Phenotypic Mutation 'shaky'

• Allele: shaky
• Mutation Type: nonsense
• Chromosome: 6
• Coordinate: 111,472,752 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Grm7
• Gene Name: glutamate receptor, metabotropic 7
• Synonym(s): 6330570A01Rik, Gpr1g, mGlu7a receptor, mGluR7, E130018M02Rik
• Chromosomal Location: 110,622,542-111,544,191 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009] ; PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]
• Mapped: No
• Amino Acid Change: Lysine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000064404] [ENSMUSP00000133957] [ENSMUSP00000134635 ^†] † probably from a misspliced transcript
• AlphaFold: Q68ED2
• SMART Domains: Protein: ENSMUSP00000064404; Gene: ENSMUSG00000056755; AA Change: K864*

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	3e-108	PFAM
Pfam:Peripla_BP_6	144	371	3e-11	PFAM
Pfam:NCD3G	519	569	1.2e-13	PFAM
Pfam:7tm_3	602	847	5.1e-59	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000133957; Gene: ENSMUSG00000056755; AA Change: K864*

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	1.7e-103	PFAM
Pfam:Peripla_BP_6	144	487	1e-12	PFAM
Pfam:NCD3G	519	569	1.2e-17	PFAM
Pfam:7tm_3	600	848	1.4e-87	PFAM

• Predicted Effect: probably null
• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000134635; Gene: ENSMUSG00000056755

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	176	4.9e-20	PFAM

• Predicted Effect: probably benign
• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9754
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm, gDNA
• MMRRC Submission: 038207-MU
• Last Updated: 2019-09-04 9:46 PM by Anne Murray
• Record Created: 2015-02-25 11:55 AM by Jeff SoRelle
• Record Posted: 2015-06-18
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Jeff SoRelle, Jianhui Wang

Accession Number

NCBI RefSeq: NM_177328; MGI:1351344

Alleles Listed at MGI

All mutations/alleles(6) : Gene trapped(1) Spontaneous(1) Targeted(4)

Phenotypic Description

The shaky phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice in the pedigree R1816, some of which exhibited shaking behavior upon scruffing. Some mice also exhibited unilateral forepaw contractions that generalized and resolved within 30 seconds. In addition, the mice were hypersensitive to touch after the seizure when scruffing was attempted again for the next minute. After this episode, the seizure was unable to be provoked again.

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 77 mutations. Among these, only one affected a gene (Grm7) with known neurological functions. The mutation in Grm7 was presumed to be causative because the shaky neurological phenotype mimics other mutant alleles of Grm7 (see MGI for a list of Grm7 alleles). The Grm7 mutation in shaky is an A to T transversion at base pair 111,495,791 (v38) on chromosome 10, or base pair 850,334 in the GenBank genomic region NC_000072. The mutation corresponds to residue 2,860 in the NM_177328 mRNA sequence in exon 9 of 10 total exons and residue 2,877 in the ENSMUST00000071076 cDNA sequence in exon 9 of 11 total exons.

850319  CGGAAGCGAAGCTTCAAGGCCGTAGTCACAGCA 859     -R--K--R--S--F--K--A--V--V--T--A-

Genomic numbering corresponds to NC_000076. The mutated nucleotide is indicated in red.  The mutation results in substitution of lysine 864 (K864) for a premature stop codon (K864*) in all isoforms of the metabotropic glutamate receptor 7 (mGluR7) protein.

Protein Prediction

Figure 1. Domain structure of mGluR7a. mGluR7a is a G protein-coupled receptor with a signal peptide (SP), a ligand-binding domain (LBD), a Cys-rich domain (CYS), and seven transmembrane domains (TM). The locations of the PKC/CaM- and PICK1-binding regions are indicated. The location of the shaky mutation is shown with a red asterisk.

Figure 2. Crystal structure of the ligand-binding domain of rat mGluR1a. The two lobes, LB1 (N-terminal) and LB2 (C-terminal), are indicated. Figure was generated using UCSF Chimera and is based on PDB:1ISS

Figure 3. GPCR activation cycle. In its inactive state, the GDP-bound α subunit and the βγ complex are associated. Upon agonist binding, the GPCR undergoes conformational change and exchanges GDP for GTP in the Gα subunit. GTP-Gα and βγ dissociate and modulate effectors. Hydrolysis of GTP to GDP by RGS leads to inactivation of the G-protein.

mGluR7 is a class 3/C G-protein-coupled receptor (GPCR). Class 3 GPCRs include class B gamma-aminobutyric acid (GABA_B) receptors, taste and pheromone receptors, and calcium-sensing receptor (CaR). Class 3 GPCRs have an N-terminal signal peptide (amino acids 1-34 in mGluR7), large extracellular ligand-biding domains (LBDs), a cysteine-rich domain (CRD), seven transmembrane domains, and a variable-length intracellular C-terminal tail (Figure 1) (1). mGluR7 is highly conserved whereby human mGluR7 shares 99.5% amino acid identity with rat mGluR7 (2).

The LBD of mGluR7 mediates homodimerization. The structure of the LBD of rat mGluR1 (designated m1-LBR; see the record for donald), another class 3 GPCR, in both an active (open/closed) and resting (open/open) form have been solved [PDB: 1ISS; (3)]. Both the active and resting m1-LBR structures were a homodimer connected via a disulfide bond between Cys140 from each monomer. The role of mGluR dimerization is unknown, but is proposed to modulate the proper folding of the mGluRs, permitting the proper function of the receptor. The LBD of mGluR1 forms two lobes [LB1 (N-terminal) and LB2 (C-terminal)] connected by three short loops and separated by a cavity where glutamate binds [Figure 2; PDB: 1ISS; (3-5)]. The relative positions of LB1 and LB2 define the open and closed states of the receptor. Glutamate binding results in closing of the N-terminal lobes around the ligand. The conformational change between the open and closed forms is a rotation about an axis that passes across the three connecting loops (3;6). Within the dimer, the two LB1 domains rotate by about 70° (3). In the open/closed active state, two molecules of glutamate bind each monomer through an interaction only with the LB1 interface. In the closed state, glutamate interacts with both LB1 and LB2; full mGluR1 activation requires glutamate binding to both subunits (7).

The mGluR7 LBD is separated from the transmembrane region by a cysteine (Cys)-rich region. The Cys-rich region is essential for proper folding and trafficking of mGluRs and is proposed to be a flexible spacer that allows for the displacement of the glutamate binding pocket towards the transmembrane domains (8-11).

The second cytoplasmic loop of mGluR7 mediates coupling to a heterotrimeric G protein, promoting its downstream effects. mGluR7 couples to Gi/o proteins to inhibit cyclic AMP (cAMP) formation and protein kinase A (PKA) activation (1).  G proteins, which consist of an α subunit that binds and hydrolyzes GTP (Gα), and β and γ subunits that are constitutively associated in a complex [reviewed in (12); Figure 3].  In the absence of a stimulus, the GDP-bound α subunit and the βγ complex are associated.  Upon activation by ligand binding, the GPCR recruits its cognate heterotrimeric G protein, and undergoes a conformational change enabling it to act as guanine nucleotide exchange factor (GEF) for the G protein α subunit. GEFs promote the exchange of GDP for GTP, resulting in dissociation of the GTP-bound α subunit from the activated receptor and the βγ complex. Both the GTP-bound α subunit and the βγ complex mediate signaling by modulating the activities of other proteins, such as adenylyl cyclases, phospholipases, and ion channels. Gα signaling is terminated upon GTP hydrolysis. The GDP-bound Gα subunit reassociates with the βγ complex and is ready for another activation cycle. 

The central portion (amino acids 883-912) of the C-terminus is essential for axonal targeting of mGluR7 (13). The C-terminus of mGluR7a also mediates protein-protein interactions (14-18). Protein interacting with C kinase (PICK1) is a PDZ domain-containing protein that interacts with the PDZ-binding motif at the extreme C-terminus of mGluR7 (aa 913-915) (16-18). PICK1 attenuates PKC-mediated phosphorylation of mGluR7. A knock-in mouse expressing mGluR7a with the PDZ-binding motif (-LVI) replaced by three alanines (-AAA; mGluR7a^AAA/AAA) did not exhibit altered localization of mGluR7a (19). In addition, the mGluR7a^AAA/AAA mice did not exhibit defects in motor coordination or pain sensitivity; however, the mice exhibited defects in spatial working memory (19). In the mGluR7a^AAA/AAA mice, mGluR7a-mediated presynaptic inhibition was lost indicating that the PDZ-binding motif is essential for mGluR7a-mediated regulation of synaptic transmission. The G-protein βγ-subunits associate with amino acids 857-861 of mGluR7 (14). The calmodulin (CaM)-binding domain of mGluR7a (amino acids 864-876) can be phosphorylated by protein kinase C (PKC); PKC-mediated phosphorylation of mGluR7a inhibits the binding of CaM, while CaM binding prevents mGluR7 phosphorylation (14;15). The interaction between mGluR7, PICK1, and PKC may promote the PKC-dependent coupling of mGluR7 to the P/Q-type Ca²⁺ channels (18;20). The N- and P/Q-type Ca²⁺ channels mediate glutamate release in cerebrocortical nerve terminals. mGluR7 selectively blocks the P/Q-type Ca²⁺ channels at low (0.1 mM) extracellular calcium concentrations, but blocks N-type Ca²⁺ channels at 1.3 mM extracellular calcium concentrations (21;22).  Phosphorylation of mGluR7 by cAMP-dependent protein kinase (PKA) and cGMP-dependent protein kinase (PKG) can also inhibit the association between mGluR7 and CaM (23). PKC-, PKA-, or PKG-mediated phosphorylation of mGluR7 occurs at Ser862. Phosphorylation of Ser862 does not regulate mGluR7-mediated activation of the G protein-coupled inward rectifier potassium (GIRK) currents, indicating that another residue may also be required for kinase-mediated function. The serine/threonine protein phosphatase 1 (PP1) regulates the constitutive and agonist-induced dephosphorylation of Ser862 (24). PP1 inhibition resulted in increased Ser862 phosphorylation as well as increased mGluR7 surface expression.

Alternative splicing of Grm7 generates two isoforms of mGluR7: mGluR7a (915 amino acids) and mGluR7b (922 amino acids) that differ at their C-termini due to an out-of-frame insertion of 92 base pairs (25;26). The C-terminus of mGluR7b replaces the last 16 amino acids of mGluR7a with 23 distinct amino acids (25). The differences in the C-termini have no influence on G-protein coupling efficacy and specificity or in the efficacy to induce an inward reactivation of the current (26).

The mutation in the shaky mice results in substitution of lysine 864 (K864) for a premature stop codon in both mGluR7 isoforms. K864 is within the C-terminal tail of mGluR7 and is within the PKC/CaM-binding motif.

Expression/Localization

Within the hippocampus, Grm7 is expressed in pyramidal cells throughout the CA1-CA4 regions and in the granule cells of the dentate gyrus (1). Both the mGluR7a- and mGluR7b-encoding transcripts are expressed in the brain (e.g., hippocampus, hypothalamus, thalamus, superior and inferior colliculi, neocortex, olfactory bulb, olfactory cortex) as well as in other central nervous system regions (1;25;27;28); mGluR7a is expressed in more diverse areas than mGluR7b (27). mGluR7a and mGluR7b are expressed in axon terminals of both glutamatergic (e.g., mitral cells in the olfactory bulb, retinal ganglion neurons, and somatic sensory ganglion neurons) and GABAergic neurons (e.g., projection neurons of the striatum and Purkinje cells) (27). Within the CA3 area of the hippocampus, mGluR7 is expressed on mossy fiber terminals contacting interneurons (29) as well as in the perforant pathway and recurrent collateral axons of CA3 pyramidal cells (29). Purkinje cells of the cerebellum express Grm7, while mitral and tufted cells in the olfactory bulb express Grm7 (1;30). In humans and mouse, mGluR7 is also expressed in the hair cells and spiral ganglion cells of the inner ear (31) as well as in the colon mucosa (32). mGluR7 is primarily localized presynaptically in both glutamergic and GABAergic synapses (33-35).

Background

Figure 4. Glutamate-stimulated signaling through mGluR7 and mGluR1a. Upon presynaptic depolarization, Ca 2+ enters the presynapse through voltage-gated Ca 2+ channels (VGCCs) and induces glutamate release and CaM activation. Upon G-protein activation, PKC is recruited to mGluR7 through binding to PICK1. Activation of mGluR7 results in inhibition of adenylate cyclase activity (i.e., the formation of cAMP and ATP), the attenuation of N-type VGCCs, the activation of K + channels, and the subsequent decrease in neurotransmitter (glutamate and GABA) release. See the text for more details about mGluR7-associated signaling. Upon stimulation by glutamate, mGluR1s in the post-synaptic membrane couple to multiple signaling pathways through different G proteins. Several second messenger systems are activated upon mGluR1 activation including PKB, PLCγ, PI3K/AKT/mTOR, IP3/DAG, NFκB and CaM. The C-terminus of mGluR1 interacts with Homer proteins, which facilitate the association of mGluR1 with IP 3 receptors in the endoplasmic reticulum. Activation of these signaling pathways result in cell survival (PKC/PLD), proliferation (PKC/ERK1/2), learning, memory, and long-term potentiation (CaM), synaptic remodeling and plasticity (cAMP, PI3K/AKT/mTOR).See the record for donald for more details on the signaling pathways activated downstream of mGluR1a.

Glutamate is the major excitatory amino acid in the mammalian brain, mediating an estimated 50% of all synaptic transmission in the central nervous system [reviewed in (36)]. Glutamate is synthesized, stored, released from the presynaptic terminal, and acts through both ligand-gated ion channels (ionotropic glutamate receptors; see the record for swagger) and G-protein coupled receptors (mGluRs) on postsynaptic neurons [Figure 4; e.g., mGluR1 (see the record for donald); reviewed in (37)]. Activation of these receptors accounts for basal excitatory synaptic transmission and synaptic plasticity, such as long-term potentiation (LTP) and long-term depression (LTD) that are thought to underlie learning and memory. Glutamatergic synaptic transmission is implicated in nearly all aspects of normal brain function, including learning, memory, movement, cognition, and development. However, at elevated concentrations that excessively stimulate the same receptors, glutamate acts as a neurotoxin capable of causing extensive neuronal damage and death in the development and progression of several neurological disorders. Thus, the brain maintains very low intrasynaptic concentrations of glutamate by the action of glutamate transporters present in the plasma membrane of both glial cells and neurons.

The mGluRs transduce signals through increased ion flux and second messenger signaling pathways. The mGluRs are subdivided into three groups, designated group I, II, and III, according to agonist selectivity, coupling to different effector systems, and sequence homology. Group I includes mGluR1 and mGluR5; group II includes mGluR2 and mGluR3; and group III consists of mGluR4, mGluR6, mGluR7, and mGluR8. Group I mGluRs function in inositol phospholipid metabolism leading to increased levels of intracellular calcium, the activation of ryanodine-sensitive calcium stores (38;39), and alteration in the activity of voltage-gated channels (40-42). Both group II and III are negatively coupled to adenylate cyclase activity, leading to reduced production of cyclic AMP (cAMP) and often resulting in reduced transmitter release (43). All three mGluR groups mediate long-term synaptic plasticity including long-term potentiation and long-term depression (44;45).

At rest, mGluR7 clusters at the presynaptic active zones and associates with PICK1 (Figure 4). Upon presynaptic depolarization, Ca²⁺ enters the presynapse through voltage-gated Ca²⁺ channels (VGCCs) and induces glutamate release and CaM activation. Glutamate binding to mGluR7 induces the recruitment of the G-protein. Upon G-protein activation, PKC is recruited to mGluR7 through binding to PICK1, facilitating mGluR7 and PICK1 phosphorylation. In the absence of PKC activation, the Gβγ displaces from mGluR7 through Ca²⁺-activated CaM or by PKC-induced phosphorylation of Ser862, subsequently leading to downregulation of VGCCs. Activation of mGluR7 results in inhibition of adenylate cyclase activity (i.e., the formation of cAMP and ATP), the attenuation of N-type VGCCs, the activation of K⁺ channels, and the subsequent decrease in neurotransmitter (glutamate and GABA) release (39;46). Suppression of VGCCs results in PKC- and PICK1-dependent inhibition of synaptic transmission (47;48). mGluR7 has low affinity for glutamate and may remain inactive during normal neurotransmission, but function as a backup receptor to inhibit glutamatergic transmission in pathophysiological conditions and/or when there is excessive glutamate release (1;49).

mGluR7 is essential for the regulation of GABA-glutamate balance in the central nervous system. mGluR7 expressed on GABA-releasing neurons inhibits the release of GABA (50;51). GABA is the primary inhibitory neuromodulator. Several proteins in GABAergic neurons are essential for the synthesis of the vesicular and cytoplasmic pools of glutamate from GABA (e.g., glutamic acid decarboxylase [GAD] expressed as two isoforms, GAD65 and GAD67) as well for the synthesis of proteins that function in synaptic transmission and plasticity (e.g., the extracellular matrix protein reelin) (52). The expression of GAD65 mRNA and protein in the CA region of the hippocampus of Grm7-deficient (Grm7^-/-) mice was reduced compared to wild-type mice (52). In addition, the GAD67 mRNA and protein was reduced in the CA and dentate gyrus regions of the hippocampus in the Grm7^-/- mice compared to wild-type mice (52). Reelin expression was significantly increased in the hippocampus of the Grm7^-/- mice compared to that in wild-type mice. Taken together, mGluR7 regulates synthesis of both the neurotransmitter (via GAD65) and metabolic pool (via GAD67) of GABA and putatively the level of GABA.

In prefontal cortex pyramidal neurons, mGluR7 inhibits N-methyl-D-aspartic acid receptor (NMDAR)-mediated currents (53). NMDAR is an ionotropic glutamate receptor that can function as an ion channel to allow sodium, calcium, and potassium ions to flow through the membrane when activated. The NMDAR is essential for the regulation of synaptic plasticity and memory and NMDAR dysregulation has been associated with the pathophysiology of mental illness.

In the mouse colon, mGluR7 activation results in increased colonic secretory function (32). Treatment with AMN082, a selective mGluR7 agonist, promoted calcium signaling in a subset of submucosal neurons as well as fecal water content upon stress and electrolyte secretion (32).

In humans, GRM7 is proposed to be a risk factor for alcoholism (54) as well as a putative gene associated with schizophrenia susceptibility (55). Mutations in GRM7 have been linked to susceptibility to age-related hearing loss in a European cohort (31;56). In the inner ear, mGluR7 is proposed to regulate glutamate synaptic transmission in the cochlea at the synapses between hair cells and the dendrites of afferent auditory nerve fibers.

Putative Mechanism

The loss of mGluR7 expression and/or function results in altered synaptic transmission in the amygdala and hippocampus, subsequently leading to cognitive defects. Grm7^-/- mice display delayed learning curves (57), impaired short-term working memory (57-59), increased seizure susceptibility (60), diminished fear responses (e.g., reduced fear-related freezing responses induced by electric shock) (33;57;61;62), dysregulated stress responses (63), diminished anxiety and depression (i.e., the mice exhibited an antidepressant-like effect in the forced swim test and tail suspension test) (64;65), and diminished conditioned taste aversion [i.e., failure to associate taste (saccharin) with a negative stimulus (an injection of toxic LiCl)] (33). The Grm7^-/- mice did not exhibit defects in pain sensitivity, locomotor activity, taste preference, or sensitivity to LiCl toxicity (33). In Grm7^-/- mice, long-term potentiation could be induced, but short-term potentiation was attenuated. In addition, the frequency facilitation was altered and the post-tetanic potentiation was reduced (66). Grm7^-/- mice over 12 weeks of age developed epilepsy; mice younger than 12 weeks of age appeared normal (33). Treatment of the 12 week old (or older) Grm7^-/- mice with sub-threshold doses of two convulsant drugs (pentylenetetrazole (PTZ) and bicuculline) induced seizures; Grm7^+/- mice did not have seizures (60).

Small-interfering RNA (siRNA)-mediated knockdown of Grm7 in the mouse brain resulted in reduced anxiety-like behavior, attenuated stress-induced hyperthermia, and a reduced acoustic startle response (67). Behavioral changes were not observed among the siRNA-treated Grm7 mice in the forced swim test compared to wild-type mice. In addition, the siRNA-induced Grm7 mice did not exhibit an epilepsy-prone phenotype in contrast to Grm7^-/- mice (67).

Similar to the Grm7^-/- mice, the shaky mice exhibit increased seizure susceptibility, indicating impaired function of mGluR7^shaky. Other mGluR7-associated functions have not been assessed in the shaky mice.

Primers

PCR Primer
shaky_pcr_F: TTTAAGTATTCACACCCTATCTGCGG
shaky_pcr_R: AGCTTACTCCACAGAGCAGC

Sequencing Primer
shaky_seq_F: ACACCCTATCTGCGGTCATTG
shaky_seq_R: GCAACACACATCCCACTTTCTACAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 6, + strand):

1   tttaagtatt cacaccctat ctgcggtcat tgtatttgta atagtgcctt gtatgttgtg
61  tttcctagct ctacatacaa accaccacgc ttacaatctc catgaaccta agtgcatcag
121 tggcgctggg gatgctatac atgccgaaag tgtacatcat cattttccac cctgaactca
181 atgtccagaa acggaagcga agcttcaagg ccgtagtcac agcagccacc atgtcatcga
241 ggctgtcaca caaacccagt gacaggccca atggtgaggc aaagacagaa ctttgtgaaa
301 atgtagaccc aaacagtaag taactctgct tttatttttc catcctgcat caaaaaactg
361 tagaaagtgg gatgtgtgtt gctgctctgt ggagtaagct 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Okamoto, N., Hori, S., Akazawa, C., Hayashi, Y., Shigemoto, R., Mizuno, N., and Nakanishi, S. (1994) Molecular Characterization of a New Metabotropic Glutamate Receptor mGluR7 Coupled to Inhibitory Cyclic AMP Signal Transduction. J Biol Chem. 269, 1231-1236.

  2. Wu, S., Wright, R. A., Rockey, P. K., Burgett, S. G., Arnold, J. S., Rosteck, P. R.,Jr, Johnson, B. G., Schoepp, D. D., and Belagaje, R. M. (1998) Group III Human Metabotropic Glutamate Receptors 4, 7 and 8: Molecular Cloning, Functional Expression, and Comparison of Pharmacological Properties in RGT Cells. Brain Res Mol Brain Res. 53, 88-97.

  3. Kunishima, N., Shimada, Y., Tsuji, Y., Sato, T., Yamamoto, M., Kumasaka, T., Nakanishi, S., Jingami, H., and Morikawa, K. (2000) Structural Basis of Glutamate Recognition by a Dimeric Metabotropic Glutamate Receptor. Nature. 407, 971-977.

  4. Costantino, G., Macchiarulo, A., and Pellicciari, R. (2001) Homology Model of the Closed, Functionally Active, Form of the Amino Terminal Domain of mGlur1. Bioorg Med Chem. 9, 847-852.

  5. Costantino, G., and Pellicciari, R. (1996) Homology Modeling of Metabotropic Glutamate Receptors. (mGluRs) Structural Motifs Affecting Binding Modes and Pharmacological Profile of mGluR1 Agonists and Competitive Antagonists. J Med Chem. 39, 3998-4006.

  6. Jingami, H., Nakanishi, S., and Morikawa, K. (2003) Structure of the Metabotropic Glutamate Receptor. Curr Opin Neurobiol. 13, 271-278.

  7. Kammermeier, P. J., and Yun, J. (2005) Activation of Metabotropic Glutamate Receptor 1 Dimers Requires Glutamate Binding in both Subunits. J Pharmacol Exp Ther. 312, 502-508.

  8. Peltekova, V., Han, G., Soleymanlou, N., and Hampson, D. R. (2000) Constraints on Proper Folding of the Amino Terminal Domains of Group III Metabotropic Glutamate Receptors. Brain Res Mol Brain Res. 76, 180-190.

  9. Robbins, M. J., Ciruela, F., Rhodes, A., and McIlhinney, R. A. (1999) Characterization of the Dimerization of Metabotropic Glutamate Receptors using an N-Terminal Truncation of mGluR1alpha. J Neurochem. 72, 2539-2547.

  10. Fan, G. F., Ray, K., Zhao, X. M., Goldsmith, P. K., and Spiegel, A. M. (1998) Mutational Analysis of the Cysteines in the Extracellular Domain of the Human Ca2+ Receptor: Effects on Cell Surface Expression, Dimerization and Signal Transduction. FEBS Lett. 436, 353-356.

  11. Pace, A. J., Gama, L., and Breitwieser, G. E. (1999) Dimerization of the Calcium-Sensing Receptor Occurs within the Extracellular Domain and is Eliminated by Cys --> Ser Mutations at Cys101 and Cys236. J Biol Chem. 274, 11629-11634.

  12. Wettschureck, N., and Offermanns, S. (2005) Mammalian G Proteins and their Cell Type Specific Functions. Physiol Rev. 85, 1159-1204.

  13. Stowell, J. N., and Craig, A. M. (1999) Axon/dendrite Targeting of Metabotropic Glutamate Receptors by their Cytoplasmic Carboxy-Terminal Domains. Neuron. 22, 525-536.

  14. O'Connor, V., El Far, O., Bofill-Cardona, E., Nanoff, C., Freissmuth, M., Karschin, A., Airas, J. M., Betz, H., and Boehm, S. (1999) Calmodulin Dependence of Presynaptic Metabotropic Glutamate Receptor Signaling. Science. 286, 1180-1184.

  15. Nakajima, Y., Yamamoto, T., Nakayama, T., and Nakanishi, S. (1999) A Relationship between Protein Kinase C Phosphorylation and Calmodulin Binding to the Metabotropic Glutamate Receptor Subtype 7. J Biol Chem. 274, 27573-27577.

  16. Boudin, H., Doan, A., Xia, J., Shigemoto, R., Huganir, R. L., Worley, P., and Craig, A. M. (2000) Presynaptic Clustering of mGluR7a Requires the PICK1 PDZ Domain Binding Site. Neuron. 28, 485-497.

  17. El Far, O., Airas, J., Wischmeyer, E., Nehring, R. B., Karschin, A., and Betz, H. (2000) Interaction of the C-Terminal Tail Region of the Metabotropic Glutamate Receptor 7 with the Protein Kinase C Substrate PICK1. Eur J Neurosci. 12, 4215-4221.

  18. Dev, K. K., Nakajima, Y., Kitano, J., Braithwaite, S. P., Henley, J. M., and Nakanishi, S. (2000) PICK1 Interacts with and Regulates PKC Phosphorylation of mGLUR7. J Neurosci. 20, 7252-7257.

  19. Zhang, C. S., Bertaso, F., Eulenburg, V., Lerner-Natoli, M., Herin, G. A., Bauer, L., Bockaert, J., Fagni, L., Betz, H., and Scheschonka, A. (2008) Knock-in Mice Lacking the PDZ-Ligand Motif of mGluR7a show Impaired PKC-Dependent Autoinhibition of Glutamate Release, Spatial Working Memory Deficits, and Increased Susceptibility to Pentylenetetrazol. J Neurosci. 28, 8604-8614.

  20. Perroy, J., Gutierrez, G. J., Coulon, V., Bockaert, J., Pin, J. P., and Fagni, L. (2001) The C Terminus of the Metabotropic Glutamate Receptor Subtypes 2 and 7 Specifies the Receptor Signaling Pathways. J Biol Chem. 276, 45800-45805.

  21. Ferrero, J. J., Bartolome-Martin, D., Torres, M., and Sanchez-Prieto, J. (2013) Potentiation of mGlu7 Receptor-Mediated Glutamate Release at Nerve Terminals Containing N and P/Q Type Ca2+ Channels. Neuropharmacology. 67, 213-222.

  22. Martin, R., Torres, M., and Sanchez-Prieto, J. (2007) MGluR7 Inhibits Glutamate Release through a PKC-Independent Decrease in the Activity of P/Q-Type Ca2+ Channels and by Diminishing cAMP in Hippocampal Nerve Terminals. Eur J Neurosci. 26, 312-322.

  23. Sorensen, S. D., Macek, T. A., Cai, Z., Saugstad, J. A., and Conn, P. J. (2002) Dissociation of Protein Kinase-Mediated Regulation of Metabotropic Glutamate Receptor 7 (mGluR7) Interactions with Calmodulin and Regulation of mGluR7 Function. Mol Pharmacol. 61, 1303-1312.

  24. Suh, Y. H., Park, J. Y., Park, S., Jou, I., Roche, P. A., and Roche, K. W. (2013) Regulation of Metabotropic Glutamate Receptor 7 (mGluR7) Internalization and Surface Expression by Ser/Thr Protein Phosphatase 1. J Biol Chem. 288, 17544-17551.

  25. Flor, P. J., Van Der Putten, H., Ruegg, D., Lukic, S., Leonhardt, T., Bence, M., Sansig, G., Knopfel, T., and Kuhn, R. (1997) A Novel Splice Variant of a Metabotropic Glutamate Receptor, Human mGluR7b. Neuropharmacology. 36, 153-159.

  26. Corti, C., Restituito, S., Rimland, J. M., Brabet, I., Corsi, M., Pin, J. P., and Ferraguti, F. (1998) Cloning and Characterization of Alternative mRNA Forms for the Rat Metabotropic Glutamate Receptors mGluR7 and mGluR8. Eur J Neurosci. 10, 3629-3641.

  27. Kinoshita, A., Shigemoto, R., Ohishi, H., van der Putten, H., and Mizuno, N. (1998) Immunohistochemical Localization of Metabotropic Glutamate Receptors, mGluR7a and mGluR7b, in the Central Nervous System of the Adult Rat and Mouse: A Light and Electron Microscopic Study. J Comp Neurol. 393, 332-352.

  28. Kinzie, J. M., Saugstad, J. A., Westbrook, G. L., and Segerson, T. P. (1995) Distribution of Metabotropic Glutamate Receptor 7 Messenger RNA in the Developing and Adult Rat Brain. Neuroscience. 69, 167-176.

  29. Shigemoto, R., Kinoshita, A., Wada, E., Nomura, S., Ohishi, H., Takada, M., Flor, P. J., Neki, A., Abe, T., Nakanishi, S., and Mizuno, N. (1997) Differential Presynaptic Localization of Metabotropic Glutamate Receptor Subtypes in the Rat Hippocampus. J Neurosci. 17, 7503-7522.

  30. Saugstad, J. A., Kinzie, J. M., Mulvihill, E. R., Segerson, T. P., and Westbrook, G. L. (1994) Cloning and Expression of a New Member of the L-2-Amino-4-Phosphonobutyric Acid-Sensitive Class of Metabotropic Glutamate Receptors. Mol Pharmacol. 45, 367-372.

  31. Friedman, R. A., Van Laer, L., Huentelman, M. J., Sheth, S. S., Van Eyken, E., Corneveaux, J. J., Tembe, W. D., Halperin, R. F., Thorburn, A. Q., Thys, S., Bonneux, S., Fransen, E., Huyghe, J., Pyykko, I., Cremers, C. W., Kremer, H., Dhooge, I., Stephens, D., Orzan, E., Pfister, M., Bille, M., Parving, A., Sorri, M., Van de Heyning, P. H., Makmura, L., Ohmen, J. D., Linthicum, F. H.,Jr, Fayad, J. N., Pearson, J. V., Craig, D. W., Stephan, D. A., and Van Camp, G. (2009) GRM7 Variants Confer Susceptibility to Age-Related Hearing Impairment. Hum Mol Genet. 18, 785-796.

  32. Julio-Pieper, M., Hyland, N. P., Bravo, J. A., Dinan, T. G., and Cryan, J. F. (2010) A Novel Role for the Metabotropic Glutamate Receptor-7: Modulation of Faecal Water Content and Colonic Electrolyte Transport in the Mouse. Br J Pharmacol. 160, 367-375.

  33. Masugi, M., Yokoi, M., Shigemoto, R., Muguruma, K., Watanabe, Y., Sansig, G., van der Putten, H., and Nakanishi, S. (1999) Metabotropic Glutamate Receptor Subtype 7 Ablation Causes Deficit in Fear Response and Conditioned Taste Aversion. J Neurosci. 19, 955-963.

  34. Lafon-Cazal, M., Fagni, L., Guiraud, M. J., Mary, S., Lerner-Natoli, M., Pin, J. P., Shigemoto, R., and Bockaert, J. (1999) MGluR7-Like Metabotropic Glutamate Receptors Inhibit NMDA-Mediated Excitotoxicity in Cultured Mouse Cerebellar Granule Neurons. Eur J Neurosci. 11, 663-672.

  35. Lafon-Cazal, M., Viennois, G., Kuhn, R., Malitschek, B., Pin, J. P., Shigemoto, R., and Bockaert, J. (1999) MGluR7-Like Receptor and GABA(B) Receptor Activation Enhance Neurotoxic Effects of N-Methyl-D-Aspartate in Cultured Mouse Striatal GABAergic Neurones. Neuropharmacology. 38, 1631-1640.

  36. Rousseaux, C. G. (2008) A Review of Glutamate Receptors I: Current Understanding of their Biology. J Toxicol Pathol. 21, 25-51.

  37. Hermans, E., and Challiss, R. A. (2001) Structural, Signalling and Regulatory Properties of the Group I Metabotropic Glutamate Receptors: Prototypic Family C G-Protein-Coupled Receptors. Biochem J. 359, 465-484.

  38. Chavis, P., Fagni, L., Lansman, J. B., and Bockaert, J. (1996) Functional Coupling between Ryanodine Receptors and L-Type Calcium Channels in Neurons. Nature. 382, 719-722.

  39. Fagni, L., Chavis, P., Ango, F., and Bockaert, J. (2000) Complex Interactions between mGluRs, Intracellular Ca2+ Stores and Ion Channels in Neurons. Trends Neurosci. 23, 80-88.

  40. Guerineau, N. C., Bossu, J. L., Gahwiler, B. H., and Gerber, U. (1995) Activation of a Nonselective Cationic Conductance by Metabotropic Glutamatergic and Muscarinic Agonists in CA3 Pyramidal Neurons of the Rat Hippocampus. J Neurosci. 15, 4395-4407.

  41. Guerineau, N. C., Gahwiler, B. H., and Gerber, U. (1994) Reduction of Resting K+ Current by Metabotropic Glutamate and Muscarinic Receptors in Rat CA3 Cells: Mediation by G-Proteins. J Physiol. 474, 27-33.

  42. Swartz, K. J., and Bean, B. P. (1992) Inhibition of Calcium Channels in Rat CA3 Pyramidal Neurons by a Metabotropic Glutamate Receptor. J Neurosci. 12, 4358-4371.

  43. Cartmell, J., and Schoepp, D. D. (2000) Regulation of Neurotransmitter Release by Metabotropic Glutamate Receptors. J Neurochem. 75, 889-907.

  44. Anwyl, R. (1999) Metabotropic Glutamate Receptors: Electrophysiological Properties and Role in Plasticity. Brain Res Brain Res Rev. 29, 83-120.

  45. Bellone, C., Luscher, C., and Mameli, M. (2008) Mechanisms of Synaptic Depression Triggered by Metabotropic Glutamate Receptors. Cell Mol Life Sci. 65, 2913-2923.

  46. Pin, J. P., and Duvoisin, R. (1995) The Metabotropic Glutamate Receptors: Structure and Functions. Neuropharmacology. 34, 1-26.

  47. Perroy, J., El Far, O., Bertaso, F., Pin, J. P., Betz, H., Bockaert, J., and Fagni, L. (2002) PICK1 is Required for the Control of Synaptic Transmission by the Metabotropic Glutamate Receptor 7. EMBO J. 21, 2990-2999.

  48. Perroy, J., Prezeau, L., De Waard, M., Shigemoto, R., Bockaert, J., and Fagni, L. (2000) Selective Blockade of P/Q-Type Calcium Channels by the Metabotropic Glutamate Receptor Type 7 Involves a Phospholipase C Pathway in Neurons. J Neurosci. 20, 7896-7904.

  49. Ferraguti, F., and Shigemoto, R. (2006) Metabotropic Glutamate Receptors. Cell Tissue Res. 326, 483-504.

  50. O'Connor, R. M., Finger, B. C., Flor, P. J., and Cryan, J. F. (2010) Metabotropic Glutamate Receptor 7: At the Interface of Cognition and Emotion. Eur J Pharmacol. 639, 123-131.

  51. Swanson, C. J., Bures, M., Johnson, M. P., Linden, A. M., Monn, J. A., and Schoepp, D. D. (2005) Metabotropic Glutamate Receptors as Novel Targets for Anxiety and Stress Disorders. Nat Rev Drug Discov. 4, 131-144.

  52. Wieronska, J. M., Branski, P., Siwek, A., Dybala, M., Nowak, G., and Pilc, A. (2010) GABAergic Dysfunction in mGlu7 Receptor-Deficient Mice as Reflected by Decreased Levels of Glutamic Acid Decarboxylase 65 and 67kDa and Increased Reelin Proteins in the Hippocampus. Brain Res. 1334, 12-24.

  53. Gu, Z., Liu, W., Wei, J., and Yan, Z. (2012) Regulation of N-Methyl-D-Aspartic Acid (NMDA) Receptors by Metabotropic Glutamate Receptor 7. J Biol Chem. 287, 10265-10275.

  54. Vadasz, C., Saito, M., Gyetvai, B. M., Oros, M., Szakall, I., Kovacs, K. M., Prasad, V. V., and Toth, R. (2007) Glutamate Receptor Metabotropic 7 is Cis-Regulated in the Mouse Brain and Modulates Alcohol Drinking. Genomics. 90, 690-702.

  55. Pulver, A. E., Lasseter, V. K., Kasch, L., Wolyniec, P., Nestadt, G., Blouin, J. L., Kimberland, M., Babb, R., Vourlis, S., and Chen, H. (1995) Schizophrenia: A Genome Scan Targets Chromosomes 3p and 8p as Potential Sites of Susceptibility Genes. Am J Med Genet. 60, 252-260.

  56. Newman, D. L., Fisher, L. M., Ohmen, J., Parody, R., Fong, C. T., Frisina, S. T., Mapes, F., Eddins, D. A., Robert Frisina, D., Frisina, R. D., and Friedman, R. A. (2012) GRM7 Variants Associated with Age-Related Hearing Loss Based on Auditory Perception. Hear Res. 294, 125-132.

  57. Callaerts-Vegh, Z., Beckers, T., Ball, S. M., Baeyens, F., Callaerts, P. F., Cryan, J. F., Molnar, E., and D'Hooge, R. (2006) Concomitant Deficits in Working Memory and Fear Extinction are Functionally Dissociated from Reduced Anxiety in Metabotropic Glutamate Receptor 7-Deficient Mice. J Neurosci. 26, 6573-6582.

  58. Holscher, C., Schmid, S., Pilz, P. K., Sansig, G., van der Putten, H., and Plappert, C. F. (2005) Lack of the Metabotropic Glutamate Receptor Subtype 7 Selectively Modulates Theta Rhythm and Working Memory. Learn Mem. 12, 450-455.

  59. Holscher, C., Schmid, S., Pilz, P. K., Sansig, G., van der Putten, H., and Plappert, C. F. (2004) Lack of the Metabotropic Glutamate Receptor Subtype 7 Selectively Impairs Short-Term Working Memory but Not Long-Term Memory. Behav Brain Res. 154, 473-481.

  60. Sansig, G., Bushell, T. J., Clarke, V. R., Rozov, A., Burnashev, N., Portet, C., Gasparini, F., Schmutz, M., Klebs, K., Shigemoto, R., Flor, P. J., Kuhn, R., Knoepfel, T., Schroeder, M., Hampson, D. R., Collett, V. J., Zhang, C., Duvoisin, R. M., Collingridge, G. L., and van Der Putten, H. (2001) Increased Seizure Susceptibility in Mice Lacking Metabotropic Glutamate Receptor 7. J Neurosci. 21, 8734-8745.

  61. Fendt, M., Imobersteg, S., Peterlik, D., Chaperon, F., Mattes, C., Wittmann, C., Olpe, H. R., Mosbacher, J., Vranesic, I., van der Putten, H., McAllister, K. H., Flor, P. J., and Gee, C. E. (2013) Differential Roles of mGlu(7) and mGlu(8) in Amygdala-Dependent Behavior and Physiology. Neuropharmacology. 72, 215-223.

  62. Fendt, M., Schmid, S., Thakker, D. R., Jacobson, L. H., Yamamoto, R., Mitsukawa, K., Maier, R., Natt, F., Husken, D., Kelly, P. H., McAllister, K. H., Hoyer, D., van der Putten, H., Cryan, J. F., and Flor, P. J. (2008) MGluR7 Facilitates Extinction of Aversive Memories and Controls Amygdala Plasticity. Mol Psychiatry. 13, 970-979.

  63. Mitsukawa, K., Mombereau, C., Lotscher, E., Uzunov, D. P., van der Putten, H., Flor, P. J., and Cryan, J. F. (2006) Metabotropic Glutamate Receptor Subtype 7 Ablation Causes Dysregulation of the HPA Axis and Increases Hippocampal BDNF Protein Levels: Implications for Stress-Related Psychiatric Disorders. Neuropsychopharmacology. 31, 1112-1122.

  64. Cryan, J. F., Kelly, P. H., Neijt, H. C., Sansig, G., Flor, P. J., and van Der Putten, H. (2003) Antidepressant and Anxiolytic-Like Effects in Mice Lacking the Group III Metabotropic Glutamate Receptor mGluR7. Eur J Neurosci. 17, 2409-2417.

  65. Palucha, A., Klak, K., Branski, P., van der Putten, H., Flor, P. J., and Pilc, A. (2007) Activation of the mGlu7 Receptor Elicits Antidepressant-Like Effects in Mice. Psychopharmacology (Berl). 194, 555-562.

  66. Bushell, T. J., Sansig, G., Collett, V. J., van der Putten, H., and Collingridge, G. L. (2002) Altered Short-Term Synaptic Plasticity in Mice Lacking the Metabotropic Glutamate Receptor mGlu7. ScientificWorldJournal. 2, 730-737.

  67. O'Connor, R. M., Thakker, D. R., Schmutz, M., van der Putten, H., Hoyer, D., Flor, P. J., and Cryan, J. F. (2013) Adult siRNA-Induced Knockdown of mGlu7 Receptors Reduces Anxiety in the Mouse. Neuropharmacology. 72, 66-73.