Phenotypic Mutation 'yosemite' (pdf version)
List |< first << previous [record 21 of 30] next >> last >|
Alleleyosemite
Mutation Type critical splice donor site (1 bp from exon)
Chromosome7
Coordinate30,869,509 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Cd22
Gene Name CD22 antigen
Synonym(s) Lyb-8, Lyb8
Chromosomal Location 30,865,402-30,880,342 bp (-)
MGI Phenotype PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001043317.2, NM_009845.3; MGI: 88322

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000019248] [ENSMUSP00000103760] [ENSMUSP00000139685] [ENSMUSP00000141178] [ENSMUSP00000140521] [ENSMUSP00000139871] [ENSMUSP00000140528] [ENSMUSP00000150025]
SMART Domains Protein: ENSMUSP00000019248
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000103760
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000139685
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably null
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000140521
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably null
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000139871
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000140528
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
IG_like 166 245 1.6e-2 SMART
IGc2 269 337 1.1e-6 SMART
Predicted Effect probably benign
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased 15378059
FACS B1a cells - increased
FACS B1a cells in B1 cells - increased
FACS B1b cells in B1 cells - decreased 8864124
FACS B2 cells - decreased
FACS CD8a+ DCs (gated in CD11c+ cells) - decreased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS IgD+ B cell percentage - decreased 15378059
FACS IgM+ B cells - decreased 15378059
post-MCMV FACS B cells - decreased 15378059
post-MCMV FACS B:T cells - decreased
post-MCMV FACS B1a cells - increased
post-MCMV FACS B1a cells in B1 cells - decreased
post-MCMV FACS B2 cells - decreased
post-MCMV FACS IgD+ B cell percentage - decreased 15378059
post-MCMV FACS IgM+ B cells - decreased 15378059
Penetrance  
Alleles Listed at MGI

All mutations/alleles(16) : Chemically induced (ENU)(3) Targeted(13)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Cd22 APN 7 30876147 missense probably benign 0.01
IGL02236:Cd22 APN 7 30867468 missense possibly damaging 0.54
IGL02321:Cd22 APN 7 30869883 missense probably damaging 1.00
IGL02335:Cd22 APN 7 30876134 missense probably damaging 1.00
IGL02397:Cd22 APN 7 30877625 missense probably benign
IGL02402:Cd22 APN 7 30877530 missense possibly damaging 0.86
IGL02538:Cd22 APN 7 30877560 missense probably benign 0.40
IGL02736:Cd22 APN 7 30878045 splice site probably null
crullers UTSW 7 30869883 missense probably damaging 1.00
gansu UTSW 7 30870105 missense probably damaging 1.00
rain UTSW 7 30877534 missense probably damaging 1.00
well UTSW 7 30877787 nonsense
FR4304:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4340:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4342:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4589:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
LCD18:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
PIT4142001:Cd22 UTSW 7 30877799 missense possibly damaging 0.92
R0123:Cd22 UTSW 7 30867108 splice site probably benign
R0130:Cd22 UTSW 7 30869964 missense possibly damaging 0.92
R0926:Cd22 UTSW 7 30869509 critical splice donor site probably null
R1245:Cd22 UTSW 7 30869883 missense probably damaging 1.00
R1332:Cd22 UTSW 7 30870487 missense possibly damaging 0.48
R1457:Cd22 UTSW 7 30873170 missense probably benign 0.07
R1716:Cd22 UTSW 7 30877678 missense probably damaging 1.00
R1980:Cd22 UTSW 7 30873233 missense probably damaging 1.00
R2017:Cd22 UTSW 7 30872780 missense probably damaging 0.99
R2061:Cd22 UTSW 7 30870105 missense probably damaging 1.00
R2061:Cd22 UTSW 7 30876156 missense probably benign 0.03
R2075:Cd22 UTSW 7 30869698 missense probably damaging 1.00
R2216:Cd22 UTSW 7 30867046 missense probably damaging 1.00
R3886:Cd22 UTSW 7 30870107 missense possibly damaging 0.57
R4599:Cd22 UTSW 7 30875900 missense probably damaging 0.98
R4701:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R4796:Cd22 UTSW 7 30872956 synonymous probably null
R5179:Cd22 UTSW 7 30875874 missense possibly damaging 0.81
R5233:Cd22 UTSW 7 30877534 missense probably damaging 1.00
R5456:Cd22 UTSW 7 30876039 missense probably benign 0.02
R5511:Cd22 UTSW 7 30870071 missense probably damaging 1.00
R5513:Cd22 UTSW 7 30867025 missense probably damaging 0.99
R5611:Cd22 UTSW 7 30878150 unclassified probably benign
R5656:Cd22 UTSW 7 30869773 missense probably damaging 1.00
R5966:Cd22 UTSW 7 30866658 missense probably damaging 1.00
R6329:Cd22 UTSW 7 30877768 missense probably damaging 0.99
R6356:Cd22 UTSW 7 30877702 missense probably damaging 1.00
R6455:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R6550:Cd22 UTSW 7 30877552 missense probably benign 0.00
R6656:Cd22 UTSW 7 30877757 missense probably benign 0.11
R6688:Cd22 UTSW 7 30872964 missense possibly damaging 0.91
R6844:Cd22 UTSW 7 30873431 splice site probably null
R6957:Cd22 UTSW 7 30867574 missense possibly damaging 0.88
X0025:Cd22 UTSW 7 30873419 unclassified probably null
Mode of Inheritance Autosomal Recessive
Local Stock
MMRRC Submission 038179-MU
Last Updated 2017-08-03 4:07 PM by Diantha La Vine
Record Created 2015-03-04 10:50 AM by Anne Murray
Record Posted 2015-03-31
Phenotypic Description
Figure 1. Yosemite mice exhibit a reduced frequency of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine the frequency of B cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Yosemite mice exhibit an increased frequency of peripheral B1a cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine the frequency of B1a cells in B1 cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Yosemite mice exhibit a decreased frequency of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM+ B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Yosemite mice exhibit a decreased percentage of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD+ B cell percentage. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The yosemite phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R0926, some of which showed a decrease in the frequency of B cells (Figure 1), an increased frequency of B1a cells in B1 cells (Figure 2), a reduced frequency of IgM+ B cells (Figure 3), a decrease in the percentage of IgD+ B cells (Figure 4), all in the peripheral blood.

Nature of Mutation

Figure 5. Linkage mapping of the reduced peripheral B1a in B1 cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 61 mutations (X-axis) identified in the G1 male of pedigree R0926. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 61 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Cd22:  a G to T transversion at base pair 30,869,509 (v38) on chromosome 7, or base pair 10,834 in the GenBank genomic region NC_000073 within the donor splice site of intron 9. The strongest association was found with an additive model of linkage to the normalized frequency of peripheral B1a cells in B1 cells, wherein 1 variant homozygote and 14 heterozygotes departed phenotypically from 10 homozygous reference mice with a P value of 3.57 x 10-4 (Figure 5).  A substantial semidominant effect was observed in the B1a assay, but the mutation is preponderantly recessive; in no assay was a purely dominant effect observed. The mutation is predicted to result in an in-frame skipping of the 264-nucleotide exon 9 (out of 14 total exons), which encodes amino acids 612-699. The effect of the mutation at the cDNA and protein level has not been tested.

 

            <--exon 8      <--exon 9 intron 9-->    exon 10-->           <--exon 14

10473 ……CTCCAAGTGCTGT……CTCACTGTCTACT gtaagttcccctt……ACAGTCCAGAGACC……ACCCTCAAGCACTGA

607   ……-L--Q--V--L--……-L--T--V--Y--                Y--S--P--E--T-……-T--L--K--H--*-

          correct         deleted                               correct

 

Genomic numbering corresponds to NC_000073. The donor splice site of intron 9, which is destroyed by the yosemite mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 6. Domain structure of CD22. The yosemite mutation is within the donor splice site of intron 9. Abbreviations: SP, signaling peptide; TM, transmembrane domain; ITIM, immunoreceptor tyrosine-based inhibitory motif.

CD22 belongs to the Siglec (sialic acid-binding) family of adhesion molecules (1;2) (Figure 6). Siglecs are members of the immunoglobulin (Ig) superfamily, which specifically recognize sialic acids attached to the terminal regions of cell-surface glycoconjugates. Siglec proteins are type 1 transmembrane proteins with a sialic acid-binding N-terminal Ig-like V-type domain, variable numbers of Ig-like C2-type domains, a transmembrane region, and a cytoplasmic tail.  CD22 contains seven immunoglobulin domains in its extracellular region at amino acids 31-147, 156-254, 269-337, 365-424,448-523, 541-599, and 628-687 (1).  The yosemite mutation is predicted to result in the deletion of amino acids 612-699 the seventh immunoglobulin domain.

 

See the record well for more information about Cd22.

Putative Mechanism

CD22 is one of two Siglecs expressed by B cells (the other being Siglec-G), and was originally identified as a B cell-associated adhesion protein that functions in the regulation of B cell activation [reviewed in (3;4)].  CD22 associates with a number of BCR signaling molecules including the BCR complex itself.  Upon cross-linking of the BCR by antigen, associated CD22 is rapidly phosphorylated by Lyn (5-7).  The subsequent association of SHP1 with CD22 leads to the dephosphorylation of a number of BCR signaling components that dampens the BCR signal and Ca2+ mobilization such as Vav-1, CD19 and BLNK (8-10). In response to BCR stimulation, CD22-deficient B cells predominantly undergo apoptosis (11).  Although CD22 appears to be dispensable for the differentiation of B cells to mature follicular cells, CD22-deficient B cells express less surface IgM, which may be a consequence of a faster and more complete maturation process. In addition, CD22-deficient mice have severely reduced numbers of marginal zone B (MZB) cells, and increased numbers of B-1 peritoneal cells was observed in two of the four knockout strains (12-15). The loss of MZB cells and increased B-1 cell numbers in these mice may be due to altered BCR signaling during development as maturation into the three mature B cell subsets is driven in part by differences in BCR signal strength, and a strong BCR signal disrupts MZB development and promotes B-1 differentiation [reviewed by (16;17)]. Due to the lack of MZB cells, these animals display impaired immune responses to T-independent antigens (12;15;18), while T-dependent immune responses remain intact and subsequent germinal center formation occurs normally (11). Mice carrying the yosemite allele share several phenotypes with the Cd22 knockout mice including defects in peripheral B cell maturation that are likely caused by reduced MZB cell numbers. A defect in immune responses to T-dependent or T-independent antigens was not observed in the yosemite mice indicating that some residual CD22 function may occur in the yosemite mice.

Primers PCR Primer
yosemite(F):5'- ATCCATCAAGGGCGAGATTGGC -3'
yosemite(R):5'- AACCTCCAAGTGCTGTGTGAGTG -3'

Sequencing Primer
yosemite_seq(F):5'- GGGCGAGATTGGCATGTAG -3'
yosemite_seq(R):5'- CTGTGAGAGTGATGCCAATCC -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
List |< first << previous [record 21 of 30] next >> last >|