Phenotypic Mutation 'arum' (pdf version)
Allele | arum |
Mutation Type |
critical splice donor site
(2 bp from exon)
|
Chromosome | 8 |
Coordinate | 3,738,796 bp (GRCm39) |
Base Change | A ⇒ G (forward strand) |
Gene |
Fcer2a
|
Gene Name | Fc receptor, IgE, low affinity II, alpha polypeptide |
Synonym(s) | Ly-42, FC epsilon RII, Fce2, CD23, low-affinity IgE receptor |
Chromosomal Location |
3,731,737-3,744,175 bp (-) (GRCm39)
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011] PHENOTYPE: Mice homozygous for mutations in this gene are essentially normal although IgE levels or IgE mediated responses may be abnormal. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_013517, NM_001253737, NM_001253739, NM_001253743, NM_001253745, NM_001253746, NM_001253747; MGI:95497
|
Mapped | Yes |
Amino Acid Change |
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000005678 †]
[ENSMUSP00000147052 †]
[ENSMUSP00000146689 †]
[ENSMUSP00000146647 †]
[ENSMUSP00000146822 †]
[ENSMUSP00000146568 †]
[ENSMUSP00000146380]
† probably from a misspliced transcript
|
AlphaFold |
P20693 |
SMART Domains |
Protein: ENSMUSP00000005678 Gene: ENSMUSG00000005540
Domain | Start | End | E-Value | Type |
transmembrane domain
|
26 |
48 |
N/A |
INTRINSIC |
coiled coil region
|
80 |
150 |
N/A |
INTRINSIC |
CLECT
|
186 |
306 |
2.11e-41 |
SMART |
|
Predicted Effect |
probably null
|
Predicted Effect |
probably null
|
Predicted Effect |
probably null
|
Predicted Effect |
probably null
|
Predicted Effect |
probably null
|
Predicted Effect |
probably null
|
Predicted Effect |
probably benign
|
Meta Mutation Damage Score |
0.9488 |
Is this an essential gene? |
Non Essential (E-score: 0.000) |
Phenotypic Category |
Autosomal Recessive |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All Mutations and Alleles(8) : Chemically induced (ENU)(1) Spontaneous(1) Targeted(4) Transgenic(2)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL01102:Fcer2a
|
APN |
8 |
3738842 |
missense |
possibly damaging |
0.94 |
IGL01458:Fcer2a
|
APN |
8 |
3738151 |
missense |
probably benign |
0.45 |
IGL01545:Fcer2a
|
APN |
8 |
3733598 |
nonsense |
probably null |
|
IGL01994:Fcer2a
|
APN |
8 |
3738302 |
missense |
possibly damaging |
0.94 |
IGL03340:Fcer2a
|
APN |
8 |
3738310 |
missense |
possibly damaging |
0.75 |
anemone
|
UTSW |
8 |
3738796 |
critical splice donor site |
probably null |
|
R0058:Fcer2a
|
UTSW |
8 |
3738111 |
splice site |
probably benign |
|
R0058:Fcer2a
|
UTSW |
8 |
3738111 |
splice site |
probably benign |
|
R0241:Fcer2a
|
UTSW |
8 |
3738796 |
critical splice donor site |
probably null |
|
R0241:Fcer2a
|
UTSW |
8 |
3738796 |
critical splice donor site |
probably null |
|
R0276:Fcer2a
|
UTSW |
8 |
3739811 |
missense |
possibly damaging |
0.89 |
R1530:Fcer2a
|
UTSW |
8 |
3732976 |
missense |
probably damaging |
0.98 |
R2202:Fcer2a
|
UTSW |
8 |
3738557 |
missense |
possibly damaging |
0.72 |
R4133:Fcer2a
|
UTSW |
8 |
3741130 |
missense |
possibly damaging |
0.60 |
R4249:Fcer2a
|
UTSW |
8 |
3738831 |
missense |
probably benign |
0.00 |
R4273:Fcer2a
|
UTSW |
8 |
3732848 |
missense |
possibly damaging |
0.81 |
R4506:Fcer2a
|
UTSW |
8 |
3738603 |
splice site |
probably null |
|
R6796:Fcer2a
|
UTSW |
8 |
3739830 |
missense |
possibly damaging |
0.92 |
R6861:Fcer2a
|
UTSW |
8 |
3732910 |
missense |
probably damaging |
0.98 |
R7421:Fcer2a
|
UTSW |
8 |
3740335 |
missense |
probably benign |
|
R7795:Fcer2a
|
UTSW |
8 |
3732910 |
missense |
probably benign |
|
|
Mode of Inheritance |
Autosomal Recessive |
Local Stock | |
Repository | |
Last Updated |
2019-09-04 9:46 PM
by Bruce Beutler
|
Record Created |
2015-02-18 6:43 PM
by Jin Huk Choi
|
Record Posted |
2016-11-08 |
Phenotypic Description |
The arum phenotype was identified among G3 mice of the pedigree R0241, some of which showed a diminished frequency of B cells (Figure 1), a decreased percentage of IgD+ B cells (Figure 2), a decreased frequency of IgM+ B cells (Figure 3), an increased frequency of CD11c+ dendritic cells (Figure 4), and an increased frequency of neutrophils (Figure 5), all in the peripheral blood.
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 69 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Fcer2a: a T to C transition at base pair 3,688,796 (v38) on chromosome 8, or base pair 5,379 in the GenBank genomic region NC_000074 within the donor splice site of intron 5, two base pairs from exon 5. The strongest association was found with a recessive model of linkage to the normalized frequency of IgM+ B cells, wherein two variant homozygotes departed phenotypically from four homozygous reference mice and seven heterozygous mice with a P value of 5.912 x 10-7 (Figure 6). The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 63-nucleotide exon 5 (out of 12 total exons), resulting in an in-frame deletion of 21 amino acids beginning after amino acid 66 of the encoded protein.
<--exon 4 <--exon 5 intron 5--> exon 6--> <--exon 12
4383 ……ACTGCAATTCAGAATG ……GCCCAGAAGTCCCAGG gtgagccagcca…… TTGTTCAGATG……AGTGAACCCTGA…… 11354
61 ……-T--A--I--Q--N-- ……-A--Q--K--S--Q-- V--V--Q--M-……-S--E--P--*-
correct deleted correct
|
Genomic numbering corresponds to NC_000074. The donor splice site of intron 5, which is destroyed by the arum mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
Fcer2a encodes CD23 (alternatively, FcεRII), the low-affinity receptor for immunoglobulin (Ig) E (Figure 7). CD23 is a type II transmembrane protein that has a short cytoplasmic N-terminus (amino acids 1-23) and a large extracellular C-terminal domain (amino acids 50-331) that contains a domain similar to that in C-type (Ca2+-dependent) leptins (amino acids 185-298). A stalk region has several repeats that function as a leucine zipper and that mediate CD23 oligomerization. The use of two transcription initiation start sites and alternative splicing yield two CD23 isoforms: CD23a and CD23b (1). The isoforms differ by six or seven amino acids in the N-terminal domain in both human and mouse. Pax5 is a regulator of the B cell-restricted expression of Cd23a (2). CD23a undergoes constitutive clathrin-dependent internalization, and CD23b is stable at the plasma membrane (3). Mouse intestinal epithelial cells express a splice variant of CD23b, CD23bΔ5, which lacks sequences encoded by exon 5. The sequence deleted in the CD23bΔ5 variant is located in the coiled-coil stalk region of CD23 (4). Mouse intestinal epithelial cells also express low levels of transcripts that lack exons 6, 5 and 6, and 5, 6, and 7. These mutants, the CD23bΔ5 variant, and CD23a, are constitutively internalized; full-length CD23 is not.
CD23 can be cleaved from cell surfaces to form soluble forms of CD23 (sCD23) of 37 kDa, 33 kDa, 25 kDa, and 16 kDa. Each of the sCD23 forms can bind IgE and can function similar to a cytokine. Full-length CD23 can be sorted in an ADAM10-dependent manner into exosomes, whereby it is then cleaved by ADAM10 before being released from the cell (5). ADAM10 cleaves CD23 at the C-terminal side of either Ala80 (to generate the 37 kDa sCD23) or Arg101 (to generate the 33 kDa sCD23) (6;7). ADAM10-mediated CD23 cleavage on leukocytes occurs upon ATP-stimulated activation of the P2X7 receptor (8). The der p1 protease in the feces of the house dust mite Dermatophagoides pterronysinus cleaves between Ser155/Ser156 and Glu298/Ser299 to yield the 16 kDa derCD23 fragment (9;10). IL-4 and IFN-gamma stimulate sCD23 production in B cells and monocytes, while IFN-alpha inhibits sCD23 synthesis in response to IFN-gamma or IL-4 (11). The C-type lectin-like domain folds similar to C-type lectins. It has eight β strands, two α-helices, and contains two calcium-binding sites. The IgE binding surface is on the surface of the lectin-like domain and is mediated by Trp184, Arg188, Tyr189, Ala190, Leu198, His202, Ile221, Gly222, Arg224, Asn225, Leu226, Trp234, Val235, Ala271, Cys273, Asp274, Lys276, and Ala270 (12). Another CD23 ligand, CD21, contacts four residues at the C-terminus of derCD23: Glu294, Gly295, Ser296, and Glu298 (13). The residues for CD21 binding are absent in mouse CD23. The αv integrin binding sites are located on a loop between the β0 and β1 strands of the lectin-like domain; Arg172, Lys173, and Cys174 are essential CD23 residues for binding (14). The MHCII binding is mediated by residues Glu48 to Lys59 within the stalk region of CD23 (15).
|
Expression/Localization | CD23 is expressed in T and B cells (16;17), monocytes/macrophages (18;19), follicular dendritic cells (20), intestinal epithelial cells (21), polymorphonuclear leukocytes (neutrophils, eosinophils, and basophils) (18;22;23), and bone marrow stromal cells (24). CD23a is constitutively expressed in B cells, while CD23b is expressed in T cells, B cells, monocytic cells, and polymorphonuclear leukocytes. CD23b expression is upregulated after Epstein—Barr Virus infection (25), stimulation by IL-4 in B cells (26) or monocytes (19), or by engagement of CD40 on B cells (27). CD23a is principally localized at the basolateral pole of intestinal epithelial cells, while CD23b is at the apical face of the cells.
|
Background | CD23 has several ligands, including IgE, CD21, and several integrins, including αMβ2, αvβ3, αvβ5, and αXβ2 (Table 1). The principal ligand is IgE, which binds both the membrane-bound and soluble forms of CD23. CD23 can also interact with major histocompatibility complex class II proteins (15). The interaction with the MHCII proteins is proposed to facilitate antigen processing and presentation by antigen—IgE complexes captured by CD23 (28). Table 1. CD23 ligands.
CD23 ligand
|
|
Function
|
References
|
IgE (see the record for allegra)
|
Binds with low affinity to CD23
|
CD23—IgE binding prevents IgE binding to FcεRI
|
|
CD21 (CR2) (see the record for pillar)
|
Human sCD23 and CD23
|
|
(29)
|
MHC II proteins
|
|
Facilitates antigen processing and presentiation by antigen—IgE complexes captured by CD23
|
(28)
|
αMβ2 (CD11b/CD18) see the record for invisible)
|
|
Leukocyte integrin; mediate monocyte responses to CD23
|
(30;31)
|
αvβ3 (vitronectin receptor)
|
Human sCD23
|
Cytokine release in monocytic cells
|
(32)
|
αvβ5
|
Human sCD23
|
Mediates growth and survival of human B cell precurosors
|
(14)
|
αXβ2 (CD11c/CD18; see the record for Adendritic)
|
|
Leukocyte integrin; mediate monocyte responses to CD23
|
(30)
|
In B cells, sCD23 maintains the growth of activated mature B cells (33-35), promotes differentiation of germinal center centroblasts towards the plasma cell pool (36), and assists B cell precursors in evading apoptosis (37). In other cells, sCD23 promotes the differentiation of myeloid precursors (38), thymocytes (39), and bone marrow CD4+ T cells (40) as well as promotes cytokine release by monocytic cells (32). sCD23 can also promote nitric oxide production and cyclic adenosine-5′-monophosphate (cAMP) synthesis and cytokine release from monocytic cells (41). sCD23 upregulates IgE after class switch recombination (42;43)
The CD23-associated signaling pathways differ between B cells and monocytes (44). In B cells, ERK1/2 activation leads to the activation of the tyrosine kinase Fyn and Akt; Fyn and Akt activation are not observed in monoyctes (Figure 9). In B cells, CD23 activation promotes both inositol lipid hydrolysis and calcium mobilization (45) and delayed cAMP accumulation (46). CD23 stimulation in monocytic cells produces only cAMP accumulation and no lipid signaling. In addition, NO production following CD23 ligation appears to be restricted to monocytes (47). CD23a putatively associates with the Fyn tyrosine kinase; the residue responsible for association with Fyn (Tyr6) is absent in CD23b (48). CD23a and CD23b also differ in the mode of uptake and recycling. CD23a enters the cell by endocytosis, while CD23b does not undergo endocytosis efficiently, but targets IgE-coated particles to a phagocytic uptake pathway (49). In human monocyte-derived macrophages, cross-linking of surface CD23 induced a dose-dependent antibacterial activity of the macrophages (50). In addition, CD23 activation resulted in the production of TNF-alpha from the macrophages. The CD23b isoform mediates the transocytosis of IgE and IgE-antigen complexes in intestinal epithelial cells (21;51). On respiratory tract epithelial cells, CD23 promotes airway allergic inflammation (52). Fcer2a mutations in the mouse lead to defects in antigen processing and presentation of IgE-antigen complexes as well as a hyper-IgE phenotype compared to wild type mice (53-56). Serum levels of IgG1 and IgG2b were lower in the Cd23-/- mice, but the serum levels of IgM, IgG3, and IgA were similar to that in wild-type mice (56). Fcer2a-deficient (Cd23-/-) mice did not exhibit changes in the frequency of thymocytes, peripheral T cells, B1 and B2b cells (53;56). T and B cell development in the Cd23-/- mice was normal (56). Also, the B cell proliferative response to CD40 ligand (see the record for walla), IL-2, and IL-4 were not altered. The Cd23-/- mice exhibited normal IgE responses upon immunization with T-dependent antigens (57). In addition, germinal center formation after immunization and B cell proliferation were not affected in the Cd23-/- mice (57). Increased levels of sCD23 are found in several autoimmune diseases, including Sjogren’s syndrome, systemic lupus erythematosus, and rheumatoid arthritis.
|
Putative Mechanism | sCD23 maintains the growth of activated mature B cells (33-35). Fcer2a-deficient (Cd23-/-) mice did not exhibit changes in the frequency of thymocytes, peripheral T cells, B1 and B2b cells (53;56). T and B cell development in the Cd23-/- mice was normal (56).
|
Primers |
PCR Primer
arum_pcr_F: GTGATGACAAGGTTCCTGGAGAGTG
arum_pcr_R: GATGTGAAAGAGGCCCCTGAACTG
Sequencing Primer
arum_seq_F: TTCCTGGAGAGTGTCCCCTG
arum_seq_R: aggaggttgaggcaggag
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 498 nucleotides is amplified (chromosome 8, - strand):
1 gatgtgaaag aggcccctga actgagggtt ggggtgaagt acaacccaac cttaactgga 61 tgccttaact gggtatgggg gtgcatgtgt ggctgttgtg tcaggaggtt gaggcaggag 121 gactgcaagt gtgaaagcaa tatgaactgc aaagtgggaa aggagaaaga gagggaggaa 181 aggggggagg gatggatgga aagtgggtct ttgtgattct taaaaatacc tttcctcttc 241 ctccctctgt cccagtctct catgttacca aggacttaca aaaattccag agtaatcaat 301 tggcccagaa gtcccagggt gagccagcca cctcctgtca gtttgggttg gggaaggaaa 361 aaaaggctga aatggccttg gatagtcagt agtggtttat ccatgccctg ctgcaaacca 421 cacagcaaag agacagccct aggggccatg ggggaagagg tggaggcagg ggacactctc 481 caggaacctt gtcatcac
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References | 1. Yokota, A., Kikutani, H., Tanaka, T., Sato, R., Barsumian, E. L., Suemura, M., and Kishimoto, T. (1988) Two Species of Human Fc Epsilon Receptor II (Fc Epsilon RII/CD23): Tissue-Specific and IL-4-Specific Regulation of Gene Expression. Cell. 55, 611-618.
2. Visan, I., Goller, M., Berberich, I., Kneitz, C., and Tony, H. P. (2003) Pax-5 is a Key Regulator of the B Cell-Restricted Expression of the CD23a Isoform. Eur J Immunol. 33, 1163-1173.
3. Montagnac, G., Molla-Herman, A., Bouchet, J., Yu, L. C., Conrad, D. H., Perdue, M. H., and Benmerah, A. (2005) Intracellular Trafficking of CD23: Differential Regulation in Humans and Mice by both Extracellular and Intracellular Exons. J Immunol. 174, 5562-5572.
4. Montagnac, G., Yu, L. C., Bevilacqua, C., Heyman, M., Conrad, D. H., Perdue, M. H., and Benmerah, A. (2005) Differential Role for CD23 Splice Forms in Apical to Basolateral Transcytosis of IgE/allergen Complexes. Traffic. 6, 230-242.
5. Mathews, J. A., Gibb, D. R., Chen, B. H., Scherle, P., and Conrad, D. H. (2010) CD23 Sheddase A Disintegrin and Metalloproteinase 10 (ADAM10) is also Required for CD23 Sorting into B Cell-Derived Exosomes. J Biol Chem. 285, 37531-37541.
6. Weskamp, G., Ford, J. W., Sturgill, J., Martin, S., Docherty, A. J., Swendeman, S., Broadway, N., Hartmann, D., Saftig, P., Umland, S., Sehara-Fujisawa, A., Black, R. A., Ludwig, A., Becherer, J. D., Conrad, D. H., and Blobel, C. P. (2006) ADAM10 is a Principal 'Sheddase' of the Low-Affinity Immunoglobulin E Receptor CD23. Nat Immunol. 7, 1293-1298.
7. Lemieux, G. A., Blumenkron, F., Yeung, N., Zhou, P., Williams, J., Grammer, A. C., Petrovich, R., Lipsky, P. E., Moss, M. L., and Werb, Z. (2007) The Low Affinity IgE Receptor (CD23) is Cleaved by the Metalloproteinase ADAM10. J Biol Chem. 282, 14836-14844.
9. Schulz, O., Laing, P., Sewell, H. F., and Shakib, F. (1995) Der p I, a Major Allergen of the House Dust Mite, Proteolytically Cleaves the Low-Affinity Receptor for Human IgE (CD23). Eur J Immunol. 25, 3191-3194.
10. Schulz, O., Sutton, B. J., Beavil, R. L., Shi, J., Sewell, H. F., Gould, H. J., Laing, P., and Shakib, F. (1997) Cleavage of the Low-Affinity Receptor for Human IgE (CD23) by a Mite Cysteine Protease: Nature of the Cleaved Fragment in Relation to the Structure and Function of CD23. Eur J Immunol. 27, 584-588.
12. Mossalayi, M. D., Arock, M., Delespesse, G., Hofstetter, H., Bettler, B., Dalloul, A. H., Kilchherr, E., Quaaz, F., Debre, P., and Sarfati, M. (1992) Cytokine Effects of CD23 are Mediated by an Epitope Distinct from the IgE Binding Site. EMBO J. 11, 4323-4328.
13. Hibbert, R. G., Teriete, P., Grundy, G. J., Beavil, R. L., Reljic, R., Holers, V. M., Hannan, J. P., Sutton, B. J., Gould, H. J., and McDonnell, J. M. (2005) The Structure of Human CD23 and its Interactions with IgE and CD21. J Exp Med. 202, 751-760.
14. Borland, G., Edkins, A. L., Acharya, M., Matheson, J., White, L. J., Allen, J. M., Bonnefoy, J. Y., Ozanne, B. W., and Cushley, W. (2007) Alphavbeta5 Integrin Sustains Growth of Human Pre-B Cells through an RGD-Independent Interaction with a Basic Domain of the CD23 Protein. J Biol Chem. 282, 27315-27326.
17. Veneri, D., Ortolani, R., Franchini, M., Tridente, G., Pizzolo, G., and Vella, A. (2009) Expression of CD27 and CD23 on Peripheral Blood B Lymphocytes in Humans of Different Ages. Blood Transfus. 7, 29-34.
18. Kikutani, H., Yokota, A., Uchibayashi, N., Yukawa, K., Tanaka, T., Sugiyama, K., Barsumian, E. L., Suemura, M., and Kishimoto, T. (1989) Structure and Function of Fc Epsilon Receptor II (Fc Epsilon RII/CD23): A Point of Contact between the Effector Phase of Allergy and B Cell Differentiation. Ciba Found Symp. 147, 23-31; discussion 31-5.
19. Vercelli, D., Jabara, H. H., Lee, B. W., Woodland, N., Geha, R. S., and Leung, D. Y. (1988) Human Recombinant Interleukin 4 Induces Fc Epsilon R2/CD23 on Normal Human Monocytes. J Exp Med. 167, 1406-1416.
21. Yu, L. C., Montagnac, G., Yang, P. C., Conrad, D. H., Benmerah, A., and Perdue, M. H. (2003) Intestinal Epithelial CD23 Mediates Enhanced Antigen Transport in Allergy: Evidence for Novel Splice Forms. Am J Physiol Gastrointest Liver Physiol. 285, G223-34.
22. Yamaoka, K. A., Arock, M., Issaly, F., Dugas, N., Le Goff, L., and Kolb, J. P. (1996) Granulocyte Macrophage Colony Stimulating Factor Induces Fc Epsilon RII/CD23 Expression on Normal Human Polymorphonuclear Neutrophils. Int Immunol. 8, 479-490.
23. Capron, M., Truong, M. J., Aldebert, D., Gruart, V., Suemura, M., Delespesse, G., Tourvieille, B., and Capron, A. (1992) Eosinophil IgE Receptor and CD23. Immunol Res. 11, 252-259.
24. Fourcade, C., Arock, M., Ktorza, S., Ouaaz, F., Merle-Beral, H., Mentz, F., Kilchherr, E., Debre, P., and Mossalayi, M. D. (1992) Expression of CD23 by Human Bone Marrow Stromal Cells. Eur Cytokine Netw. 3, 539-543.
25. Wang, F., Kikutani, H., Tsang, S. F., Kishimoto, T., and Kieff, E. (1991) Epstein-Barr Virus Nuclear Protein 2 Transactivates a Cis-Acting CD23 DNA Element. J Virol. 65, 4101-4106.
26. Defrance, T., Aubry, J. P., Rousset, F., Vanbervliet, B., Bonnefoy, J. Y., Arai, N., Takebe, Y., Yokota, T., Lee, F., and Arai, K. (1987) Human Recombinant Interleukin 4 Induces Fc Epsilon Receptors (CD23) on Normal Human B Lymphocytes. J Exp Med. 165, 1459-1467.
28. Flores-Romo, L., Johnson, G. D., Ghaderi, A. A., Stanworth, D. R., Veronesi, A., and Gordon, J. (1990) Functional Implication for the Topographical Relationship between MHC Class II and the Low-Affinity IgE Receptor: Occupancy of CD23 Prevents B Lymphocytes from Stimulating Allogeneic Mixed Lymphocyte Responses. Eur J Immunol. 20, 2465-2469.
29. Aubry, J. P., Pochon, S., Graber, P., Jansen, K. U., and Bonnefoy, J. Y. (1992) CD21 is a Ligand for CD23 and Regulates IgE Production. Nature. 358, 505-507.
30. Lecoanet-Henchoz, S., Gauchat, J. F., Aubry, J. P., Graber, P., Life, P., Paul-Eugene, N., Ferrua, B., Corbi, A. L., Dugas, B., and Plater-Zyberk, C. (1995) CD23 Regulates Monocyte Activation through a Novel Interaction with the Adhesion Molecules CD11b-CD18 and CD11c-CD18. Immunity. 3, 119-125.
31. Lecoanet-Henchoz, S., Plater-Zyberk, C., Graber, P., Gretener, D., Aubry, J. P., Conrad, D. H., and Bonnefoy, J. Y. (1997) Mouse CD23 Regulates Monocyte Activation through an Interaction with the Adhesion Molecule CD11b/CD18. Eur J Immunol. 27, 2290-2294.
32. Hermann, P., Armant, M., Brown, E., Rubio, M., Ishihara, H., Ulrich, D., Caspary, R. G., Lindberg, F. P., Armitage, R., Maliszewski, C., Delespesse, G., and Sarfati, M. (1999) The Vitronectin Receptor and its Associated CD47 Molecule Mediates Proinflammatory Cytokine Synthesis in Human Monocytes by Interaction with Soluble CD23. J Cell Biol. 144, 767-775.
33. Gordon, J., Flores-Romo, L., Cairns, J. A., Millsum, M. J., Lane, P. J., Johnson, G. D., and MacLennan, I. C. (1989) CD23: A Multi-Functional receptor/lymphokine? Immunol Today. 10, 153-157.
34. Gordon, J., Rowe, M., Walker, L., and Guy, G. (1986) Ligation of the CD23,p45 (BLAST-2,EBVCS) Antigen Triggers the Cell-Cycle Progression of Activated B Lymphocytes. Eur J Immunol. 16, 1075-1080.
36. Liu, Y. J., Cairns, J. A., Holder, M. J., Abbot, S. D., Jansen, K. U., Bonnefoy, J. Y., Gordon, J., and MacLennan, I. C. (1991) Recombinant 25-kDa CD23 and Interleukin 1 Alpha Promote the Survival of Germinal Center B Cells: Evidence for Bifurcation in the Development of Centrocytes Rescued from Apoptosis. Eur J Immunol. 21, 1107-1114.
37. White, L. J., Ozanne, B. W., Graber, P., Aubry, J. P., Bonnefoy, J. Y., and Cushley, W. (1997) Inhibition of Apoptosis in a Human Pre-B-Cell Line by CD23 is Mediated Via a Novel Receptor. Blood. 90, 234-243.
38. Mossalayi, M. D., Arock, M., Bertho, J. M., Blanc, C., Dalloul, A. H., Hofstetter, H., Sarfati, M., Delespesse, G., and Debre, P. (1990) Proliferation of Early Human Myeloid Precursors Induced by Interleukin-1 and Recombinant Soluble CD23. Blood. 75, 1924-1927.
39. Mossalayi, M. D., Lecron, J. C., Dalloul, A. H., Sarfati, M., Bertho, J. M., Hofstetter, H., Delespesse, G., and Debre, P. (1990) Soluble CD23 (Fc Epsilon RII) and Interleukin 1 Synergistically Induce Early Human Thymocyte Maturation. J Exp Med. 171, 959-964.
40. Bertho, J. M., Fourcade, C., Dalloul, A. H., Debre, P., and Mossalayi, M. D. (1991) Synergistic Effect of Interleukin 1 and Soluble CD23 on the Growth of Human CD4+ Bone Marrow-Derived T Cells. Eur J Immunol. 21, 1073-1076.
42. Cooper, A. M., Hobson, P. S., Jutton, M. R., Kao, M. W., Drung, B., Schmidt, B., Fear, D. J., Beavil, A. J., McDonnell, J. M., Sutton, B. J., and Gould, H. J. (2012) Soluble CD23 Controls IgE Synthesis and Homeostasis in Human B Cells. J Immunol. 188, 3199-3207.
43. McCloskey, N., Hunt, J., Beavil, R. L., Jutton, M. R., Grundy, G. J., Girardi, E., Fabiane, S. M., Fear, D. J., Conrad, D. H., Sutton, B. J., and Gould, H. J. (2007) Soluble CD23 Monomers Inhibit and Oligomers Stimulate IGE Synthesis in Human B Cells. J Biol Chem. 282, 24083-24091.
44. Chan, M. A., Gigliotti, N. M., Matangkasombut, P., Gauld, S. B., Cambier, J. C., and Rosenwasser, L. J. (2010) CD23-Mediated Cell Signaling in Human B Cells Differs from Signaling in Cells of the Monocytic Lineage. Clin Immunol. 137, 330-336.
45. Kolb, J. P., Renard, D., Dugas, B., Genot, E., Petit-Koskas, E., Sarfati, M., Delespesse, G., and Poggioli, J. (1990) Monoclonal Anti-CD23 Antibodies Induce a Rise in [Ca2+]i and Polyphosphoinositide Hydrolysis in Human Activated B Cells. Involvement of a Gp Protein. J Immunol. 145, 429-437.
46. Kolb, J. P., Abadie, A., Paul-Eugene, N., Capron, M., Sarfati, M., Dugas, B., and Delespesse, G. (1993) Ligation of CD23 Triggers Cyclic AMP Generation in Human B Lymphocytes. J Immunol. 150, 4798-4809.
47. Kolb, J. P., Paul-Eugene Dugas, N., Yamaoka, K., Mossalayi, M. D., and Dugas, B. (1995) Role of CD23 in NO Production by Human Monocytic Cells. Res Immunol. 146, 684-689.
48. Sugie, K., Kawakami, T., Maeda, Y., Kawabe, T., Uchida, A., and Yodoi, J. (1991) Fyn Tyrosine Kinase Associated with Fc Epsilon RII/CD23: Possible Multiple Roles in Lymphocyte Activation. Proc Natl Acad Sci U S A. 88, 9132-9135.
49. Yokota, A., Yukawa, K., Yamamoto, A., Sugiyama, K., Suemura, M., Tashiro, Y., Kishimoto, T., and Kikutani, H. (1992) Two Forms of the Low-Affinity Fc Receptor for IgE Differentially Mediate Endocytosis and Phagocytosis: Identification of the Critical Cytoplasmic Domains. Proc Natl Acad Sci U S A. 89, 5030-5034.
50. Mossalayi, M. D., Vouldoukis, I., Mamani-Matsuda, M., Kauss, T., Guillon, J., Maugein, J., Moynet, D., Rambert, J., Desplat, V., Mazier, D., Vincendeau, P., and Malvy, D. (2009) CD23 Mediates Antimycobacterial Activity of Human Macrophages. Infect Immun. 77, 5537-5542.
51. Bevilacqua, C., Montagnac, G., Benmerah, A., Candalh, C., Brousse, N., Cerf-Bensussan, N., Perdue, M. H., and Heyman, M. (2004) Food Allergens are Protected from Degradation during CD23-Mediated Transepithelial Transport. Int Arch Allergy Immunol. 135, 108-116.
52. Palaniyandi, S., Tomei, E., Li, Z., Conrad, D. H., and Zhu, X. (2011) CD23-Dependent Transcytosis of IgE and Immune Complex Across the Polarized Human Respiratory Epithelial Cells. J Immunol. 186, 3484-3496.
53. Stief, A., Texido, G., Sansig, G., Eibel, H., Le Gros, G., and van der Putten, H. (1994) Mice Deficient in CD23 Reveal its Modulatory Role in IgE Production but no Role in T and B Cell Development. J Immunol. 152, 3378-3390.
54. Lewis, G., Rapsomaniki, E., Bouriez, T., Crockford, T., Ferry, H., Rigby, R., Vyse, T., Lambe, T., and Cornall, R. (2004) Hyper IgE in New Zealand Black Mice due to a Dominant-Negative CD23 Mutation. Immunogenetics. 56, 564-571.
56. Yu, P., Kosco-Vilbois, M., Richards, M., Kohler, G., and Lamers, M. C. (1994) Negative Feedback Regulation of IgE Synthesis by Murine CD23. Nature. 369, 753-756.
57. Fujiwara, H., Kikutani, H., Suematsu, S., Naka, T., Yoshida, K., Yoshida, K., Tanaka, T., Suemura, M., Matsumoto, N., and Kojima, S. (1994) The Absence of IgE Antibody-Mediated Augmentation of Immune Responses in CD23-Deficient Mice. Proc Natl Acad Sci U S A. 91, 6835-6839.
|
Science Writers | Anne Murray |
Illustrators | Katherine Timer |
Authors | Kuan-Wen Wang, Jin Huk Choi, Ming Zeng, Bruce Beutler |