; the residue responsible for association with Fyn (Tyr6) is absent in CD23b (48). CD23a and CD23b also differ in the mode of uptake and recycling. CD23a enters the cell by endocytosis, while CD23b does not undergo endocytosis efficiently, but targets IgE-coated particles to a phagocytic uptake pathway (49). In human monocyte-derived macrophages, cross-linking of surface CD23 induced a dose-dependent antibacterial activity of the macrophages (50). In addition, CD23 activation resulted in the production of TNF-alpha from the macrophages. The CD23b isoform mediates the transocytosis of IgE and IgE-antigen complexes in intestinal epithelial cells (21;51). On respiratory tract epithelial cells, CD23 promotes airway allergic inflammation (52).

 

Fcer2a mutations in the mouse lead to defects in antigen processing and presentation of IgE-antigen complexes as well as a hyper-IgE phenotype compared to wild type mice (53-56). Serum levels of IgG1 and IgG2b were lower in the Cd23-/- mice, but the serum levels of IgM, IgG3, and IgA were similar to that in wild-type mice (56). Fcer2a-deficient (Cd23-/-) mice did not exhibit changes in the frequency of thymocytes, peripheral T cells, B1 and B2b cells (53;56). T and B cell development in the Cd23-/- mice was normal (56). Also, the B cell proliferative response to CD40 ligand (see the record for walla), IL-2, and IL-4 were not altered. The Cd23-/- mice exhibited normal IgE responses upon immunization with T-dependent antigens (57). In addition, germinal center formation after immunization and B cell proliferation were not affected in the Cd23-/- mice (57).

 

Increased levels of sCD23 are found in several autoimmune diseases, including Sjogren’s syndrome, systemic lupus erythematosus, and rheumatoid arthritis.

Putative Mechanism

sCD23 maintains the growth of activated mature B cells (33-35). Fcer2a-deficient (Cd23-/-) mice did not exhibit changes in the frequency of thymocytes, peripheral T cells, B1 and B2b cells (53;56). T and B cell development in the Cd23-/- mice was normal (56).

Primers PCR Primer
arum(F):5'- GTGATGACAAGGTTCCTGGAGAGTG -3'
arum(R):5'- GATGTGAAAGAGGCCCCTGAACTG -3'

Sequencing Primer
arum_seq(F):5'- TTCCTGGAGAGTGTCCCCTG -3'
arum_seq(R):5'- aggaggttgaggcaggag -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsKuan-Wen Wang, Jin Huk Choi, Ming Zeng, Bruce Beutler
List |< first << previous [record 24 of 511] next >> last >|